##gff-version 3
##gvf-version 1.07
##file-date 2020-05-22
##genome-build ensembl ASM465v1
##species http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=39946
##feature-ontology http://song.cvs.sourceforge.net/viewvc/song/ontology/so.obo?revision=1.283
##data-source Source=ensembl;version=101;url=http://plants.ensembl.org/Oryza_sativa_Indica_Group
##file-version 101
##sequence-region CH398455.1 1 17488
##sequence-region CH399874.1 1 4280
##sequence-region CH400166.1 1 3569
##sequence-region AAAA02037089.1 1 12380
##sequence-region AAAA02038338.1 1 8078
##sequence-region CH400062.1 1 3804
##sequence-region AAAA02045985.1 1 2811
##sequence-region CH399755.1 1 4614
##sequence-region CH399743.1 1 4635
##sequence-region AAAA02049309.1 1 2145
##sequence-region AAAA02047261.1 1 2507
##sequence-region CH400874.1 1 2332
##sequence-region AAAA02041857.1 1 4332
##sequence-region AAAA02049754.1 1 2073
##sequence-region AAAA02043871.1 1 3410
##sequence-region CH398677.1 1 11315
##sequence-region AAAA02049486.1 1 2120
##sequence-region AAAA02048260.1 1 2313
##sequence-region AAAA02041150.1 1 4751
##sequence-region AAAA02040707.1 1 5051
##sequence-region AAAA02039951.1 1 5687
##sequence-region CH398431.1 1 18448
##sequence-region AAAA02043361.1 1 3605
##sequence-region CH400640.1 1 2709
##sequence-region AAAA02042055.1 1 4213
##sequence-region AAAA02044679.1 1 3158
##sequence-region AAAA02042462.1 1 4023
##sequence-region CH399936.1 1 4137
##sequence-region CH399154.1 1 7024
##sequence-region AAAA02047630.1 1 2431
##sequence-region AAAA02042349.1 1 4079
##sequence-region AAAA02046237.1 1 2754
##sequence-region CH398696.1 1 11060
##sequence-region AAAA02043979.1 1 3381
##sequence-region CH398963.1 1 8218
##sequence-region AAAA02045004.1 1 3068
##sequence-region AAAA02044024.1 1 3362
##sequence-region CH398496.1 1 15800
##sequence-region AAAA02046367.1 1 2715
##sequence-region CH401044.1 1 2143
##sequence-region CH399114.1 1 7205
##sequence-region CH398480.1 1 16786
##sequence-region AAAA02047788.1 1 2403
##sequence-region AAAA02040763.1 1 5006
##sequence-region CH399119.1 1 7193
##sequence-region AAAA02048833.1 1 2219
##sequence-region AAAA02043121.1 1 3708
##sequence-region AAAA02043338.1 1 3612
##sequence-region AAAA02039853.1 1 5785
##sequence-region CH400900.1 1 2309
##sequence-region AAAA02050016.1 1 2032
##sequence-region CH401038.1 1 2150
##sequence-region AAAA02043090.1 1 3718
##sequence-region CH399311.1 1 6173
##sequence-region CH400222.1 1 3448
##sequence-region AAAA02044412.1 1 3245
##sequence-region AAAA02046357.1 1 2720
##sequence-region CH400294.1 1 3317
##sequence-region AAAA02046591.1 1 2661
##sequence-region AAAA02049593.1 1 2103
##sequence-region AAAA02045938.1 1 2820
##sequence-region AAAA02040026.1 1 5591
##sequence-region AAAA02043905.1 1 3402
##sequence-region CH399853.1 1 4332
##sequence-region CH399890.1 1 4248
##sequence-region AAAA02042480.1 1 4016
##sequence-region CH400885.1 1 2325
##sequence-region CH399273.1 1 6325
##sequence-region AAAA02049445.1 1 2126
##sequence-region AAAA02047672.1 1 2425
##sequence-region AAAA02040642.1 1 5103
##sequence-region AAAA02046334.1 1 2728
##sequence-region AAAA02043795.1 1 3432
##sequence-region AAAA02045030.1 1 3061
##sequence-region CH399940.1 1 4129
##sequence-region AAAA02038077.1 1 8685
##sequence-region AAAA02046132.1 1 2779
##sequence-region AAAA02044511.1 1 3206
##sequence-region AAAA02049062.1 1 2184
##sequence-region AAAA02043326.1 1 3615
##sequence-region AAAA02040531.1 1 5173
##sequence-region AAAA02046344.1 1 2723
##sequence-region AAAA02041644.1 1 4453
##sequence-region AAAA02048834.1 1 2219
##sequence-region CH399218.1 1 6739
##sequence-region AAAA02039238.1 1 6617
##sequence-region AAAA02044353.1 1 3263
##sequence-region CH401016.1 1 2171
##sequence-region AAAA02038122.1 1 8592
##sequence-region CH399028.1 1 7716
##sequence-region AAAA02049663.1 1 2089
##sequence-region CH400399.1 1 3105
##sequence-region AAAA02038317.1 1 8146
##sequence-region AAAA02041700.1 1 4421
##sequence-region CH400400.1 1 3104
##sequence-region AAAA02039565.1 1 6135
##sequence-region AAAA02043425.1 1 3582
##sequence-region CH399805.1 1 4453
##sequence-region CH400819.1 1 2410
##sequence-region AAAA02041379.1 1 4625
##sequence-region CH399887.1 1 4259
##sequence-region AAAA02043638.1 1 3498
##sequence-region AAAA02042861.1 1 3815
##sequence-region AAAA02044700.1 1 3149
##sequence-region AAAA02039303.1 1 6489
##sequence-region AAAA02040674.1 1 5083
##sequence-region AAAA02040262.1 1 5378
##sequence-region CH399065.1 1 7505
##sequence-region CH399270.1 1 6383
##sequence-region CH398822.1 1 9606
##sequence-region AAAA02047399.1 1 2471
##sequence-region AAAA02045368.1 1 2970
##sequence-region CH400309.1 1 3287
##sequence-region AAAA02041531.1 1 4528
##sequence-region AAAA02046907.1 1 2589
##sequence-region AAAA02041439.1 1 4596
##sequence-region AAAA02039287.1 1 6533
##sequence-region AAAA02041608.1 1 4477
##sequence-region CH399166.1 1 6965
##sequence-region CH400849.1 1 2369
##sequence-region AAAA02040608.1 1 5122
##sequence-region CH399202.1 1 6795
##sequence-region CH398259.1 1 43446
##sequence-region AAAA02039671.1 1 5996
##sequence-region CH398713.1 1 10841
##sequence-region AAAA02039620.1 1 6062
##sequence-region CH398676.1 1 11321
##sequence-region AAAA02047566.1 1 2443
##sequence-region CH399565.1 1 5132
##sequence-region AAAA02041433.1 1 4599
##sequence-region CH398562.1 1 13802
##sequence-region CH400396.1 1 3109
##sequence-region CH398738.1 1 10531
##sequence-region CH399751.1 1 4623
##sequence-region AAAA02037377.1 1 11043
##sequence-region CH399637.1 1 4918
##sequence-region CH399221.1 1 6714
##sequence-region AAAA02037593.1 1 10252
##sequence-region AAAA02038654.1 1 7491
##sequence-region AAAA02048128.1 1 2341
##sequence-region AAAA02041297.1 1 4668
##sequence-region AAAA02041788.1 1 4375
##sequence-region AAAA02047581.1 1 2440
##sequence-region CH401057.1 1 2129
##sequence-region AAAA02043407.1 1 3588
##sequence-region AAAA02037248.1 1 11669
##sequence-region AAAA02042780.1 1 3848
##sequence-region AAAA02045977.1 1 2813
##sequence-region CH398235.1 1 93296
##sequence-region AAAA02049799.1 1 2065
##sequence-region AAAA02043713.1 1 3471
##sequence-region CH399287.1 1 6277
##sequence-region AAAA02045765.1 1 2862
##sequence-region CH399873.1 1 4280
##sequence-region AAAA02039026.1 1 6921
##sequence-region AAAA02044628.1 1 3173
##sequence-region CH398323.1 1 26047
##sequence-region AAAA02042621.1 1 3941
##sequence-region AAAA02043709.1 1 3474
##sequence-region AAAA02044116.1 1 3336
##sequence-region AAAA02044514.1 1 3204
##sequence-region AAAA02041533.1 1 4521
##sequence-region AAAA02043908.1 1 3401
##sequence-region AAAA02038583.1 1 7610
##sequence-region AAAA02045900.1 1 2827
##sequence-region AAAA02036749.1 1 15090
##sequence-region AAAA02037136.1 1 12038
##sequence-region CH399315.1 1 6153
##sequence-region CH400950.1 1 2251
##sequence-region AAAA02038501.1 1 7761
##sequence-region CH399213.1 1 6757
##sequence-region AAAA02039273.1 1 6567
##sequence-region AAAA02036413.1 1 18365
##sequence-region CH399278.1 1 6310
##sequence-region AAAA02048661.1 1 2247
##sequence-region CH399742.1 1 4637
##sequence-region AAAA02039302.1 1 6491
##sequence-region AAAA02038900.1 1 7091
##sequence-region AAAA02039344.1 1 6420
##sequence-region AAAA02041520.1 1 4538
##sequence-region AAAA02040298.1 1 5353
##sequence-region CH398990.1 1 7980
##sequence-region AAAA02049958.1 1 2041
##sequence-region AAAA02049939.1 1 2043
##sequence-region CH399427.1 1 5631
##sequence-region AAAA02045910.1 1 2825
##sequence-region AAAA02039378.1 1 6371
##sequence-region AAAA02043122.1 1 3708
##sequence-region CH400198.1 1 3508
##sequence-region CH399099.1 1 7284
##sequence-region AAAA02049484.1 1 2120
##sequence-region AAAA02040818.1 1 4967
##sequence-region AAAA02043377.1 1 3599
##sequence-region AAAA02047696.1 1 2420
##sequence-region AAAA02045564.1 1 2911
##sequence-region AAAA02048357.1 1 2297
##sequence-region AAAA02047543.1 1 2446
##sequence-region CH398784.1 1 10049
##sequence-region CH399296.1 1 6241
##sequence-region AAAA02049211.1 1 2161
##sequence-region AAAA02046309.1 1 2734
##sequence-region AAAA02049651.1 1 2092
##sequence-region AAAA02039523.1 1 6185
##sequence-region AAAA02045723.1 1 2872
##sequence-region AAAA02045591.1 1 2905
##sequence-region AAAA02049409.1 1 2132
##sequence-region CH400247.1 1 3407
##sequence-region AAAA02048555.1 1 2263
##sequence-region CH399295.1 1 6248
##sequence-region CH400282.1 1 3337
##sequence-region CH399773.1 1 4556
##sequence-region AAAA02047866.1 1 2389
##sequence-region AAAA02036631.1 1 16041
##sequence-region CH399030.1 1 7699
##sequence-region AAAA02035660.1 1 39108
##sequence-region AAAA02037697.1 1 9952
##sequence-region CH400614.1 1 2756
##sequence-region AAAA02049730.1 1 2077
##sequence-region AAAA02045490.1 1 2932
##sequence-region AAAA02044712.1 1 3145
##sequence-region CH398813.1 1 9711
##sequence-region AAAA02043149.1 1 3696
##sequence-region CH398706.1 1 10959
##sequence-region AAAA02040999.1 1 4858
##sequence-region AAAA02044774.1 1 3128
##sequence-region CH399074.1 1 7458
##sequence-region CH398750.1 1 10374
##sequence-region AAAA02045033.1 1 3060
##sequence-region AAAA02040119.1 1 5511
##sequence-region AAAA02039885.1 1 5758
##sequence-region CH398361.1 1 22094
##sequence-region AAAA02039521.1 1 6186
##sequence-region CH398499.1 1 15746
##sequence-region AAAA02045780.1 1 2858
##sequence-region CH400380.1 1 3136
##sequence-region CH398447.1 1 17798
##sequence-region AAAA02040993.1 1 4866
##sequence-region AAAA02047474.1 1 2456
##sequence-region AAAA02037698.1 1 9949
##sequence-region AAAA02037080.1 1 12432
##sequence-region CH400061.1 1 3805
##sequence-region AAAA02041598.1 1 4481
##sequence-region AAAA02038732.1 1 7340
##sequence-region AAAA02045565.1 1 2911
##sequence-region AAAA02047189.1 1 2524
##sequence-region AAAA02041429.1 1 4601
##sequence-region AAAA02042290.1 1 4115
##sequence-region AAAA02041017.1 1 4846
##sequence-region AAAA02048650.1 1 2248
##sequence-region AAAA02048933.1 1 2204
##sequence-region CH401135.1 1 2035
##sequence-region AAAA02038249.1 1 8292
##sequence-region CH398658.1 1 11660
##sequence-region AAAA02048657.1 1 2247
##sequence-region AAAA02046398.1 1 2710
##sequence-region AAAA02047312.1 1 2491
##sequence-region AAAA02039092.1 1 6836
##sequence-region CH400017.1 1 3915
##sequence-region AAAA02047252.1 1 2511
##sequence-region AAAA02041074.1 1 4798
##sequence-region CH398574.1 1 13475
##sequence-region CH400414.1 1 3087
##sequence-region AAAA02049533.1 1 2111
##sequence-region AAAA02041866.1 1 4328
##sequence-region CH399929.1 1 4147
##sequence-region AAAA02044496.1 1 3210
##sequence-region AAAA02044573.1 1 3189
##sequence-region AAAA02041333.1 1 4646
##sequence-region AAAA02043154.1 1 3696
##sequence-region AAAA02048124.1 1 2341
##sequence-region CH398661.1 1 11555
##sequence-region AAAA02043899.1 1 3404
##sequence-region CH399358.1 1 5945
##sequence-region AAAA02038797.1 1 7226
##sequence-region AAAA02041605.1 1 4479
##sequence-region CH399478.1 1 5448
##sequence-region AAAA02043191.1 1 3681
##sequence-region AAAA02041547.1 1 4512
##sequence-region AAAA02035472.1 1 64592
##sequence-region AAAA02045053.1 1 3057
##sequence-region AAAA02041548.1 1 4512
##sequence-region AAAA02042075.1 1 4200
##sequence-region CH400010.1 1 3943
##sequence-region AAAA02046175.1 1 2769
##sequence-region CH399964.1 1 4073
##sequence-region AAAA02038182.1 1 8425
##sequence-region CH398556.1 1 13978
##sequence-region AAAA02037325.1 1 11286
##sequence-region AAAA02041726.1 1 4405
##sequence-region AAAA02049944.1 1 2043
##sequence-region AAAA02045638.1 1 2897
##sequence-region AAAA02045575.1 1 2908
##sequence-region AAAA02044458.1 1 3224
##sequence-region AAAA02048436.1 1 2283
##sequence-region AAAA02039937.1 1 5708
##sequence-region CH399841.1 1 4361
##sequence-region CH399341.1 1 6027
##sequence-region AAAA02044258.1 1 3291
##sequence-region AAAA02042153.1 1 4161
##sequence-region CH398379.1 1 20857
##sequence-region AAAA02047354.1 1 2482
##sequence-region AAAA02038572.1 1 7622
##sequence-region AAAA02048677.1 1 2243
##sequence-region AAAA02045740.1 1 2869
##sequence-region AAAA02042512.1 1 3998
##sequence-region AAAA02042092.1 1 4190
##sequence-region AAAA02044368.1 1 3260
##sequence-region AAAA02040525.1 1 5179
##sequence-region AAAA02043603.1 1 3510
##sequence-region CH399348.1 1 6005
##sequence-region CH399229.1 1 6670
##sequence-region AAAA02042309.1 1 4100
##sequence-region AAAA02040972.1 1 4878
##sequence-region AAAA02042447.1 1 4032
##sequence-region CH399836.1 1 4380
##sequence-region CH400366.1 1 3167
##sequence-region AAAA02049831.1 1 2060
##sequence-region AAAA02044132.1 1 3332
##sequence-region AAAA02044229.1 1 3299
##sequence-region AAAA02036545.1 1 16991
##sequence-region AAAA02036860.1 1 14118
##sequence-region CH399488.1 1 5394
##sequence-region AAAA02045075.1 1 3052
##sequence-region CH398282.1 1 33310
##sequence-region AAAA02040729.1 1 5034
##sequence-region CH400962.1 1 2235
##sequence-region CH400937.1 1 2265
##sequence-region AAAA02041707.1 1 4416
##sequence-region CH400683.1 1 2642
##sequence-region CH398384.1 1 20649
##sequence-region AAAA02048678.1 1 2243
##sequence-region AAAA02048744.1 1 2232
##sequence-region AAAA02038320.1 1 8140
##sequence-region CH398418.1 1 19156
##sequence-region AAAA02046876.1 1 2595
##sequence-region CH398722.1 1 10728
##sequence-region CH399240.1 1 6599
##sequence-region AAAA02043130.1 1 3704
##sequence-region AAAA02047744.1 1 2411
##sequence-region CH399797.1 1 4478
##sequence-region AAAA02042879.1 1 3806
##sequence-region CH400766.1 1 2492
##sequence-region AAAA02039483.1 1 6235
##sequence-region AAAA02045346.1 1 2978
##sequence-region AAAA02040680.1 1 5075
##sequence-region CH399378.1 1 5861
##sequence-region CH398371.1 1 21324
##sequence-region AAAA02049027.1 1 2190
##sequence-region AAAA02048847.1 1 2216
##sequence-region CH398396.1 1 20250
##sequence-region AAAA02038452.1 1 7836
##sequence-region AAAA02049504.1 1 2115
##sequence-region AAAA02045534.1 1 2919
##sequence-region AAAA02044616.1 1 3177
##sequence-region AAAA02039888.1 1 5754
##sequence-region AAAA02049826.1 1 2061
##sequence-region CH399968.1 1 4067
##sequence-region AAAA02041104.1 1 4779
##sequence-region AAAA02039680.1 1 5982
##sequence-region CH398539.1 1 14525
##sequence-region CH398500.1 1 15725
##sequence-region AAAA02049563.1 1 2107
##sequence-region AAAA02047801.1 1 2401
##sequence-region AAAA02049426.1 1 2129
##sequence-region AAAA02038807.1 1 7212
##sequence-region AAAA02040614.1 1 5120
##sequence-region AAAA02040827.1 1 4961
##sequence-region AAAA02048147.1 1 2337
##sequence-region CH399374.1 1 5880
##sequence-region CH399767.1 1 4569
##sequence-region AAAA02040923.1 1 4908
##sequence-region CH399663.1 1 4850
##sequence-region AAAA02036261.1 1 20302
##sequence-region AAAA02046262.1 1 2745
##sequence-region CH398358.1 1 22276
##sequence-region CH400297.1 1 3313
##sequence-region AAAA02041307.1 1 4662
##sequence-region AAAA02039805.1 1 5850
##sequence-region AAAA02043099.1 1 3715
##sequence-region AAAA02042091.1 1 4190
##sequence-region AAAA02047591.1 1 2438
##sequence-region AAAA02044683.1 1 3155
##sequence-region AAAA02047533.1 1 2447
##sequence-region AAAA02039216.1 1 6653
##sequence-region CH401043.1 1 2145
##sequence-region AAAA02039211.1 1 6658
##sequence-region AAAA02048743.1 1 2232
##sequence-region CH400053.1 1 3818
##sequence-region AAAA02038178.1 1 8428
##sequence-region AAAA02039814.1 1 5838
##sequence-region AAAA02048580.1 1 2260
##sequence-region AAAA02044061.1 1 3350
##sequence-region AAAA02037115.1 1 12118
##sequence-region CH398419.1 1 19151
##sequence-region CH400212.1 1 3479
##sequence-region AAAA02048830.1 1 2219
##sequence-region CH400960.1 1 2237
##sequence-region AAAA02038339.1 1 8074
##sequence-region AAAA02046823.1 1 2608
##sequence-region AAAA02045906.1 1 2826
##sequence-region AAAA02048873.1 1 2213
##sequence-region AAAA02049131.1 1 2174
##sequence-region AAAA02036888.1 1 13908
##sequence-region AAAA02050049.1 1 2025
##sequence-region CH399460.1 1 5508
##sequence-region AAAA02048318.1 1 2305
##sequence-region AAAA02042307.1 1 4101
##sequence-region CH399560.1 1 5156
##sequence-region AAAA02037656.1 1 10094
##sequence-region AAAA02044693.1 1 3151
##sequence-region CH398795.1 1 9888
##sequence-region AAAA02041808.1 1 4365
##sequence-region AAAA02041953.1 1 4278
##sequence-region AAAA02044843.1 1 3109
##sequence-region AAAA02044753.1 1 3133
##sequence-region AAAA02040522.1 1 5183
##sequence-region CH399349.1 1 5992
##sequence-region AAAA02044404.1 1 3248
##sequence-region AAAA02050107.1 1 2017
##sequence-region AAAA02048207.1 1 2325
##sequence-region AAAA02049234.1 1 2157
##sequence-region AAAA02043542.1 1 3531
##sequence-region CH398969.1 1 8186
##sequence-region CH400124.1 1 3663
##sequence-region CH398296.1 1 30711
##sequence-region AAAA02040433.1 1 5255
##sequence-region CH399464.1 1 5500
##sequence-region AAAA02043336.1 1 3613
##sequence-region CH398831.1 1 9456
##sequence-region AAAA02049213.1 1 2161
##sequence-region CH399604.1 1 5023
##sequence-region AAAA02045514.1 1 2926
##sequence-region CH399096.1 1 7302
##sequence-region CH401143.1 1 2021
##sequence-region AAAA02047756.1 1 2409
##sequence-region AAAA02042346.1 1 4080
##sequence-region AAAA02047707.1 1 2418
##sequence-region AAAA02040199.1 1 5445
##sequence-region CH399977.1 1 4035
##sequence-region AAAA02039592.1 1 6098
##sequence-region AAAA02049158.1 1 2170
##sequence-region CH398343.1 1 23650
##sequence-region AAAA02037639.1 1 10163
##sequence-region AAAA02048254.1 1 2316
##sequence-region AAAA02048621.1 1 2252
##sequence-region AAAA02047842.1 1 2393
##sequence-region CH400776.1 1 2470
##sequence-region CH399684.1 1 4785
##sequence-region AAAA02036756.1 1 15022
##sequence-region AAAA02048244.1 1 2318
##sequence-region CH399434.1 1 5606
##sequence-region CH401117.1 1 2053
##sequence-region AAAA02046447.1 1 2699
##sequence-region AAAA02043626.1 1 3502
##sequence-region AAAA02035845.1 1 29333
##sequence-region CH398594.1 1 12923
##sequence-region AAAA02046449.1 1 2698
##sequence-region AAAA02048310.1 1 2306
##sequence-region AAAA02040581.1 1 5140
##sequence-region CH400182.1 1 3540
##sequence-region AAAA02047203.1 1 2521
##sequence-region AAAA02038387.1 1 7957
##sequence-region AAAA02040140.1 1 5499
##sequence-region AAAA02041594.1 1 4485
##sequence-region AAAA02043478.1 1 3556
##sequence-region AAAA02039490.1 1 6231
##sequence-region CH398935.1 1 8410
##sequence-region AAAA02046257.1 1 2747
##sequence-region CH398386.1 1 20530
##sequence-region CH398998.1 1 7902
##sequence-region CH399818.1 1 4424
##sequence-region AAAA02044276.1 1 3287
##sequence-region AAAA02047079.1 1 2546
##sequence-region AAAA02042533.1 1 3989
##sequence-region AAAA02040897.1 1 4921
##sequence-region CH399053.1 1 7584
##sequence-region CH398409.1 1 19594
##sequence-region CH398278.1 1 35206
##sequence-region AAAA02047422.1 1 2466
##sequence-region AAAA02041041.1 1 4819
##sequence-region CH400541.1 1 2849
##sequence-region AAAA02039557.1 1 6146
##sequence-region AAAA02040803.1 1 4980
##sequence-region AAAA02049686.1 1 2085
##sequence-region AAAA02040512.1 1 5191
##sequence-region AAAA02046310.1 1 2733
##sequence-region AAAA02036079.1 1 22480
##sequence-region CH398313.1 1 26878
##sequence-region AAAA02048406.1 1 2288
##sequence-region CH400598.1 1 2780
##sequence-region AAAA02040249.1 1 5391
##sequence-region AAAA02045398.1 1 2960
##sequence-region CH400432.1 1 3046
##sequence-region CH398720.1 1 10745
##sequence-region AAAA02043052.1 1 3729
##sequence-region CH400336.1 1 3244
##sequence-region AAAA02040929.1 1 4906
##sequence-region AAAA02042393.1 1 4059
##sequence-region CH400790.1 1 2452
##sequence-region AAAA02036283.1 1 20143
##sequence-region AAAA02048166.1 1 2332
##sequence-region CH398393.1 1 20332
##sequence-region AAAA02043889.1 1 3406
##sequence-region CH399417.1 1 5690
##sequence-region AAAA02036935.1 1 13614
##sequence-region CH400447.1 1 3026
##sequence-region CH400146.1 1 3614
##sequence-region AAAA02048900.1 1 2208
##sequence-region AAAA02048057.1 1 2355
##sequence-region AAAA02048099.1 1 2346
##sequence-region AAAA02046803.1 1 2614
##sequence-region AAAA02048030.1 1 2359
##sequence-region AAAA02046761.1 1 2621
##sequence-region CH399749.1 1 4624
##sequence-region AAAA02045417.1 1 2955
##sequence-region CH398381.1 1 20821
##sequence-region AAAA02047764.1 1 2408
##sequence-region AAAA02039399.1 1 6330
##sequence-region AAAA02047016.1 1 2561
##sequence-region AAAA02045940.1 1 2820
##sequence-region AAAA02040158.1 1 5483
##sequence-region AAAA02041796.1 1 4369
##sequence-region AAAA02045728.1 1 2871
##sequence-region AAAA02046756.1 1 2623
##sequence-region AAAA02038972.1 1 6986
##sequence-region CH401024.1 1 2163
##sequence-region CH400287.1 1 3331
##sequence-region CH399406.1 1 5743
##sequence-region AAAA02042001.1 1 4253
##sequence-region AAAA02044162.1 1 3320
##sequence-region AAAA02041632.1 1 4461
##sequence-region AAAA02036315.1 1 19695
##sequence-region AAAA02040735.1 1 5031
##sequence-region AAAA02039042.1 1 6901
##sequence-region CH398960.1 1 8234
##sequence-region AAAA02045397.1 1 2960
##sequence-region CH398545.1 1 14328
##sequence-region AAAA02047384.1 1 2475
##sequence-region CH398628.1 1 12026
##sequence-region CH399891.1 1 4246
##sequence-region AAAA02048738.1 1 2233
##sequence-region AAAA02046354.1 1 2720
##sequence-region AAAA02046076.1 1 2794
##sequence-region AAAA02045165.1 1 3029
##sequence-region AAAA02046743.1 1 2626
##sequence-region AAAA02047120.1 1 2538
##sequence-region CH399383.1 1 5828
##sequence-region AAAA02049419.1 1 2130
##sequence-region CH399842.1 1 4360
##sequence-region AAAA02039971.1 1 5657
##sequence-region AAAA02044569.1 1 3190
##sequence-region CH398334.1 1 25336
##sequence-region AAAA02037345.1 1 11194
##sequence-region AAAA02043649.1 1 3495
##sequence-region AAAA02044048.1 1 3352
##sequence-region AAAA02049313.1 1 2145
##sequence-region CH398964.1 1 8209
##sequence-region CH400211.1 1 3480
##sequence-region CH398679.1 1 11303
##sequence-region CH398686.1 1 11187
##sequence-region AAAA02047133.1 1 2536
##sequence-region CH399640.1 1 4913
##sequence-region CH400795.1 1 2445
##sequence-region CH398233.1 1 121265
##sequence-region AAAA02049797.1 1 2065
##sequence-region CH399367.1 1 5916
##sequence-region AAAA02039345.1 1 6419
##sequence-region AAAA02041714.1 1 4411
##sequence-region AAAA02041217.1 1 4706
##sequence-region CH399532.1 1 5247
##sequence-region CH399369.1 1 5892
##sequence-region AAAA02043285.1 1 3640
##sequence-region AAAA02043000.1 1 3752
##sequence-region AAAA02039988.1 1 5636
##sequence-region CH400404.1 1 3099
##sequence-region AAAA02042939.1 1 3784
##sequence-region AAAA02044534.1 1 3200
##sequence-region CH399017.1 1 7811
##sequence-region AAAA02041196.1 1 4724
##sequence-region CH399740.1 1 4639
##sequence-region CH398424.1 1 18913
##sequence-region AAAA02045973.1 1 2814
##sequence-region CH399051.1 1 7589
##sequence-region AAAA02043727.1 1 3461
##sequence-region CH400467.1 1 2981
##sequence-region CH399756.1 1 4607
##sequence-region AAAA02043998.1 1 3372
##sequence-region AAAA02040987.1 1 4868
##sequence-region AAAA02037909.1 1 9210
##sequence-region CH398995.1 1 7936
##sequence-region CH400249.1 1 3405
##sequence-region AAAA02043846.1 1 3416
##sequence-region AAAA02037713.1 1 9896
##sequence-region AAAA02046933.1 1 2582
##sequence-region AAAA02048271.1 1 2312
##sequence-region CH400407.1 1 3093
##sequence-region CH398839.1 1 9371
##sequence-region AAAA02048566.1 1 2261
##sequence-region CH398367.1 1 21489
##sequence-region AAAA02044219.1 1 3301
##sequence-region CH400981.1 1 2215
##sequence-region CH399972.1 1 4051
##sequence-region CH400254.1 1 3394
##sequence-region CH398999.1 1 7894
##sequence-region CH398916.1 1 8595
##sequence-region AAAA02043798.1 1 3430
##sequence-region CH398453.1 1 17550
##sequence-region AAAA02045069.1 1 3053
##sequence-region AAAA02040015.1 1 5607
##sequence-region CH398390.1 1 20392
##sequence-region AAAA02045415.1 1 2956
##sequence-region CH399233.1 1 6644
##sequence-region CH400547.1 1 2843
##sequence-region AAAA02038701.1 1 7398
##sequence-region AAAA02039679.1 1 5982
##sequence-region AAAA02044715.1 1 3144
##sequence-region AAAA02039266.1 1 6582
##sequence-region CH399781.1 1 4539
##sequence-region AAAA02040859.1 1 4942
##sequence-region AAAA02044348.1 1 3264
##sequence-region AAAA02047338.1 1 2488
##sequence-region AAAA02049986.1 1 2036
##sequence-region AAAA02046908.1 1 2589
##sequence-region AAAA02048484.1 1 2276
##sequence-region AAAA02043819.1 1 3426
##sequence-region AAAA02048498.1 1 2273
##sequence-region AAAA02048470.1 1 2278
##sequence-region CH400083.1 1 3752
##sequence-region AAAA02046999.1 1 2564
##sequence-region 3 1 41884883
##sequence-region AAAA02039580.1 1 6110
##sequence-region AAAA02044439.1 1 3233
##sequence-region AAAA02043752.1 1 3447
##sequence-region CH400180.1 1 3543
##sequence-region AAAA02047769.1 1 2407
##sequence-region AAAA02044467.1 1 3218
##sequence-region CH399746.1 1 4625
##sequence-region CH400415.1 1 3087
##sequence-region AAAA02045506.1 1 2928
##sequence-region AAAA02048832.1 1 2219
##sequence-region AAAA02042053.1 1 4215
##sequence-region AAAA02048854.1 1 2215
##sequence-region AAAA02038529.1 1 7702
##sequence-region AAAA02050070.1 1 2023
##sequence-region AAAA02048443.1 1 2282
##sequence-region CH398841.1 1 9359
##sequence-region AAAA02046386.1 1 2712
##sequence-region AAAA02044702.1 1 3148
##sequence-region AAAA02046490.1 1 2688
##sequence-region AAAA02039394.1 1 6335
##sequence-region AAAA02038516.1 1 7717
##sequence-region CH399760.1 1 4602
##sequence-region AAAA02040541.1 1 5167
##sequence-region AAAA02049839.1 1 2059
##sequence-region AAAA02042913.1 1 3794
##sequence-region CH399318.1 1 6141
##sequence-region AAAA02045543.1 1 2916
##sequence-region AAAA02049810.1 1 2063
##sequence-region AAAA02042357.1 1 4076
##sequence-region AAAA02043327.1 1 3615
##sequence-region AAAA02047705.1 1 2419
##sequence-region AAAA02047561.1 1 2443
##sequence-region AAAA02045078.1 1 3051
##sequence-region AAAA02047467.1 1 2457
##sequence-region AAAA02043452.1 1 3567
##sequence-region AAAA02047111.1 1 2540
##sequence-region CH399679.1 1 4797
##sequence-region AAAA02041183.1 1 4734
##sequence-region CH399181.1 1 6903
##sequence-region AAAA02049295.1 1 2147
##sequence-region AAAA02037568.1 1 10315
##sequence-region CH399001.1 1 7887
##sequence-region AAAA02043293.1 1 3636
##sequence-region AAAA02043183.1 1 3685
##sequence-region AAAA02042251.1 1 4129
##sequence-region CH399778.1 1 4547
##sequence-region AAAA02040598.1 1 5128
##sequence-region CH398588.1 1 13101
##sequence-region AAAA02048880.1 1 2211
##sequence-region AAAA02045531.1 1 2919
##sequence-region CH400261.1 1 3389
##sequence-region CH398857.1 1 9145
##sequence-region AAAA02040030.1 1 5588
##sequence-region CH398285.1 1 32570
##sequence-region AAAA02043023.1 1 3744
##sequence-region AAAA02042151.1 1 4161
##sequence-region AAAA02049127.1 1 2174
##sequence-region AAAA02038843.1 1 7180
##sequence-region CH399630.1 1 4935
##sequence-region CH399551.1 1 5178
##sequence-region AAAA02042843.1 1 3824
##sequence-region AAAA02046819.1 1 2610
##sequence-region AAAA02038303.1 1 8181
##sequence-region CH399165.1 1 6968
##sequence-region AAAA02044426.1 1 3239
##sequence-region AAAA02048943.1 1 2203
##sequence-region AAAA02048573.1 1 2260
##sequence-region AAAA02040115.1 1 5515
##sequence-region AAAA02049270.1 1 2152
##sequence-region AAAA02040176.1 1 5462
##sequence-region AAAA02045013.1 1 3065
##sequence-region AAAA02047346.1 1 2486
##sequence-region AAAA02043209.1 1 3674
##sequence-region AAAA02043102.1 1 3714
##sequence-region CH399780.1 1 4540
##sequence-region CH398639.1 1 11910
##sequence-region AAAA02041105.1 1 4779
##sequence-region CH398232.1 1 124537
##sequence-region AAAA02048352.1 1 2299
##sequence-region AAAA02045152.1 1 3031
##sequence-region AAAA02049976.1 1 2038
##sequence-region AAAA02042311.1 1 4098
##sequence-region AAAA02048256.1 1 2314
##sequence-region AAAA02047743.1 1 2411
##sequence-region AAAA02041630.1 1 4461
##sequence-region AAAA02047590.1 1 2439
##sequence-region CH399669.1 1 4823
##sequence-region CH398915.1 1 8598
##sequence-region AAAA02048616.1 1 2253
##sequence-region AAAA02044649.1 1 3167
##sequence-region AAAA02036857.1 1 14178
##sequence-region AAAA02043307.1 1 3625
##sequence-region AAAA02045329.1 1 2982
##sequence-region AAAA02042417.1 1 4049
##sequence-region AAAA02046146.1 1 2775
##sequence-region AAAA02045363.1 1 2971
##sequence-region AAAA02045832.1 1 2845
##sequence-region AAAA02040781.1 1 4999
##sequence-region CH400869.1 1 2346
##sequence-region CH398336.1 1 25009
##sequence-region AAAA02045058.1 1 3056
##sequence-region AAAA02047163.1 1 2530
##sequence-region AAAA02036143.1 1 21488
##sequence-region AAAA02044848.1 1 3108
##sequence-region AAAA02046815.1 1 2610
##sequence-region AAAA02043601.1 1 3510
##sequence-region AAAA02038152.1 1 8510
##sequence-region AAAA02049607.1 1 2100
##sequence-region AAAA02041617.1 1 4473
##sequence-region CH398555.1 1 13999
##sequence-region CH398733.1 1 10556
##sequence-region CH399804.1 1 4455
##sequence-region AAAA02046541.1 1 2675
##sequence-region AAAA02042160.1 1 4159
##sequence-region AAAA02049737.1 1 2076
##sequence-region CH400907.1 1 2303
##sequence-region AAAA02045038.1 1 3059
##sequence-region CH398378.1 1 20879
##sequence-region AAAA02047067.1 1 2549
##sequence-region CH398385.1 1 20605
##sequence-region CH398493.1 1 15938
##sequence-region AAAA02040454.1 1 5237
##sequence-region AAAA02040162.1 1 5480
##sequence-region AAAA02036781.1 1 14897
##sequence-region CH399442.1 1 5570
##sequence-region CH400750.1 1 2530
##sequence-region CH399384.1 1 5824
##sequence-region CH400855.1 1 2363
##sequence-region AAAA02039688.1 1 5970
##sequence-region AAAA02047496.1 1 2454
##sequence-region AAAA02041132.1 1 4763
##sequence-region AAAA02039828.1 1 5817
##sequence-region CH398974.1 1 8159
##sequence-region AAAA02048928.1 1 2204
##sequence-region CH400144.1 1 3623
##sequence-region AAAA02049766.1 1 2070
##sequence-region AAAA02044022.1 1 3363
##sequence-region AAAA02047806.1 1 2401
##sequence-region AAAA02038408.1 1 7903
##sequence-region AAAA02042998.1 1 3756
##sequence-region AAAA02038932.1 1 7052
##sequence-region CH398764.1 1 10247
##sequence-region AAAA02048662.1 1 2247
##sequence-region AAAA02049240.1 1 2157
##sequence-region AAAA02042112.1 1 4182
##sequence-region CH401106.1 1 2067
##sequence-region CH398548.1 1 14283
##sequence-region AAAA02046401.1 1 2709
##sequence-region AAAA02042056.1 1 4213
##sequence-region AAAA02040231.1 1 5412
##sequence-region AAAA02038600.1 1 7588
##sequence-region AAAA02043919.1 1 3397
##sequence-region AAAA02048668.1 1 2245
##sequence-region CH400951.1 1 2251
##sequence-region AAAA02040087.1 1 5541
##sequence-region AAAA02047236.1 1 2514
##sequence-region CH399068.1 1 7481
##sequence-region AAAA02046956.1 1 2576
##sequence-region AAAA02042574.1 1 3967
##sequence-region AAAA02048321.1 1 2304
##sequence-region AAAA02045341.1 1 2979
##sequence-region CH400186.1 1 3533
##sequence-region CH399494.1 1 5373
##sequence-region AAAA02043949.1 1 3391
##sequence-region AAAA02041460.1 1 4575
##sequence-region AAAA02042575.1 1 3966
##sequence-region AAAA02042761.1 1 3855
##sequence-region AAAA02045496.1 1 2931
##sequence-region AAAA02039213.1 1 6654
##sequence-region AAAA02039868.1 1 5770
##sequence-region AAAA02046142.1 1 2776
##sequence-region AAAA02044191.1 1 3313
##sequence-region CH399633.1 1 4927
##sequence-region CH398573.1 1 13600
##sequence-region AAAA02041006.1 1 4851
##sequence-region AAAA02036171.1 1 21138
##sequence-region AAAA02044839.1 1 3110
##sequence-region AAAA02040683.1 1 5072
##sequence-region CH399824.1 1 4402
##sequence-region CH400511.1 1 2900
##sequence-region CH398333.1 1 25410
##sequence-region AAAA02042965.1 1 3772
##sequence-region AAAA02047327.1 1 2490
##sequence-region CH399652.1 1 4890
##sequence-region AAAA02050141.1 1 2012
##sequence-region AAAA02048948.1 1 2202
##sequence-region AAAA02038970.1 1 6987
##sequence-region CH398561.1 1 13804
##sequence-region AAAA02042674.1 1 3905
##sequence-region AAAA02036868.1 1 14039
##sequence-region CH398249.1 1 51654
##sequence-region 11 1 23035369
##sequence-region AAAA02037005.1 1 13080
##sequence-region AAAA02035823.1 1 30287
##sequence-region CH400231.1 1 3428
##sequence-region AAAA02048722.1 1 2236
##sequence-region AAAA02049413.1 1 2131
##sequence-region CH399037.1 1 7674
##sequence-region CH398991.1 1 7967
##sequence-region CH399525.1 1 5266
##sequence-region AAAA02049987.1 1 2036
##sequence-region AAAA02044543.1 1 3197
##sequence-region AAAA02046412.1 1 2707
##sequence-region AAAA02041364.1 1 4633
##sequence-region AAAA02043902.1 1 3403
##sequence-region CH399286.1 1 6280
##sequence-region CH398812.1 1 9726
##sequence-region AAAA02047421.1 1 2466
##sequence-region AAAA02040833.1 1 4957
##sequence-region CH400372.1 1 3162
##sequence-region CH399453.1 1 5526
##sequence-region AAAA02047439.1 1 2464
##sequence-region CH398798.1 1 9855
##sequence-region AAAA02048970.1 1 2199
##sequence-region AAAA02039280.1 1 6550
##sequence-region CH399702.1 1 4735
##sequence-region AAAA02039932.1 1 5717
##sequence-region AAAA02039207.1 1 6665
##sequence-region AAAA02040037.1 1 5583
##sequence-region AAAA02042824.1 1 3834
##sequence-region AAAA02044294.1 1 3280
##sequence-region AAAA02039299.1 1 6507
##sequence-region CH398827.1 1 9516
##sequence-region AAAA02042119.1 1 4176
##sequence-region CH398435.1 1 18225
##sequence-region AAAA02041544.1 1 4514
##sequence-region AAAA02043723.1 1 3462
##sequence-region CH398289.1 1 31659
##sequence-region AAAA02050123.1 1 2015
##sequence-region CH399707.1 1 4709
##sequence-region AAAA02050112.1 1 2017
##sequence-region CH398830.1 1 9494
##sequence-region AAAA02042973.1 1 3769
##sequence-region AAAA02042479.1 1 4016
##sequence-region AAAA02039106.1 1 6819
##sequence-region AAAA02039460.1 1 6265
##sequence-region AAAA02038564.1 1 7644
##sequence-region CH400048.1 1 3830
##sequence-region AAAA02048529.1 1 2266
##sequence-region AAAA02043660.1 1 3489
##sequence-region AAAA02043618.1 1 3504
##sequence-region AAAA02049080.1 1 2181
##sequence-region CH400774.1 1 2474
##sequence-region AAAA02044318.1 1 3273
##sequence-region AAAA02044557.1 1 3193
##sequence-region AAAA02040500.1 1 5201
##sequence-region AAAA02040038.1 1 5580
##sequence-region AAAA02038939.1 1 7036
##sequence-region CH399710.1 1 4703
##sequence-region AAAA02037564.1 1 10340
##sequence-region CH398729.1 1 10669
##sequence-region AAAA02041906.1 1 4296
##sequence-region CH400605.1 1 2764
##sequence-region AAAA02048882.1 1 2210
##sequence-region AAAA02041339.1 1 4643
##sequence-region AAAA02044297.1 1 3278
##sequence-region AAAA02042860.1 1 3816
##sequence-region AAAA02047567.1 1 2442
##sequence-region AAAA02047521.1 1 2450
##sequence-region CH398579.1 1 13294
##sequence-region AAAA02043445.1 1 3570
##sequence-region AAAA02037567.1 1 10327
##sequence-region CH401020.1 1 2168
##sequence-region CH400783.1 1 2457
##sequence-region AAAA02048132.1 1 2340
##sequence-region AAAA02044351.1 1 3263
##sequence-region AAAA02046311.1 1 2733
##sequence-region AAAA02038399.1 1 7915
##sequence-region CH399908.1 1 4185
##sequence-region CH399288.1 1 6273
##sequence-region AAAA02039570.1 1 6131
##sequence-region AAAA02039780.1 1 5875
##sequence-region AAAA02045600.1 1 2903
##sequence-region CH398355.1 1 22464
##sequence-region AAAA02037602.1 1 10242
##sequence-region AAAA02043306.1 1 3625
##sequence-region AAAA02036664.1 1 15709
##sequence-region AAAA02040137.1 1 5502
##sequence-region AAAA02040970.1 1 4880
##sequence-region CH399031.1 1 7696
##sequence-region AAAA02041728.1 1 4403
##sequence-region AAAA02038855.1 1 7158
##sequence-region AAAA02048303.1 1 2307
##sequence-region AAAA02041555.1 1 4509
##sequence-region AAAA02041004.1 1 4856
##sequence-region AAAA02043635.1 1 3499
##sequence-region CH399160.1 1 6990
##sequence-region CH399072.1 1 7466
##sequence-region CH400040.1 1 3846
##sequence-region AAAA02044695.1 1 3151
##sequence-region AAAA02047880.1 1 2386
##sequence-region CH398236.1 1 87163
##sequence-region CH399004.1 1 7874
##sequence-region CH399103.1 1 7267
##sequence-region CH400670.1 1 2659
##sequence-region AAAA02048169.1 1 2331
##sequence-region AAAA02038528.1 1 7702
##sequence-region AAAA02038936.1 1 7041
##sequence-region AAAA02045272.1 1 2998
##sequence-region AAAA02043496.1 1 3548
##sequence-region AAAA02048504.1 1 2272
##sequence-region CH398335.1 1 25148
##sequence-region AAAA02045892.1 1 2829
##sequence-region CH400240.1 1 3415
##sequence-region AAAA02047061.1 1 2551
##sequence-region CH398425.1 1 18720
##sequence-region CH401005.1 1 2181
##sequence-region AAAA02041858.1 1 4332
##sequence-region AAAA02038584.1 1 7610
##sequence-region AAAA02041016.1 1 4847
##sequence-region AAAA02047041.1 1 2556
##sequence-region CH398988.1 1 7997
##sequence-region CH400126.1 1 3661
##sequence-region AAAA02038032.1 1 8788
##sequence-region AAAA02044174.1 1 3317
##sequence-region AAAA02046343.1 1 2723
##sequence-region AAAA02045786.1 1 2856
##sequence-region CH398858.1 1 9140
##sequence-region AAAA02037016.1 1 12923
##sequence-region AAAA02048131.1 1 2340
##sequence-region AAAA02049701.1 1 2082
##sequence-region AAAA02039310.1 1 6472
##sequence-region CH398824.1 1 9567
##sequence-region AAAA02043560.1 1 3527
##sequence-region CH400433.1 1 3045
##sequence-region CH398803.1 1 9795
##sequence-region CH401045.1 1 2142
##sequence-region AAAA02043472.1 1 3558
##sequence-region CH398770.1 1 10214
##sequence-region AAAA02042130.1 1 4170
##sequence-region AAAA02040351.1 1 5313
##sequence-region AAAA02049033.1 1 2189
##sequence-region AAAA02049526.1 1 2112
##sequence-region CH399851.1 1 4335
##sequence-region AAAA02041103.1 1 4780
##sequence-region AAAA02043136.1 1 3702
##sequence-region AAAA02044951.1 1 3082
##sequence-region AAAA02041030.1 1 4830
##sequence-region AAAA02046474.1 1 2690
##sequence-region CH399775.1 1 4550
##sequence-region AAAA02039108.1 1 6811
##sequence-region AAAA02043511.1 1 3542
##sequence-region AAAA02040348.1 1 5319
##sequence-region CH398826.1 1 9532
##sequence-region CH398775.1 1 10145
##sequence-region CH399456.1 1 5516
##sequence-region AAAA02042816.1 1 3837
##sequence-region AAAA02037865.1 1 9364
##sequence-region AAAA02038560.1 1 7662
##sequence-region CH398678.1 1 11305
##sequence-region AAAA02048087.1 1 2349
##sequence-region AAAA02042523.1 1 3992
##sequence-region CH398622.1 1 12108
##sequence-region AAAA02045913.1 1 2825
##sequence-region AAAA02045120.1 1 3040
##sequence-region AAAA02044605.1 1 3181
##sequence-region AAAA02041755.1 1 4395
##sequence-region CH398261.1 1 42953
##sequence-region AAAA02040988.1 1 4868
##sequence-region AAAA02043101.1 1 3714
##sequence-region AAAA02044386.1 1 3254
##sequence-region AAAA02044680.1 1 3156
##sequence-region AAAA02047799.1 1 2401
##sequence-region CH398505.1 1 15622
##sequence-region AAAA02044375.1 1 3258
##sequence-region AAAA02043573.1 1 3522
##sequence-region AAAA02048648.1 1 2249
##sequence-region CH400437.1 1 3036
##sequence-region AAAA02043431.1 1 3580
##sequence-region AAAA02042738.1 1 3868
##sequence-region AAAA02037414.1 1 10919
##sequence-region AAAA02042947.1 1 3779
##sequence-region CH401160.1 1 2003
##sequence-region AAAA02040749.1 1 5020
##sequence-region CH400592.1 1 2790
##sequence-region AAAA02044963.1 1 3078
##sequence-region AAAA02043112.1 1 3711
##sequence-region AAAA02042202.1 1 4146
##sequence-region AAAA02049506.1 1 2115
##sequence-region CH398528.1 1 14964
##sequence-region CH399803.1 1 4459
##sequence-region CH398254.1 1 46441
##sequence-region AAAA02037340.1 1 11224
##sequence-region AAAA02048656.1 1 2247
##sequence-region CH398872.1 1 8936
##sequence-region CH398314.1 1 26837
##sequence-region AAAA02039581.1 1 6109
##sequence-region AAAA02035839.1 1 29631
##sequence-region AAAA02039543.1 1 6157
##sequence-region AAAA02047505.1 1 2453
##sequence-region AAAA02043208.1 1 3674
##sequence-region AAAA02050201.1 1 2004
##sequence-region AAAA02041131.1 1 4764
##sequence-region AAAA02044461.1 1 3222
##sequence-region AAAA02036926.1 1 13659
##sequence-region AAAA02042507.1 1 4000
##sequence-region CH399343.1 1 6016
##sequence-region CH398655.1 1 11703
##sequence-region AAAA02045831.1 1 2845
##sequence-region CH400978.1 1 2216
##sequence-region AAAA02046358.1 1 2719
##sequence-region CH400606.1 1 2764
##sequence-region AAAA02041768.1 1 4386
##sequence-region AAAA02046680.1 1 2640
##sequence-region CH398698.1 1 11036
##sequence-region AAAA02042024.1 1 4234
##sequence-region AAAA02044855.1 1 3106
##sequence-region CH398994.1 1 7940
##sequence-region CH398461.1 1 17240
##sequence-region AAAA02046193.1 1 2764
##sequence-region AAAA02049639.1 1 2096
##sequence-region CH400584.1 1 2798
##sequence-region CH399328.1 1 6081
##sequence-region CH398437.1 1 18214
##sequence-region AAAA02047632.1 1 2431
##sequence-region AAAA02037330.1 1 11260
##sequence-region CH400789.1 1 2453
##sequence-region AAAA02043247.1 1 3658
##sequence-region AAAA02040210.1 1 5431
##sequence-region AAAA02044279.1 1 3285
##sequence-region AAAA02039380.1 1 6363
##sequence-region CH398769.1 1 10216
##sequence-region CH398642.1 1 11857
##sequence-region CH399095.1 1 7311
##sequence-region CH400410.1 1 3091
##sequence-region AAAA02038680.1 1 7452
##sequence-region AAAA02040812.1 1 4972
##sequence-region AAAA02036297.1 1 20073
##sequence-region AAAA02044231.1 1 3298
##sequence-region CH399961.1 1 4079
##sequence-region AAAA02041098.1 1 4781
##sequence-region AAAA02042149.1 1 4162
##sequence-region AAAA02049028.1 1 2190
##sequence-region CH398653.1 1 11720
##sequence-region AAAA02048874.1 1 2213
##sequence-region AAAA02036386.1 1 18856
##sequence-region AAAA02047230.1 1 2515
##sequence-region AAAA02036541.1 1 17042
##sequence-region AAAA02047616.1 1 2434
##sequence-region CH399210.1 1 6766
##sequence-region AAAA02043213.1 1 3673
##sequence-region AAAA02037930.1 1 9138
##sequence-region CH399882.1 1 4267
##sequence-region AAAA02038196.1 1 8394
##sequence-region AAAA02044842.1 1 3109
##sequence-region AAAA02039487.1 1 6232
##sequence-region CH399954.1 1 4107
##sequence-region AAAA02049102.1 1 2179
##sequence-region AAAA02038820.1 1 7197
##sequence-region AAAA02036508.1 1 17276
##sequence-region AAAA02045522.1 1 2922
##sequence-region AAAA02048979.1 1 2199
##sequence-region CH399659.1 1 4874
##sequence-region AAAA02048643.1 1 2249
##sequence-region AAAA02037302.1 1 11363
##sequence-region AAAA02039532.1 1 6174
##sequence-region CH398351.1 1 23148
##sequence-region AAAA02044756.1 1 3133
##sequence-region AAAA02040694.1 1 5059
##sequence-region AAAA02039522.1 1 6185
##sequence-region AAAA02036544.1 1 17033
##sequence-region AAAA02045598.1 1 2904
##sequence-region CH398982.1 1 8052
##sequence-region CH400507.1 1 2902
##sequence-region CH400694.1 1 2629
##sequence-region AAAA02047715.1 1 2416
##sequence-region AAAA02042397.1 1 4056
##sequence-region AAAA02046945.1 1 2580
##sequence-region AAAA02042502.1 1 4002
##sequence-region CH400006.1 1 3951
##sequence-region AAAA02045456.1 1 2943
##sequence-region CH399958.1 1 4084
##sequence-region AAAA02044682.1 1 3155
##sequence-region AAAA02042812.1 1 3840
##sequence-region AAAA02046821.1 1 2609
##sequence-region CH399985.1 1 4013
##sequence-region AAAA02044486.1 1 3212
##sequence-region AAAA02042034.1 1 4226
##sequence-region AAAA02043356.1 1 3607
##sequence-region AAAA02040801.1 1 4980
##sequence-region AAAA02044544.1 1 3197
##sequence-region CH400602.1 1 2774
##sequence-region AAAA02048985.1 1 2197
##sequence-region AAAA02046011.1 1 2804
##sequence-region AAAA02049412.1 1 2131
##sequence-region AAAA02040395.1 1 5274
##sequence-region AAAA02045006.1 1 3067
##sequence-region CH398685.1 1 11212
##sequence-region CH399007.1 1 7854
##sequence-region AAAA02046279.1 1 2741
##sequence-region CH400633.1 1 2714
##sequence-region AAAA02044844.1 1 3109
##sequence-region AAAA02048469.1 1 2278
##sequence-region CH400018.1 1 3909
##sequence-region AAAA02048785.1 1 2226
##sequence-region AAAA02045299.1 1 2991
##sequence-region CH398356.1 1 22457
##sequence-region AAAA02042628.1 1 3937
##sequence-region AAAA02046252.1 1 2749
##sequence-region CH399056.1 1 7574
##sequence-region AAAA02045167.1 1 3028
##sequence-region CH399036.1 1 7674
##sequence-region AAAA02048438.1 1 2283
##sequence-region AAAA02046759.1 1 2621
##sequence-region CH398546.1 1 14319
##sequence-region CH399920.1 1 4155
##sequence-region AAAA02044373.1 1 3258
##sequence-region CH401021.1 1 2167
##sequence-region AAAA02049561.1 1 2107
##sequence-region CH400133.1 1 3654
##sequence-region CH398902.1 1 8695
##sequence-region AAAA02043764.1 1 3443
##sequence-region AAAA02046594.1 1 2660
##sequence-region AAAA02041338.1 1 4643
##sequence-region AAAA02048791.1 1 2224
##sequence-region AAAA02039514.1 1 6197
##sequence-region AAAA02041282.1 1 4673
##sequence-region CH398263.1 1 41819
##sequence-region AAAA02049909.1 1 2049
##sequence-region AAAA02044778.1 1 3127
##sequence-region CH400540.1 1 2849
##sequence-region AAAA02043926.1 1 3395
##sequence-region CH398372.1 1 21321
##sequence-region CH398454.1 1 17542
##sequence-region AAAA02038481.1 1 7807
##sequence-region AAAA02048496.1 1 2273
##sequence-region AAAA02042733.1 1 3870
##sequence-region AAAA02050208.1 1 2002
##sequence-region AAAA02042086.1 1 4194
##sequence-region AAAA02045094.1 1 3047
##sequence-region CH399357.1 1 5947
##sequence-region AAAA02048170.1 1 2331
##sequence-region AAAA02045091.1 1 3047
##sequence-region AAAA02045424.1 1 2953
##sequence-region CH400585.1 1 2798
##sequence-region AAAA02041560.1 1 4503
##sequence-region AAAA02042061.1 1 4211
##sequence-region AAAA02049133.1 1 2173
##sequence-region AAAA02040673.1 1 5084
##sequence-region AAAA02037106.1 1 12201
##sequence-region CH399603.1 1 5025
##sequence-region AAAA02046242.1 1 2753
##sequence-region CH400759.1 1 2515
##sequence-region AAAA02046224.1 1 2757
##sequence-region CH399817.1 1 4429
##sequence-region AAAA02041301.1 1 4664
##sequence-region CH398703.1 1 10965
##sequence-region AAAA02036603.1 1 16459
##sequence-region AAAA02049115.1 1 2176
##sequence-region AAAA02043510.1 1 3542
##sequence-region AAAA02041777.1 1 4383
##sequence-region CH399660.1 1 4861
##sequence-region AAAA02045229.1 1 3011
##sequence-region CH398751.1 1 10358
##sequence-region CH398422.1 1 18950
##sequence-region AAAA02049403.1 1 2133
##sequence-region AAAA02040613.1 1 5120
##sequence-region AAAA02047211.1 1 2519
##sequence-region CH399722.1 1 4679
##sequence-region AAAA02042576.1 1 3965
##sequence-region AAAA02041804.1 1 4366
##sequence-region AAAA02044378.1 1 3257
##sequence-region AAAA02043948.1 1 3391
##sequence-region AAAA02037676.1 1 10025
##sequence-region AAAA02044478.1 1 3213
##sequence-region AAAA02039312.1 1 6471
##sequence-region CH398395.1 1 20319
##sequence-region CH399492.1 1 5376
##sequence-region CH401053.1 1 2136
##sequence-region CH399216.1 1 6743
##sequence-region AAAA02041559.1 1 4504
##sequence-region AAAA02040280.1 1 5365
##sequence-region AAAA02045110.1 1 3043
##sequence-region AAAA02036847.1 1 14298
##sequence-region AAAA02047331.1 1 2490
##sequence-region AAAA02041780.1 1 4380
##sequence-region AAAA02041281.1 1 4673
##sequence-region AAAA02037305.1 1 11332
##sequence-region CH398638.1 1 11911
##sequence-region CH400441.1 1 3031
##sequence-region AAAA02043805.1 1 3429
##sequence-region AAAA02044637.1 1 3171
##sequence-region AAAA02046006.1 1 2805
##sequence-region AAAA02040481.1 1 5215
##sequence-region CH398427.1 1 18618
##sequence-region AAAA02040967.1 1 4882
##sequence-region CH398283.1 1 33220
##sequence-region CH399744.1 1 4634
##sequence-region AAAA02047960.1 1 2370
##sequence-region CH399593.1 1 5051
##sequence-region AAAA02045946.1 1 2819
##sequence-region CH400189.1 1 3526
##sequence-region AAAA02041612.1 1 4475
##sequence-region AAAA02042958.1 1 3775
##sequence-region CH398624.1 1 12069
##sequence-region AAAA02049545.1 1 2109
##sequence-region CH398552.1 1 14044
##sequence-region AAAA02042041.1 1 4222
##sequence-region CH399430.1 1 5625
##sequence-region AAAA02040924.1 1 4908
##sequence-region CH400072.1 1 3788
##sequence-region AAAA02044485.1 1 3212
##sequence-region CH400024.1 1 3884
##sequence-region AAAA02037205.1 1 11809
##sequence-region AAAA02038236.1 1 8321
##sequence-region AAAA02041718.1 1 4409
##sequence-region AAAA02047035.1 1 2557
##sequence-region CH398467.1 1 17080
##sequence-region AAAA02044749.1 1 3135
##sequence-region CH398292.1 1 31580
##sequence-region AAAA02046710.1 1 2632
##sequence-region AAAA02047309.1 1 2492
##sequence-region CH399319.1 1 6134
##sequence-region CH398348.1 1 23472
##sequence-region AAAA02043311.1 1 3624
##sequence-region AAAA02040112.1 1 5517
##sequence-region AAAA02049684.1 1 2087
##sequence-region AAAA02047831.1 1 2395
##sequence-region CH398260.1 1 43180
##sequence-region CH398494.1 1 15909
##sequence-region AAAA02040946.1 1 4894
##sequence-region AAAA02044862.1 1 3104
##sequence-region AAAA02038769.1 1 7272
##sequence-region CH400387.1 1 3123
##sequence-region AAAA02047155.1 1 2531
##sequence-region CH398730.1 1 10621
##sequence-region AAAA02041915.1 1 4293
##sequence-region CH399330.1 1 6080
##sequence-region AAAA02045379.1 1 2967
##sequence-region AAAA02046033.1 1 2802
##sequence-region AAAA02042567.1 1 3969
##sequence-region AAAA02040986.1 1 4869
##sequence-region CH398898.1 1 8707
##sequence-region CH400871.1 1 2340
##sequence-region AAAA02040186.1 1 5452
##sequence-region CH399524.1 1 5269
##sequence-region AAAA02037477.1 1 10613
##sequence-region AAAA02050095.1 1 2019
##sequence-region AAAA02044807.1 1 3117
##sequence-region AAAA02044167.1 1 3319
##sequence-region AAAA02048588.1 1 2257
##sequence-region AAAA02043272.1 1 3648
##sequence-region AAAA02037090.1 1 12376
##sequence-region AAAA02039073.1 1 6855
##sequence-region AAAA02038772.1 1 7271
##sequence-region 9 1 21757032
##sequence-region AAAA02048624.1 1 2252
##sequence-region CH398752.1 1 10356
##sequence-region AAAA02043270.1 1 3648
##sequence-region AAAA02049205.1 1 2162
##sequence-region CH399271.1 1 6356
##sequence-region AAAA02048027.1 1 2359
##sequence-region AAAA02047855.1 1 2391
##sequence-region AAAA02042710.1 1 3880
##sequence-region AAAA02045642.1 1 2896
##sequence-region AAAA02046389.1 1 2712
##sequence-region CH399050.1 1 7596
##sequence-region AAAA02039030.1 1 6918
##sequence-region CH399026.1 1 7728
##sequence-region AAAA02048524.1 1 2268
##sequence-region AAAA02039396.1 1 6332
##sequence-region AAAA02040618.1 1 5117
##sequence-region AAAA02043969.1 1 3386
##sequence-region CH399504.1 1 5339
##sequence-region CH399432.1 1 5620
##sequence-region AAAA02038977.1 1 6978
##sequence-region AAAA02039850.1 1 5787
##sequence-region CH398837.1 1 9433
##sequence-region AAAA02044448.1 1 3230
##sequence-region AAAA02048890.1 1 2209
##sequence-region CH400158.1 1 3591
##sequence-region AAAA02044256.1 1 3291
##sequence-region AAAA02045330.1 1 2982
##sequence-region CH400162.1 1 3584
##sequence-region AAAA02041971.1 1 4267
##sequence-region CH401009.1 1 2178
##sequence-region AAAA02042588.1 1 3961
##sequence-region AAAA02040062.1 1 5559
##sequence-region AAAA02042337.1 1 4083
##sequence-region AAAA02040408.1 1 5266
##sequence-region AAAA02044277.1 1 3286
##sequence-region AAAA02049092.1 1 2180
##sequence-region AAAA02038491.1 1 7777
##sequence-region CH399006.1 1 7859
##sequence-region CH401025.1 1 2162
##sequence-region AAAA02041340.1 1 4641
##sequence-region CH399191.1 1 6854
##sequence-region CH399750.1 1 4624
##sequence-region CH399097.1 1 7289
##sequence-region CH399069.1 1 7478
##sequence-region CH401072.1 1 2114
##sequence-region CH398469.1 1 17039
##sequence-region AAAA02044948.1 1 3083
##sequence-region CH398617.1 1 12235
##sequence-region AAAA02038612.1 1 7574
##sequence-region CH400587.1 1 2796
##sequence-region AAAA02042679.1 1 3900
##sequence-region AAAA02043857.1 1 3414
##sequence-region AAAA02045480.1 1 2935
##sequence-region AAAA02043593.1 1 3511
##sequence-region CH399346.1 1 6011
##sequence-region AAAA02039228.1 1 6628
##sequence-region AAAA02037625.1 1 10185
##sequence-region AAAA02047690.1 1 2421
##sequence-region AAAA02049824.1 1 2061
##sequence-region AAAA02043312.1 1 3624
##sequence-region CH399382.1 1 5834
##sequence-region AAAA02041080.1 1 4796
##sequence-region AAAA02045820.1 1 2847
##sequence-region AAAA02044858.1 1 3105
##sequence-region CH399201.1 1 6805
##sequence-region AAAA02041662.1 1 4443
##sequence-region AAAA02043541.1 1 3532
##sequence-region AAAA02044183.1 1 3315
##sequence-region CH400463.1 1 2994
##sequence-region AAAA02044468.1 1 3217
##sequence-region AAAA02042012.1 1 4246
##sequence-region CH400666.1 1 2673
##sequence-region AAAA02047036.1 1 2557
##sequence-region AAAA02044192.1 1 3313
##sequence-region AAAA02045441.1 1 2947
##sequence-region AAAA02039694.1 1 5958
##sequence-region CH401123.1 1 2050
##sequence-region AAAA02048483.1 1 2276
##sequence-region CH400859.1 1 2359
##sequence-region AAAA02046307.1 1 2734
##sequence-region AAAA02049568.1 1 2106
##sequence-region AAAA02046982.1 1 2567
##sequence-region AAAA02041122.1 1 4771
##sequence-region CH398756.1 1 10304
##sequence-region AAAA02040221.1 1 5425
##sequence-region AAAA02047526.1 1 2448
##sequence-region AAAA02046795.1 1 2615
##sequence-region CH399596.1 1 5046
##sequence-region CH399505.1 1 5338
##sequence-region AAAA02038819.1 1 7200
##sequence-region CH400440.1 1 3034
##sequence-region AAAA02040819.1 1 4966
##sequence-region AAAA02049145.1 1 2172
##sequence-region AAAA02044785.1 1 3123
##sequence-region AAAA02043947.1 1 3392
##sequence-region AAAA02036936.1 1 13612
##sequence-region AAAA02048437.1 1 2283
##sequence-region AAAA02046070.1 1 2795
##sequence-region AAAA02047282.1 1 2500
##sequence-region AAAA02041789.1 1 4374
##sequence-region AAAA02050065.1 1 2024
##sequence-region CH398264.1 1 40901
##sequence-region AAAA02045715.1 1 2876
##sequence-region CH400130.1 1 3656
##sequence-region CH399247.1 1 6578
##sequence-region AAAA02038033.1 1 8783
##sequence-region CH399536.1 1 5236
##sequence-region CH399616.1 1 4968
##sequence-region AAAA02036497.1 1 17307
##sequence-region CH400382.1 1 3133
##sequence-region AAAA02041299.1 1 4665
##sequence-region AAAA02045725.1 1 2872
##sequence-region AAAA02045370.1 1 2970
##sequence-region AAAA02037787.1 1 9638
##sequence-region AAAA02044466.1 1 3218
##sequence-region AAAA02038505.1 1 7751
##sequence-region AAAA02049221.1 1 2160
##sequence-region AAAA02040314.1 1 5339
##sequence-region AAAA02040111.1 1 5517
##sequence-region CH398605.1 1 12582
##sequence-region AAAA02047271.1 1 2504
##sequence-region CH398357.1 1 22293
##sequence-region CH398250.1 1 50075
##sequence-region AAAA02046556.1 1 2672
##sequence-region AAAA02045378.1 1 2967
##sequence-region CH398978.1 1 8096
##sequence-region AAAA02050225.1 1 2001
##sequence-region CH398240.1 1 63035
##sequence-region AAAA02044955.1 1 3080
##sequence-region AAAA02040557.1 1 5162
##sequence-region AAAA02046347.1 1 2722
##sequence-region CH398748.1 1 10402
##sequence-region AAAA02039277.1 1 6564
##sequence-region CH398517.1 1 15210
##sequence-region AAAA02046255.1 1 2747
##sequence-region AAAA02042217.1 1 4140
##sequence-region CH398391.1 1 20374
##sequence-region CH399092.1 1 7326
##sequence-region CH399736.1 1 4649
##sequence-region AAAA02048630.1 1 2251
##sequence-region AAAA02048041.1 1 2358
##sequence-region AAAA02042909.1 1 3798
##sequence-region AAAA02040711.1 1 5047
##sequence-region CH398895.1 1 8741
##sequence-region AAAA02044073.1 1 3347
##sequence-region CH399147.1 1 7069
##sequence-region CH400143.1 1 3625
##sequence-region CH398637.1 1 11913
##sequence-region AAAA02047969.1 1 2369
##sequence-region AAAA02047143.1 1 2534
##sequence-region CH399084.1 1 7368
##sequence-region AAAA02048603.1 1 2255
##sequence-region AAAA02046639.1 1 2648
##sequence-region CH400559.1 1 2825
##sequence-region CH400862.1 1 2357
##sequence-region AAAA02037002.1 1 13093
##sequence-region AAAA02046147.1 1 2774
##sequence-region AAAA02044654.1 1 3166
##sequence-region CH399588.1 1 5061
##sequence-region AAAA02040250.1 1 5390
##sequence-region AAAA02043111.1 1 3711
##sequence-region CH399111.1 1 7220
##sequence-region AAAA02042624.1 1 3939
##sequence-region CH400692.1 1 2630
##sequence-region AAAA02043627.1 1 3502
##sequence-region AAAA02046889.1 1 2592
##sequence-region AAAA02048267.1 1 2312
##sequence-region AAAA02044684.1 1 3155
##sequence-region AAAA02042410.1 1 4051
##sequence-region AAAA02046586.1 1 2663
##sequence-region AAAA02043670.1 1 3485
##sequence-region CH399666.1 1 4837
##sequence-region AAAA02042006.1 1 4248
##sequence-region AAAA02040276.1 1 5372
##sequence-region AAAA02046887.1 1 2592
##sequence-region AAAA02045392.1 1 2962
##sequence-region AAAA02041235.1 1 4693
##sequence-region AAAA02047475.1 1 2456
##sequence-region AAAA02039099.1 1 6829
##sequence-region CH400558.1 1 2826
##sequence-region AAAA02040435.1 1 5250
##sequence-region CH400866.1 1 2348
##sequence-region CH398675.1 1 11325
##sequence-region AAAA02046385.1 1 2712
##sequence-region AAAA02046241.1 1 2754
##sequence-region AAAA02048002.1 1 2363
##sequence-region AAAA02045483.1 1 2934
##sequence-region AAAA02050083.1 1 2021
##sequence-region AAAA02037950.1 1 9076
##sequence-region AAAA02042918.1 1 3792
##sequence-region AAAA02039591.1 1 6100
##sequence-region AAAA02044115.1 1 3336
##sequence-region CH400717.1 1 2595
##sequence-region AAAA02044250.1 1 3292
##sequence-region AAAA02042542.1 1 3982
##sequence-region CH399462.1 1 5504
##sequence-region AAAA02040689.1 1 5063
##sequence-region AAAA02038931.1 1 7054
##sequence-region CH398760.1 1 10291
##sequence-region CH399973.1 1 4051
##sequence-region AAAA02044630.1 1 3173
##sequence-region CH399153.1 1 7024
##sequence-region AAAA02038527.1 1 7707
##sequence-region AAAA02043731.1 1 3458
##sequence-region AAAA02044492.1 1 3211
##sequence-region AAAA02040554.1 1 5163
##sequence-region AAAA02048916.1 1 2206
##sequence-region AAAA02049916.1 1 2047
##sequence-region CH399894.1 1 4234
##sequence-region AAAA02044179.1 1 3316
##sequence-region CH400726.1 1 2580
##sequence-region AAAA02044058.1 1 3350
##sequence-region CH399530.1 1 5258
##sequence-region AAAA02041743.1 1 4399
##sequence-region CH401071.1 1 2115
##sequence-region AAAA02038126.1 1 8580
##sequence-region AAAA02049931.1 1 2045
##sequence-region AAAA02046388.1 1 2712
##sequence-region AAAA02048043.1 1 2358
##sequence-region AAAA02050130.1 1 2014
##sequence-region AAAA02047028.1 1 2558
##sequence-region AAAA02042543.1 1 3982
##sequence-region AAAA02041421.1 1 4605
##sequence-region CH399786.1 1 4506
##sequence-region AAAA02049364.1 1 2138
##sequence-region AAAA02040079.1 1 5546
##sequence-region AAAA02046326.1 1 2730
##sequence-region AAAA02043551.1 1 3529
##sequence-region CH399124.1 1 7181
##sequence-region AAAA02044211.1 1 3304
##sequence-region CH399162.1 1 6978
##sequence-region AAAA02040865.1 1 4941
##sequence-region CH400561.1 1 2823
##sequence-region CH399020.1 1 7793
##sequence-region AAAA02038597.1 1 7589
##sequence-region AAAA02041754.1 1 4396
##sequence-region AAAA02046832.1 1 2606
##sequence-region CH398607.1 1 12576
##sequence-region AAAA02042612.1 1 3944
##sequence-region AAAA02044957.1 1 3080
##sequence-region AAAA02042454.1 1 4027
##sequence-region CH398922.1 1 8540
##sequence-region AAAA02039994.1 1 5631
##sequence-region AAAA02047656.1 1 2427
##sequence-region AAAA02042878.1 1 3806
##sequence-region AAAA02044763.1 1 3131
##sequence-region CH399518.1 1 5299
##sequence-region AAAA02048946.1 1 2202
##sequence-region AAAA02045324.1 1 2984
##sequence-region AAAA02049349.1 1 2140
##sequence-region AAAA02047694.1 1 2420
##sequence-region CH398583.1 1 13232
##sequence-region AAAA02048365.1 1 2296
##sequence-region AAAA02045235.1 1 3008
##sequence-region AAAA02043729.1 1 3460
##sequence-region CH399171.1 1 6950
##sequence-region CH399219.1 1 6734
##sequence-region AAAA02039135.1 1 6774
##sequence-region AAAA02042336.1 1 4083
##sequence-region AAAA02041199.1 1 4720
##sequence-region AAAA02043768.1 1 3442
##sequence-region CH400348.1 1 3204
##sequence-region AAAA02049823.1 1 2061
##sequence-region AAAA02039315.1 1 6466
##sequence-region AAAA02046804.1 1 2614
##sequence-region CH400459.1 1 2998
##sequence-region AAAA02037643.1 1 10123
##sequence-region AAAA02039779.1 1 5878
##sequence-region CH400714.1 1 2600
##sequence-region AAAA02038494.1 1 7775
##sequence-region CH399437.1 1 5590
##sequence-region CH400395.1 1 3114
##sequence-region AAAA02043297.1 1 3632
##sequence-region AAAA02047004.1 1 2563
##sequence-region AAAA02047444.1 1 2462
##sequence-region CH399054.1 1 7580
##sequence-region AAAA02041664.1 1 4443
##sequence-region AAAA02037184.1 1 11852
##sequence-region CH398726.1 1 10691
##sequence-region CH399892.1 1 4242
##sequence-region AAAA02049377.1 1 2137
##sequence-region AAAA02045338.1 1 2980
##sequence-region AAAA02042045.1 1 4219
##sequence-region AAAA02049644.1 1 2094
##sequence-region CH398890.1 1 8778
##sequence-region CH398534.1 1 14738
##sequence-region AAAA02044587.1 1 3185
##sequence-region AAAA02049696.1 1 2083
##sequence-region CH399182.1 1 6885
##sequence-region CH399542.1 1 5216
##sequence-region AAAA02040228.1 1 5413
##sequence-region CH400924.1 1 2281
##sequence-region AAAA02050082.1 1 2021
##sequence-region AAAA02047709.1 1 2418
##sequence-region AAAA02043888.1 1 3407
##sequence-region AAAA02046133.1 1 2779
##sequence-region AAAA02038823.1 1 7194
##sequence-region AAAA02049537.1 1 2110
##sequence-region AAAA02038938.1 1 7038
##sequence-region AAAA02046923.1 1 2584
##sequence-region AAAA02041029.1 1 4831
##sequence-region CH398619.1 1 12173
##sequence-region AAAA02043648.1 1 3495
##sequence-region AAAA02039788.1 1 5868
##sequence-region AAAA02047900.1 1 2383
##sequence-region CH399499.1 1 5356
##sequence-region CH398382.1 1 20778
##sequence-region CH400603.1 1 2772
##sequence-region AAAA02042684.1 1 3897
##sequence-region AAAA02046987.1 1 2566
##sequence-region CH398531.1 1 14814
##sequence-region AAAA02048221.1 1 2323
##sequence-region AAAA02038425.1 1 7881
##sequence-region CH400784.1 1 2456
##sequence-region CH399391.1 1 5784
##sequence-region CH398486.1 1 16409
##sequence-region CH398715.1 1 10801
##sequence-region AAAA02041680.1 1 4439
##sequence-region AAAA02036153.1 1 21340
##sequence-region AAAA02037006.1 1 13053
##sequence-region AAAA02040464.1 1 5224
##sequence-region CH398693.1 1 11082
##sequence-region AAAA02045463.1 1 2940
##sequence-region AAAA02044530.1 1 3201
##sequence-region CH399022.1 1 7776
##sequence-region AAAA02043671.1 1 3485
##sequence-region AAAA02044210.1 1 3304
##sequence-region AAAA02046119.1 1 2782
##sequence-region AAAA02046500.1 1 2686
##sequence-region CH400501.1 1 2908
##sequence-region CH398976.1 1 8121
##sequence-region AAAA02044731.1 1 3141
##sequence-region AAAA02042450.1 1 4030
##sequence-region AAAA02040995.1 1 4864
##sequence-region AAAA02049787.1 1 2066
##sequence-region AAAA02049093.1 1 2180
##sequence-region AAAA02038155.1 1 8500
##sequence-region AAAA02041308.1 1 4662
##sequence-region AAAA02043522.1 1 3538
##sequence-region CH398640.1 1 11870
##sequence-region AAAA02037343.1 1 11202
##sequence-region AAAA02042991.1 1 3760
##sequence-region AAAA02039556.1 1 6146
##sequence-region AAAA02044784.1 1 3123
##sequence-region AAAA02046505.1 1 2684
##sequence-region AAAA02038316.1 1 8151
##sequence-region CH399408.1 1 5733
##sequence-region CH398746.1 1 10407
##sequence-region AAAA02049192.1 1 2164
##sequence-region CH399376.1 1 5869
##sequence-region AAAA02044618.1 1 3176
##sequence-region AAAA02044586.1 1 3186
##sequence-region AAAA02038250.1 1 8281
##sequence-region AAAA02042426.1 1 4044
##sequence-region CH398753.1 1 10355
##sequence-region AAAA02039968.1 1 5658
##sequence-region CH398866.1 1 9042
##sequence-region AAAA02041410.1 1 4612
##sequence-region CH400066.1 1 3801
##sequence-region CH400525.1 1 2869
##sequence-region AAAA02043892.1 1 3405
##sequence-region AAAA02041821.1 1 4358
##sequence-region AAAA02043745.1 1 3450
##sequence-region AAAA02045501.1 1 2930
##sequence-region AAAA02039822.1 1 5825
##sequence-region AAAA02049974.1 1 2039
##sequence-region CH398389.1 1 20404
##sequence-region AAAA02039774.1 1 5881
##sequence-region AAAA02045849.1 1 2840
##sequence-region AAAA02044427.1 1 3238
##sequence-region AAAA02047804.1 1 2401
##sequence-region AAAA02048577.1 1 2260
##sequence-region AAAA02046683.1 1 2640
##sequence-region CH399655.1 1 4882
##sequence-region AAAA02048770.1 1 2228
##sequence-region AAAA02048535.1 1 2265
##sequence-region AAAA02040479.1 1 5216
##sequence-region CH400159.1 1 3591
##sequence-region AAAA02043385.1 1 3596
##sequence-region AAAA02044474.1 1 3215
##sequence-region CH398610.1 1 12524
##sequence-region AAAA02038068.1 1 8697
##sequence-region AAAA02037028.1 1 12783
##sequence-region AAAA02047066.1 1 2549
##sequence-region AAAA02035683.1 1 37581
##sequence-region AAAA02045856.1 1 2838
##sequence-region AAAA02048919.1 1 2206
##sequence-region CH398955.1 1 8280
##sequence-region CH398328.1 1 25609
##sequence-region AAAA02048840.1 1 2218
##sequence-region AAAA02039845.1 1 5796
##sequence-region AAAA02047901.1 1 2382
##sequence-region AAAA02050147.1 1 2012
##sequence-region AAAA02049492.1 1 2118
##sequence-region CH400121.1 1 3670
##sequence-region AAAA02044443.1 1 3232
##sequence-region CH399545.1 1 5207
##sequence-region AAAA02039472.1 1 6252
##sequence-region AAAA02042482.1 1 4015
##sequence-region AAAA02042736.1 1 3868
##sequence-region AAAA02038076.1 1 8690
##sequence-region AAAA02050041.1 1 2026
##sequence-region AAAA02044323.1 1 3272
##sequence-region AAAA02040149.1 1 5497
##sequence-region AAAA02037975.1 1 8994
##sequence-region AAAA02042698.1 1 3889
##sequence-region CH400860.1 1 2358
##sequence-region AAAA02049628.1 1 2097
##sequence-region AAAA02036831.1 1 14378
##sequence-region AAAA02042178.1 1 4154
##sequence-region AAAA02044902.1 1 3095
##sequence-region AAAA02036682.1 1 15617
##sequence-region AAAA02048620.1 1 2252
##sequence-region AAAA02046929.1 1 2583
##sequence-region AAAA02042209.1 1 4141
##sequence-region CH400621.1 1 2741
##sequence-region AAAA02047378.1 1 2476
##sequence-region CH398248.1 1 51904
##sequence-region AAAA02049793.1 1 2065
##sequence-region AAAA02043679.1 1 3482
##sequence-region AAAA02046468.1 1 2693
##sequence-region AAAA02040317.1 1 5338
##sequence-region AAAA02043654.1 1 3492
##sequence-region AAAA02041574.1 1 4497
##sequence-region AAAA02047681.1 1 2423
##sequence-region CH401137.1 1 2034
##sequence-region AAAA02046646.1 1 2647
##sequence-region CH398270.1 1 37396
##sequence-region AAAA02036705.1 1 15293
##sequence-region AAAA02044418.1 1 3241
##sequence-region AAAA02043734.1 1 3455
##sequence-region CH398939.1 1 8365
##sequence-region AAAA02039985.1 1 5642
##sequence-region CH400509.1 1 2900
##sequence-region AAAA02039755.1 1 5897
##sequence-region AAAA02045307.1 1 2989
##sequence-region AAAA02044246.1 1 3293
##sequence-region AAAA02041683.1 1 4438
##sequence-region CH399226.1 1 6687
##sequence-region AAAA02038571.1 1 7627
##sequence-region AAAA02045507.1 1 2928
##sequence-region AAAA02038720.1 1 7357
##sequence-region AAAA02044040.1 1 3356
##sequence-region AAAA02045226.1 1 3013
##sequence-region AAAA02040867.1 1 4941
##sequence-region AAAA02048004.1 1 2362
##sequence-region AAAA02037821.1 1 9527
##sequence-region CH400840.1 1 2381
##sequence-region AAAA02036389.1 1 18744
##sequence-region CH400165.1 1 3574
##sequence-region AAAA02043316.1 1 3622
##sequence-region CH398959.1 1 8256
##sequence-region AAAA02038743.1 1 7323
##sequence-region CH401023.1 1 2164
##sequence-region CH399572.1 1 5113
##sequence-region CH400098.1 1 3722
##sequence-region CH398613.1 1 12416
##sequence-region AAAA02036945.1 1 13471
##sequence-region AAAA02042011.1 1 4246
##sequence-region AAAA02038629.1 1 7533
##sequence-region AAAA02038440.1 1 7855
##sequence-region AAAA02047175.1 1 2527
##sequence-region CH399455.1 1 5518
##sequence-region CH401026.1 1 2161
##sequence-region AAAA02046904.1 1 2589
##sequence-region CH400642.1 1 2708
##sequence-region AAAA02039939.1 1 5702
##sequence-region AAAA02037087.1 1 12408
##sequence-region AAAA02041200.1 1 4720
##sequence-region AAAA02036649.1 1 15764
##sequence-region AAAA02041292.1 1 4669
##sequence-region AAAA02036755.1 1 15023
##sequence-region AAAA02037624.1 1 10185
##sequence-region CH398936.1 1 8403
##sequence-region AAAA02044149.1 1 3326
##sequence-region AAAA02035821.1 1 30430
##sequence-region AAAA02040247.1 1 5393
##sequence-region AAAA02048224.1 1 2322
##sequence-region AAAA02048394.1 1 2291
##sequence-region AAAA02044622.1 1 3175
##sequence-region AAAA02043972.1 1 3385
##sequence-region AAAA02045452.1 1 2944
##sequence-region AAAA02045519.1 1 2924
##sequence-region AAAA02050203.1 1 2003
##sequence-region CH400682.1 1 2643
##sequence-region AAAA02043081.1 1 3720
##sequence-region AAAA02037978.1 1 8988
##sequence-region AAAA02039284.1 1 6539
##sequence-region AAAA02037227.1 1 11750
##sequence-region CH400428.1 1 3055
##sequence-region CH399441.1 1 5573
##sequence-region AAAA02046582.1 1 2665
##sequence-region AAAA02046682.1 1 2640
##sequence-region CH400037.1 1 3850
##sequence-region CH401006.1 1 2181
##sequence-region CH399186.1 1 6876
##sequence-region AAAA02038205.1 1 8360
##sequence-region AAAA02040078.1 1 5547
##sequence-region CH400724.1 1 2581
##sequence-region AAAA02041807.1 1 4366
##sequence-region AAAA02047643.1 1 2429
##sequence-region CH400969.1 1 2227
##sequence-region AAAA02047076.1 1 2546
##sequence-region CH400706.1 1 2612
##sequence-region AAAA02039390.1 1 6345
##sequence-region AAAA02049850.1 1 2057
##sequence-region AAAA02049682.1 1 2087
##sequence-region AAAA02043277.1 1 3645
##sequence-region CH398456.1 1 17444
##sequence-region AAAA02038034.1 1 8781
##sequence-region AAAA02045615.1 1 2901
##sequence-region AAAA02043110.1 1 3712
##sequence-region AAAA02049059.1 1 2185
##sequence-region AAAA02040643.1 1 5103
##sequence-region AAAA02040390.1 1 5281
##sequence-region AAAA02039957.1 1 5671
##sequence-region CH399317.1 1 6143
##sequence-region AAAA02045836.1 1 2844
##sequence-region AAAA02041481.1 1 4564
##sequence-region CH400857.1 1 2361
##sequence-region AAAA02040657.1 1 5097
##sequence-region AAAA02039775.1 1 5880
##sequence-region AAAA02047398.1 1 2471
##sequence-region AAAA02042535.1 1 3989
##sequence-region CH399729.1 1 4669
##sequence-region AAAA02043329.1 1 3615
##sequence-region AAAA02049470.1 1 2122
##sequence-region AAAA02043092.1 1 3716
##sequence-region AAAA02048347.1 1 2300
##sequence-region CH400493.1 1 2928
##sequence-region AAAA02042747.1 1 3864
##sequence-region AAAA02044495.1 1 3210
##sequence-region CH398950.1 1 8334
##sequence-region AAAA02047766.1 1 2407
##sequence-region AAAA02046566.1 1 2670
##sequence-region AAAA02042467.1 1 4018
##sequence-region AAAA02048507.1 1 2271
##sequence-region AAAA02047623.1 1 2433
##sequence-region AAAA02049251.1 1 2155
##sequence-region CH399595.1 1 5047
##sequence-region CH400155.1 1 3594
##sequence-region AAAA02045242.1 1 3006
##sequence-region AAAA02041601.1 1 4480
##sequence-region AAAA02046690.1 1 2638
##sequence-region CH398516.1 1 15213
##sequence-region AAAA02045614.1 1 2901
##sequence-region AAAA02047303.1 1 2495
##sequence-region CH399323.1 1 6108
##sequence-region AAAA02039289.1 1 6527
##sequence-region CH398331.1 1 25567
##sequence-region AAAA02049789.1 1 2066
##sequence-region AAAA02048665.1 1 2246
##sequence-region AAAA02037486.1 1 10561
##sequence-region AAAA02043436.1 1 3576
##sequence-region CH400993.1 1 2199
##sequence-region CH398322.1 1 26216
##sequence-region CH401097.1 1 2080
##sequence-region AAAA02043406.1 1 3589
##sequence-region AAAA02041465.1 1 4569
##sequence-region CH401052.1 1 2137
##sequence-region CH400280.1 1 3339
##sequence-region AAAA02037058.1 1 12563
##sequence-region AAAA02044009.1 1 3365
##sequence-region CH399638.1 1 4915
##sequence-region AAAA02043538.1 1 3533
##sequence-region AAAA02040153.1 1 5490
##sequence-region AAAA02037328.1 1 11267
##sequence-region CH400330.1 1 3254
##sequence-region CH398665.1 1 11518
##sequence-region CH399272.1 1 6330
##sequence-region AAAA02040057.1 1 5564
##sequence-region CH398565.1 1 13714
##sequence-region CH398606.1 1 12580
##sequence-region AAAA02046045.1 1 2800
##sequence-region AAAA02048417.1 1 2286
##sequence-region AAAA02045017.1 1 3064
##sequence-region AAAA02048693.1 1 2240
##sequence-region AAAA02048111.1 1 2345
##sequence-region CH400339.1 1 3230
##sequence-region AAAA02040033.1 1 5584
##sequence-region AAAA02047072.1 1 2548
##sequence-region CH399396.1 1 5765
##sequence-region AAAA02039296.1 1 6510
##sequence-region AAAA02036472.1 1 17644
##sequence-region CH398265.1 1 40281
##sequence-region CH398834.1 1 9438
##sequence-region AAAA02046230.1 1 2755
##sequence-region AAAA02048019.1 1 2361
##sequence-region CH398743.1 1 10457
##sequence-region AAAA02047429.1 1 2465
##sequence-region AAAA02040540.1 1 5167
##sequence-region CH398241.1 1 62442
##sequence-region CH401056.1 1 2133
##sequence-region CH399183.1 1 6883
##sequence-region AAAA02043204.1 1 3676
##sequence-region AAAA02036431.1 1 18275
##sequence-region AAAA02045297.1 1 2991
##sequence-region AAAA02045590.1 1 2905
##sequence-region AAAA02045264.1 1 3001
##sequence-region AAAA02041226.1 1 4702
##sequence-region CH399469.1 1 5488
##sequence-region CH400544.1 1 2846
##sequence-region AAAA02045855.1 1 2838
##sequence-region AAAA02038018.1 1 8831
##sequence-region AAAA02041854.1 1 4333
##sequence-region AAAA02046747.1 1 2625
##sequence-region CH399302.1 1 6218
##sequence-region CH399984.1 1 4016
##sequence-region AAAA02040805.1 1 4979
##sequence-region AAAA02048375.1 1 2295
##sequence-region AAAA02040252.1 1 5386
##sequence-region AAAA02041001.1 1 4857
##sequence-region CH398690.1 1 11163
##sequence-region CH400684.1 1 2641
##sequence-region AAAA02041933.1 1 4284
##sequence-region AAAA02049455.1 1 2124
##sequence-region AAAA02044826.1 1 3114
##sequence-region AAAA02046448.1 1 2699
##sequence-region CH400136.1 1 3651
##sequence-region CH400141.1 1 3630
##sequence-region CH399719.1 1 4682
##sequence-region AAAA02043049.1 1 3732
##sequence-region AAAA02048407.1 1 2288
##sequence-region AAAA02041375.1 1 4627
##sequence-region CH399721.1 1 4679
##sequence-region AAAA02043405.1 1 3590
##sequence-region AAAA02043724.1 1 3462
##sequence-region AAAA02040507.1 1 5196
##sequence-region AAAA02045271.1 1 2999
##sequence-region CH398650.1 1 11774
##sequence-region AAAA02041397.1 1 4619
##sequence-region AAAA02046564.1 1 2671
##sequence-region CH399647.1 1 4904
##sequence-region AAAA02036617.1 1 16191
##sequence-region AAAA02042694.1 1 3892
##sequence-region AAAA02039220.1 1 6644
##sequence-region CH398892.1 1 8769
##sequence-region AAAA02042144.1 1 4163
##sequence-region AAAA02046751.1 1 2624
##sequence-region CH398316.1 1 26515
##sequence-region AAAA02048261.1 1 2313
##sequence-region AAAA02041725.1 1 4406
##sequence-region AAAA02045180.1 1 3026
##sequence-region AAAA02046238.1 1 2754
##sequence-region AAAA02042478.1 1 4016
##sequence-region AAAA02045857.1 1 2838
##sequence-region AAAA02040406.1 1 5267
##sequence-region AAAA02046134.1 1 2779
##sequence-region AAAA02043592.1 1 3512
##sequence-region AAAA02047910.1 1 2381
##sequence-region AAAA02035863.1 1 28447
##sequence-region AAAA02038352.1 1 8034
##sequence-region AAAA02042216.1 1 4140
##sequence-region AAAA02040392.1 1 5279
##sequence-region AAAA02041206.1 1 4718
##sequence-region CH399082.1 1 7389
##sequence-region AAAA02043499.1 1 3547
##sequence-region AAAA02038244.1 1 8301
##sequence-region AAAA02049252.1 1 2155
##sequence-region CH398476.1 1 16807
##sequence-region AAAA02047488.1 1 2455
##sequence-region AAAA02039350.1 1 6406
##sequence-region AAAA02039391.1 1 6342
##sequence-region CH398364.1 1 21923
##sequence-region AAAA02042368.1 1 4072
##sequence-region AAAA02040279.1 1 5370
##sequence-region CH400205.1 1 3495
##sequence-region CH400625.1 1 2733
##sequence-region CH398547.1 1 14302
##sequence-region AAAA02040708.1 1 5050
##sequence-region CH400691.1 1 2630
##sequence-region AAAA02046916.1 1 2586
##sequence-region CH398394.1 1 20319
##sequence-region AAAA02041286.1 1 4670
##sequence-region AAAA02046861.1 1 2599
##sequence-region AAAA02048932.1 1 2204
##sequence-region AAAA02046104.1 1 2785
##sequence-region AAAA02049031.1 1 2189
##sequence-region AAAA02036750.1 1 15057
##sequence-region CH399454.1 1 5519
##sequence-region AAAA02042398.1 1 4056
##sequence-region AAAA02041140.1 1 4756
##sequence-region CH400426.1 1 3058
##sequence-region CH399830.1 1 4397
##sequence-region AAAA02047414.1 1 2468
##sequence-region AAAA02038149.1 1 8521
##sequence-region AAAA02044472.1 1 3216
##sequence-region AAAA02044400.1 1 3250
##sequence-region AAAA02042966.1 1 3770
##sequence-region CH398256.1 1 43850
##sequence-region CH398481.1 1 16769
##sequence-region CH399490.1 1 5384
##sequence-region CH400271.1 1 3354
##sequence-region AAAA02042113.1 1 4179
##sequence-region AAAA02042126.1 1 4172
##sequence-region AAAA02045810.1 1 2849
##sequence-region AAAA02042974.1 1 3768
##sequence-region AAAA02041571.1 1 4499
##sequence-region AAAA02042681.1 1 3900
##sequence-region CH399815.1 1 4436
##sequence-region AAAA02047255.1 1 2509
##sequence-region AAAA02049009.1 1 2193
##sequence-region AAAA02049914.1 1 2048
##sequence-region AAAA02038169.1 1 8455
##sequence-region CH398778.1 1 10096
##sequence-region AAAA02041174.1 1 4739
##sequence-region CH399776.1 1 4549
##sequence-region CH400200.1 1 3507
##sequence-region AAAA02049329.1 1 2143
##sequence-region AAAA02046359.1 1 2719
##sequence-region AAAA02047319.1 1 2491
##sequence-region AAAA02047069.1 1 2549
##sequence-region CH399412.1 1 5721
##sequence-region AAAA02043545.1 1 3531
##sequence-region CH398347.1 1 23570
##sequence-region CH400422.1 1 3063
##sequence-region AAAA02040086.1 1 5543
##sequence-region AAAA02046010.1 1 2804
##sequence-region CH399018.1 1 7807
##sequence-region CH399866.1 1 4285
##sequence-region CH398302.1 1 28992
##sequence-region AAAA02047099.1 1 2543
##sequence-region CH398502.1 1 15702
##sequence-region AAAA02041414.1 1 4609
##sequence-region AAAA02047094.1 1 2543
##sequence-region CH398501.1 1 15716
##sequence-region CH399876.1 1 4275
##sequence-region AAAA02038156.1 1 8498
##sequence-region AAAA02040806.1 1 4978
##sequence-region CH398269.1 1 37876
##sequence-region CH399352.1 1 5959
##sequence-region CH399177.1 1 6914
##sequence-region CH401076.1 1 2108
##sequence-region AAAA02042781.1 1 3848
##sequence-region AAAA02048194.1 1 2327
##sequence-region AAAA02044327.1 1 3270
##sequence-region CH398755.1 1 10312
##sequence-region AAAA02047621.1 1 2433
##sequence-region CH400842.1 1 2377
##sequence-region CH399846.1 1 4356
##sequence-region AAAA02047447.1 1 2461
##sequence-region AAAA02036185.1 1 20883
##sequence-region AAAA02044385.1 1 3256
##sequence-region AAAA02038125.1 1 8584
##sequence-region AAAA02041784.1 1 4378
##sequence-region CH398717.1 1 10787
##sequence-region AAAA02048006.1 1 2362
##sequence-region AAAA02042742.1 1 3865
##sequence-region AAAA02035471.1 1 64700
##sequence-region CH399826.1 1 4400
##sequence-region AAAA02036741.1 1 15101
##sequence-region AAAA02041872.1 1 4322
##sequence-region CH398306.1 1 28341
##sequence-region AAAA02041628.1 1 4464
##sequence-region AAAA02043233.1 1 3664
##sequence-region AAAA02042150.1 1 4162
##sequence-region CH401019.1 1 2168
##sequence-region AAAA02048789.1 1 2225
##sequence-region CH400514.1 1 2893
##sequence-region CH399475.1 1 5462
##sequence-region CH398535.1 1 14711
##sequence-region AAAA02040866.1 1 4941
##sequence-region AAAA02040583.1 1 5139
##sequence-region CH400945.1 1 2257
##sequence-region CH399937.1 1 4133
##sequence-region AAAA02043530.1 1 3534
##sequence-region AAAA02044818.1 1 3116
##sequence-region AAAA02045852.1 1 2839
##sequence-region AAAA02048348.1 1 2299
##sequence-region CH399618.1 1 4964
##sequence-region AAAA02042592.1 1 3958
##sequence-region CH398808.1 1 9780
##sequence-region CH401060.1 1 2124
##sequence-region AAAA02041227.1 1 4702
##sequence-region AAAA02043501.1 1 3546
##sequence-region AAAA02044452.1 1 3226
##sequence-region AAAA02039140.1 1 6768
##sequence-region CH401070.1 1 2115
##sequence-region AAAA02047149.1 1 2532
##sequence-region CH398309.1 1 27531
##sequence-region AAAA02043811.1 1 3428
##sequence-region AAAA02047487.1 1 2455
##sequence-region CH400379.1 1 3144
##sequence-region CH398601.1 1 12698
##sequence-region AAAA02042837.1 1 3828
##sequence-region CH398482.1 1 16742
##sequence-region AAAA02038336.1 1 8092
##sequence-region AAAA02045650.1 1 2894
##sequence-region AAAA02046013.1 1 2804
##sequence-region AAAA02044453.1 1 3226
##sequence-region AAAA02043785.1 1 3436
##sequence-region AAAA02040131.1 1 5505
##sequence-region CH398961.1 1 8226
##sequence-region AAAA02047280.1 1 2501
##sequence-region CH398567.1 1 13698
##sequence-region AAAA02037802.1 1 9604
##sequence-region AAAA02046612.1 1 2656
##sequence-region CH398910.1 1 8630
##sequence-region AAAA02049703.1 1 2082
##sequence-region AAAA02037857.1 1 9420
##sequence-region AAAA02041302.1 1 4664
##sequence-region AAAA02040595.1 1 5131
##sequence-region AAAA02049980.1 1 2038
##sequence-region AAAA02043925.1 1 3395
##sequence-region AAAA02036784.1 1 14839
##sequence-region AAAA02039239.1 1 6615
##sequence-region AAAA02048008.1 1 2362
##sequence-region CH398669.1 1 11466
##sequence-region AAAA02039539.1 1 6164
##sequence-region AAAA02049887.1 1 2052
##sequence-region AAAA02040535.1 1 5171
##sequence-region AAAA02042814.1 1 3838
##sequence-region CH399835.1 1 4385
##sequence-region AAAA02047315.1 1 2491
##sequence-region AAAA02045181.1 1 3025
##sequence-region AAAA02047387.1 1 2474
##sequence-region AAAA02036009.1 1 24349
##sequence-region AAAA02045096.1 1 3047
##sequence-region AAAA02045061.1 1 3055
##sequence-region AAAA02043482.1 1 3554
##sequence-region AAAA02042234.1 1 4136
##sequence-region CH400319.1 1 3275
##sequence-region AAAA02049784.1 1 2067
##sequence-region AAAA02040128.1 1 5507
##sequence-region AAAA02039678.1 1 5983
##sequence-region CH400807.1 1 2431
##sequence-region CH398377.1 1 20925
##sequence-region AAAA02045709.1 1 2878
##sequence-region AAAA02043045.1 1 3733
##sequence-region AAAA02040251.1 1 5388
##sequence-region AAAA02045891.1 1 2829
##sequence-region CH399869.1 1 4282
##sequence-region CH399307.1 1 6192
##sequence-region AAAA02048400.1 1 2290
##sequence-region AAAA02046090.1 1 2790
##sequence-region CH400279.1 1 3340
##sequence-region CH398487.1 1 16336
##sequence-region AAAA02043893.1 1 3405
##sequence-region AAAA02046694.1 1 2636
##sequence-region CH398581.1 1 13271
##sequence-region AAAA02043197.1 1 3678
##sequence-region CH399231.1 1 6654
##sequence-region CH398603.1 1 12610
##sequence-region AAAA02047909.1 1 2381
##sequence-region AAAA02048888.1 1 2209
##sequence-region AAAA02049572.1 1 2106
##sequence-region AAAA02040660.1 1 5094
##sequence-region AAAA02045292.1 1 2994
##sequence-region AAAA02042970.1 1 3770
##sequence-region AAAA02039847.1 1 5792
##sequence-region CH399113.1 1 7211
##sequence-region AAAA02048143.1 1 2338
##sequence-region AAAA02039938.1 1 5705
##sequence-region AAAA02039170.1 1 6720
##sequence-region AAAA02044847.1 1 3108
##sequence-region AAAA02037725.1 1 9843
##sequence-region CH399227.1 1 6685
##sequence-region AAAA02045721.1 1 2874
##sequence-region AAAA02043294.1 1 3633
##sequence-region CH399554.1 1 5167
##sequence-region AAAA02046477.1 1 2690
##sequence-region CH398796.1 1 9887
##sequence-region AAAA02049128.1 1 2174
##sequence-region CH400693.1 1 2630
##sequence-region AAAA02041078.1 1 4796
##sequence-region AAAA02042115.1 1 4178
##sequence-region CH399104.1 1 7258
##sequence-region CH398844.1 1 9318
##sequence-region AAAA02050034.1 1 2028
##sequence-region AAAA02036010.1 1 24099
##sequence-region CH399790.1 1 4498
##sequence-region AAAA02049618.1 1 2099
##sequence-region AAAA02048612.1 1 2253
##sequence-region CH400333.1 1 3251
##sequence-region CH398332.1 1 25549
##sequence-region CH398818.1 1 9646
##sequence-region AAAA02036560.1 1 16895
##sequence-region AAAA02045088.1 1 3048
##sequence-region AAAA02040841.1 1 4950
##sequence-region CH399526.1 1 5266
##sequence-region AAAA02048615.1 1 2253
##sequence-region AAAA02049051.1 1 2186
##sequence-region AAAA02040241.1 1 5401
##sequence-region AAAA02042051.1 1 4216
##sequence-region CH401139.1 1 2030
##sequence-region AAAA02046036.1 1 2802
##sequence-region AAAA02039670.1 1 6001
##sequence-region CH398280.1 1 34890
##sequence-region AAAA02042598.1 1 3953
##sequence-region CH399574.1 1 5110
##sequence-region AAAA02041539.1 1 4519
##sequence-region AAAA02038470.1 1 7812
##sequence-region AAAA02046534.1 1 2676
##sequence-region AAAA02043546.1 1 3531
##sequence-region AAAA02040505.1 1 5198
##sequence-region CH399073.1 1 7462
##sequence-region CH398308.1 1 27682
##sequence-region AAAA02042917.1 1 3793
##sequence-region AAAA02044435.1 1 3236
##sequence-region CH398503.1 1 15679
##sequence-region AAAA02045674.1 1 2886
##sequence-region AAAA02043910.1 1 3400
##sequence-region AAAA02039656.1 1 6016
##sequence-region AAAA02047226.1 1 2516
##sequence-region AAAA02040060.1 1 5562
##sequence-region AAAA02045258.1 1 3003
##sequence-region AAAA02048284.1 1 2310
##sequence-region AAAA02040906.1 1 4915
##sequence-region AAAA02046346.1 1 2723
##sequence-region AAAA02045389.1 1 2963
##sequence-region CH398689.1 1 11172
##sequence-region AAAA02036236.1 1 20459
##sequence-region AAAA02050214.1 1 2002
##sequence-region AAAA02046607.1 1 2657
##sequence-region CH398362.1 1 22002
##sequence-region AAAA02039229.1 1 6624
##sequence-region CH398329.1 1 25598
##sequence-region AAAA02044871.1 1 3103
##sequence-region CH399678.1 1 4799
##sequence-region AAAA02045635.1 1 2898
##sequence-region AAAA02044600.1 1 3182
##sequence-region AAAA02046579.1 1 2666
##sequence-region CH398444.1 1 17925
##sequence-region AAAA02048150.1 1 2336
##sequence-region AAAA02047454.1 1 2460
##sequence-region AAAA02049002.1 1 2195
##sequence-region AAAA02038115.1 1 8600
##sequence-region AAAA02045626.1 1 2900
##sequence-region AAAA02045179.1 1 3026
##sequence-region AAAA02045969.1 1 2815
##sequence-region AAAA02044579.1 1 3188
##sequence-region CH399102.1 1 7271
##sequence-region AAAA02048804.1 1 2222
##sequence-region CH400567.1 1 2816
##sequence-region AAAA02043113.1 1 3710
##sequence-region AAAA02041244.1 1 4688
##sequence-region AAAA02050060.1 1 2024
##sequence-region AAAA02036407.1 1 18477
##sequence-region AAAA02043980.1 1 3380
##sequence-region CH400368.1 1 3166
##sequence-region AAAA02042411.1 1 4051
##sequence-region AAAA02037344.1 1 11199
##sequence-region CH399533.1 1 5244
##sequence-region AAAA02042898.1 1 3801
##sequence-region AAAA02045275.1 1 2997
##sequence-region CH398674.1 1 11366
##sequence-region AAAA02040620.1 1 5115
##sequence-region CH399981.1 1 4019
##sequence-region CH398711.1 1 10876
##sequence-region AAAA02036879.1 1 14004
##sequence-region CH398980.1 1 8066
##sequence-region CH398908.1 1 8636
##sequence-region AAAA02042143.1 1 4164
##sequence-region AAAA02037319.1 1 11305
##sequence-region AAAA02041250.1 1 4687
##sequence-region CH398923.1 1 8538
##sequence-region AAAA02043015.1 1 3748
##sequence-region AAAA02043337.1 1 3613
##sequence-region AAAA02044106.1 1 3338
##sequence-region AAAA02046060.1 1 2797
##sequence-region CH399075.1 1 7454
##sequence-region AAAA02041715.1 1 4410
##sequence-region AAAA02047830.1 1 2395
##sequence-region AAAA02036277.1 1 20187
##sequence-region AAAA02047459.1 1 2459
##sequence-region AAAA02042016.1 1 4243
##sequence-region CH398846.1 1 9278
##sequence-region AAAA02038806.1 1 7216
##sequence-region AAAA02040856.1 1 4944
##sequence-region AAAA02046767.1 1 2620
##sequence-region AAAA02040918.1 1 4912
##sequence-region CH398901.1 1 8700
##sequence-region CH399487.1 1 5398
##sequence-region CH398473.1 1 16945
##sequence-region AAAA02037588.1 1 10258
##sequence-region AAAA02046375.1 1 2713
##sequence-region AAAA02039294.1 1 6512
##sequence-region CH399583.1 1 5091
##sequence-region CH398592.1 1 12951
##sequence-region AAAA02048574.1 1 2260
##sequence-region CH400351.1 1 3202
##sequence-region AAAA02038319.1 1 8144
##sequence-region AAAA02042077.1 1 4199
##sequence-region AAAA02037889.1 1 9277
##sequence-region AAAA02040686.1 1 5068
##sequence-region AAAA02041019.1 1 4846
##sequence-region AAAA02046524.1 1 2679
##sequence-region AAAA02046181.1 1 2767
##sequence-region CH400576.1 1 2807
##sequence-region CH398791.1 1 9953
##sequence-region CH400550.1 1 2834
##sequence-region CH398415.1 1 19326
##sequence-region AAAA02047260.1 1 2508
##sequence-region CH400824.1 1 2402
##sequence-region AAAA02039869.1 1 5766
##sequence-region CH398307.1 1 27832
##sequence-region AAAA02037982.1 1 8936
##sequence-region AAAA02049594.1 1 2103
##sequence-region AAAA02045246.1 1 3005
##sequence-region AAAA02043716.1 1 3470
##sequence-region AAAA02036907.1 1 13721
##sequence-region AAAA02047644.1 1 2429
##sequence-region CH400087.1 1 3736
##sequence-region CH399123.1 1 7181
##sequence-region AAAA02045484.1 1 2934
##sequence-region AAAA02042714.1 1 3878
##sequence-region AAAA02049621.1 1 2099
##sequence-region AAAA02044775.1 1 3128
##sequence-region AAAA02041695.1 1 4427
##sequence-region CH398440.1 1 18110
##sequence-region AAAA02046202.1 1 2761
##sequence-region AAAA02041367.1 1 4631
##sequence-region CH400534.1 1 2859
##sequence-region AAAA02041832.1 1 4352
##sequence-region CH398870.1 1 8992
##sequence-region AAAA02048023.1 1 2360
##sequence-region AAAA02043083.1 1 3719
##sequence-region CH398434.1 1 18341
##sequence-region CH399774.1 1 4555
##sequence-region AAAA02039297.1 1 6510
##sequence-region AAAA02040908.1 1 4915
##sequence-region AAAA02043493.1 1 3550
##sequence-region AAAA02039352.1 1 6402
##sequence-region CH399828.1 1 4399
##sequence-region AAAA02036812.1 1 14545
##sequence-region AAAA02041882.1 1 4314
##sequence-region AAAA02043930.1 1 3395
##sequence-region CH400209.1 1 3484
##sequence-region AAAA02043216.1 1 3672
##sequence-region CH400308.1 1 3289
##sequence-region AAAA02041114.1 1 4775
##sequence-region AAAA02042275.1 1 4121
##sequence-region CH398582.1 1 13268
##sequence-region AAAA02045497.1 1 2931
##sequence-region CH399586.1 1 5081
##sequence-region AAAA02042975.1 1 3768
##sequence-region CH400056.1 1 3812
##sequence-region AAAA02046436.1 1 2702
##sequence-region CH399019.1 1 7802
##sequence-region CH400408.1 1 3093
##sequence-region AAAA02047697.1 1 2420
##sequence-region CH398763.1 1 10253
##sequence-region CH398291.1 1 31625
##sequence-region CH399175.1 1 6930
##sequence-region AAAA02045303.1 1 2990
##sequence-region AAAA02048373.1 1 2295
##sequence-region AAAA02049153.1 1 2171
##sequence-region CH401048.1 1 2139
##sequence-region AAAA02037078.1 1 12444
##sequence-region AAAA02050184.1 1 2006
##sequence-region AAAA02046397.1 1 2710
##sequence-region AAAA02042769.1 1 3853
##sequence-region CH399284.1 1 6300
##sequence-region AAAA02044591.1 1 3184
##sequence-region AAAA02049803.1 1 2064
##sequence-region AAAA02043810.1 1 3428
##sequence-region CH399988.1 1 4006
##sequence-region CH398359.1 1 22199
##sequence-region AAAA02042283.1 1 4118
##sequence-region AAAA02038509.1 1 7732
##sequence-region AAAA02042451.1 1 4027
##sequence-region AAAA02044168.1 1 3319
##sequence-region AAAA02047316.1 1 2491
##sequence-region AAAA02042033.1 1 4227
##sequence-region AAAA02048338.1 1 2302
##sequence-region CH398512.1 1 15284
##sequence-region AAAA02048070.1 1 2352
##sequence-region AAAA02045117.1 1 3041
##sequence-region AAAA02043290.1 1 3638
##sequence-region CH401091.1 1 2085
##sequence-region AAAA02044893.1 1 3097
##sequence-region CH398786.1 1 10024
##sequence-region AAAA02042626.1 1 3938
##sequence-region AAAA02045116.1 1 3041
##sequence-region AAAA02042433.1 1 4040
##sequence-region AAAA02050223.1 1 2001
##sequence-region CH399316.1 1 6146
##sequence-region AAAA02047268.1 1 2505
##sequence-region CH399137.1 1 7129
##sequence-region CH400749.1 1 2530
##sequence-region AAAA02040000.1 1 5628
##sequence-region AAAA02044451.1 1 3226
##sequence-region AAAA02045112.1 1 3043
##sequence-region AAAA02042132.1 1 4168
##sequence-region AAAA02044508.1 1 3207
##sequence-region AAAA02047156.1 1 2531
##sequence-region AAAA02040758.1 1 5009
##sequence-region AAAA02047564.1 1 2443
##sequence-region AAAA02046046.1 1 2799
##sequence-region CH398734.1 1 10541
##sequence-region AAAA02043504.1 1 3544
##sequence-region CH401040.1 1 2146
##sequence-region AAAA02041649.1 1 4453
##sequence-region AAAA02038148.1 1 8524
##sequence-region CH399157.1 1 7018
##sequence-region CH400134.1 1 3653
##sequence-region AAAA02048432.1 1 2284
##sequence-region AAAA02045691.1 1 2881
##sequence-region CH400615.1 1 2755
##sequence-region AAAA02045425.1 1 2953
##sequence-region AAAA02036752.1 1 15039
##sequence-region AAAA02048740.1 1 2233
##sequence-region CH399293.1 1 6251
##sequence-region AAAA02048902.1 1 2208
##sequence-region AAAA02038671.1 1 7462
##sequence-region AAAA02041950.1 1 4279
##sequence-region AAAA02041631.1 1 4461
##sequence-region AAAA02039551.1 1 6150
##sequence-region AAAA02041332.1 1 4647
##sequence-region CH399285.1 1 6298
##sequence-region AAAA02040983.1 1 4872
##sequence-region CH399098.1 1 7288
##sequence-region AAAA02043065.1 1 3725
##sequence-region AAAA02045187.1 1 3024
##sequence-region CH398443.1 1 17936
##sequence-region CH400678.1 1 2648
##sequence-region AAAA02036751.1 1 15050
##sequence-region AAAA02038928.1 1 7060
##sequence-region CH401129.1 1 2042
##sequence-region AAAA02040183.1 1 5456
##sequence-region AAAA02043824.1 1 3424
##sequence-region AAAA02045726.1 1 2872
##sequence-region CH398649.1 1 11779
##sequence-region AAAA02044990.1 1 3071
##sequence-region CH398311.1 1 27482
##sequence-region AAAA02036828.1 1 14403
##sequence-region CH400744.1 1 2538
##sequence-region AAAA02046622.1 1 2653
##sequence-region CH400262.1 1 3382
##sequence-region AAAA02043509.1 1 3543
##sequence-region AAAA02045557.1 1 2913
##sequence-region AAAA02049646.1 1 2093
##sequence-region AAAA02040226.1 1 5421
##sequence-region AAAA02043726.1 1 3461
##sequence-region AAAA02046315.1 1 2732
##sequence-region AAAA02044771.1 1 3129
##sequence-region AAAA02039981.1 1 5649
##sequence-region AAAA02037890.1 1 9276
##sequence-region AAAA02042325.1 1 4087
##sequence-region AAAA02044653.1 1 3166
##sequence-region CH399476.1 1 5455
##sequence-region AAAA02041723.1 1 4408
##sequence-region CH399312.1 1 6165
##sequence-region CH400536.1 1 2855
##sequence-region AAAA02043184.1 1 3685
##sequence-region CH400990.1 1 2202
##sequence-region CH398366.1 1 21736
##sequence-region AAAA02049401.1 1 2134
##sequence-region AAAA02042578.1 1 3964
##sequence-region CH398474.1 1 16876
##sequence-region CH398695.1 1 11063
##sequence-region CH399362.1 1 5923
##sequence-region AAAA02040887.1 1 4926
##sequence-region AAAA02040067.1 1 5557
##sequence-region AAAA02047438.1 1 2464
##sequence-region AAAA02046018.1 1 2804
##sequence-region CH400551.1 1 2833
##sequence-region AAAA02040588.1 1 5136
##sequence-region AAAA02036366.1 1 19093
##sequence-region AAAA02049443.1 1 2127
##sequence-region CH399187.1 1 6872
##sequence-region CH400320.1 1 3274
##sequence-region CH398792.1 1 9936
##sequence-region AAAA02050202.1 1 2003
##sequence-region AAAA02050212.1 1 2002
##sequence-region AAAA02045904.1 1 2826
##sequence-region CH398867.1 1 9026
##sequence-region CH400566.1 1 2819
##sequence-region CH399429.1 1 5628
##sequence-region AAAA02045322.1 1 2985
##sequence-region CH400623.1 1 2740
##sequence-region AAAA02038596.1 1 7592
##sequence-region AAAA02039511.1 1 6198
##sequence-region CH400707.1 1 2610
##sequence-region CH400955.1 1 2246
##sequence-region AAAA02041904.1 1 4297
##sequence-region AAAA02036761.1 1 14984
##sequence-region CH400263.1 1 3373
##sequence-region AAAA02044674.1 1 3160
##sequence-region CH400718.1 1 2592
##sequence-region AAAA02048881.1 1 2210
##sequence-region AAAA02035470.1 1 68340
##sequence-region CH399207.1 1 6780
##sequence-region CH399282.1 1 6305
##sequence-region CH400207.1 1 3488
##sequence-region AAAA02040753.1 1 5015
##sequence-region CH399257.1 1 6451
##sequence-region AAAA02047279.1 1 2501
##sequence-region AAAA02045646.1 1 2895
##sequence-region AAAA02046370.1 1 2714
##sequence-region AAAA02043547.1 1 3531
##sequence-region AAAA02038710.1 1 7371
##sequence-region AAAA02045956.1 1 2817
##sequence-region AAAA02045984.1 1 2811
##sequence-region AAAA02041424.1 1 4604
##sequence-region AAAA02045019.1 1 3064
##sequence-region AAAA02043039.1 1 3734
##sequence-region CH400425.1 1 3059
##sequence-region AAAA02045433.1 1 2950
##sequence-region AAAA02046930.1 1 2582
##sequence-region CH398735.1 1 10539
##sequence-region CH399541.1 1 5221
##sequence-region AAAA02048689.1 1 2241
##sequence-region AAAA02047091.1 1 2544
##sequence-region AAAA02036602.1 1 16480
##sequence-region AAAA02044694.1 1 3151
##sequence-region AAAA02042457.1 1 4024
##sequence-region CH398632.1 1 11950
##sequence-region CH399943.1 1 4126
##sequence-region CH398933.1 1 8413
##sequence-region CH400236.1 1 3420
##sequence-region CH399768.1 1 4566
##sequence-region CH398634.1 1 11920
##sequence-region AAAA02044507.1 1 3208
##sequence-region AAAA02038515.1 1 7724
##sequence-region AAAA02042253.1 1 4129
##sequence-region AAAA02047967.1 1 2369
##sequence-region CH399438.1 1 5587
##sequence-region CH400657.1 1 2689
##sequence-region AAAA02047074.1 1 2547
##sequence-region CH399274.1 1 6323
##sequence-region AAAA02041058.1 1 4808
##sequence-region AAAA02050163.1 1 2009
##sequence-region AAAA02045858.1 1 2838
##sequence-region AAAA02039461.1 1 6264
##sequence-region CH398585.1 1 13203
##sequence-region AAAA02046629.1 1 2651
##sequence-region CH401102.1 1 2071
##sequence-region AAAA02048838.1 1 2218
##sequence-region AAAA02048660.1 1 2247
##sequence-region AAAA02042059.1 1 4212
##sequence-region AAAA02046003.1 1 2806
##sequence-region AAAA02046630.1 1 2651
##sequence-region AAAA02049310.1 1 2145
##sequence-region AAAA02043520.1 1 3539
##sequence-region CH398909.1 1 8632
##sequence-region AAAA02044438.1 1 3234
##sequence-region CH399782.1 1 4536
##sequence-region AAAA02048831.1 1 2219
##sequence-region AAAA02041688.1 1 4435
##sequence-region AAAA02041553.1 1 4511
##sequence-region AAAA02039219.1 1 6646
##sequence-region AAAA02042682.1 1 3898
##sequence-region AAAA02046886.1 1 2592
##sequence-region AAAA02044271.1 1 3287
##sequence-region AAAA02049003.1 1 2195
##sequence-region AAAA02039306.1 1 6484
##sequence-region CH398728.1 1 10674
##sequence-region AAAA02040559.1 1 5157
##sequence-region CH399895.1 1 4230
##sequence-region CH400273.1 1 3350
##sequence-region CH398602.1 1 12680
##sequence-region AAAA02036643.1 1 15831
##sequence-region CH399974.1 1 4045
##sequence-region AAAA02050068.1 1 2023
##sequence-region CH401066.1 1 2121
##sequence-region AAAA02039261.1 1 6585
##sequence-region CH399298.1 1 6230
##sequence-region AAAA02040757.1 1 5010
##sequence-region AAAA02046934.1 1 2582
##sequence-region AAAA02049187.1 1 2166
##sequence-region AAAA02050021.1 1 2031
##sequence-region CH400153.1 1 3599
##sequence-region AAAA02036519.1 1 17180
##sequence-region AAAA02047823.1 1 2396
##sequence-region CH399477.1 1 5451
##sequence-region AAAA02038998.1 1 6964
##sequence-region CH400983.1 1 2209
##sequence-region AAAA02040635.1 1 5109
##sequence-region AAAA02045542.1 1 2917
##sequence-region AAAA02044299.1 1 3278
##sequence-region AAAA02050085.1 1 2021
##sequence-region CH398654.1 1 11714
##sequence-region AAAA02044954.1 1 3081
##sequence-region AAAA02048510.1 1 2271
##sequence-region CH400471.1 1 2968
##sequence-region 12 1 23049917
##sequence-region AAAA02039596.1 1 6089
##sequence-region AAAA02046652.1 1 2645
##sequence-region AAAA02040165.1 1 5474
##sequence-region AAAA02050007.1 1 2033
##sequence-region AAAA02042432.1 1 4041
##sequence-region AAAA02048675.1 1 2244
##sequence-region CH398368.1 1 21402
##sequence-region AAAA02039439.1 1 6299
##sequence-region AAAA02048773.1 1 2227
##sequence-region AAAA02043187.1 1 3683
##sequence-region AAAA02037029.1 1 12767
##sequence-region AAAA02044340.1 1 3266
##sequence-region CH400861.1 1 2358
##sequence-region CH400763.1 1 2498
##sequence-region AAAA02038465.1 1 7818
##sequence-region AAAA02049282.1 1 2150
##sequence-region AAAA02045714.1 1 2876
##sequence-region AAAA02038453.1 1 7834
##sequence-region AAAA02044759.1 1 3132
##sequence-region CH399653.1 1 4888
##sequence-region AAAA02036813.1 1 14533
##sequence-region AAAA02036693.1 1 15370
##sequence-region CH400942.1 1 2262
##sequence-region AAAA02047518.1 1 2451
##sequence-region AAAA02043756.1 1 3446
##sequence-region AAAA02039134.1 1 6778
##sequence-region AAAA02047146.1 1 2533
##sequence-region CH398842.1 1 9354
##sequence-region AAAA02044153.1 1 3324
##sequence-region AAAA02047292.1 1 2498
##sequence-region AAAA02049585.1 1 2104
##sequence-region AAAA02036919.1 1 13694
##sequence-region AAAA02049489.1 1 2119
##sequence-region AAAA02040883.1 1 4930
##sequence-region CH398401.1 1 20112
##sequence-region CH398903.1 1 8690
##sequence-region CH399656.1 1 4882
##sequence-region AAAA02040776.1 1 5001
##sequence-region AAAA02047670.1 1 2425
##sequence-region AAAA02040386.1 1 5284
##sequence-region AAAA02037043.1 1 12633
##sequence-region CH398279.1 1 35004
##sequence-region AAAA02046349.1 1 2721
##sequence-region AAAA02043021.1 1 3745
##sequence-region AAAA02044255.1 1 3291
##sequence-region AAAA02041986.1 1 4264
##sequence-region AAAA02049745.1 1 2074
##sequence-region CH398986.1 1 8020
##sequence-region AAAA02039892.1 1 5753
##sequence-region AAAA02046007.1 1 2805
##sequence-region AAAA02041090.1 1 4790
##sequence-region AAAA02042646.1 1 3927
##sequence-region AAAA02042725.1 1 3872
##sequence-region AAAA02043005.1 1 3751
##sequence-region CH399353.1 1 5958
##sequence-region AAAA02049496.1 1 2117
##sequence-region CH398612.1 1 12475
##sequence-region AAAA02040692.1 1 5060
##sequence-region AAAA02040826.1 1 4961
##sequence-region CH398463.1 1 17175
##sequence-region AAAA02045718.1 1 2874
##sequence-region CH400317.1 1 3276
##sequence-region AAAA02041127.1 1 4764
##sequence-region CH400386.1 1 3123
##sequence-region CH400577.1 1 2805
##sequence-region AAAA02038495.1 1 7774
##sequence-region AAAA02048064.1 1 2353
##sequence-region AAAA02040855.1 1 4944
##sequence-region AAAA02044596.1 1 3183
##sequence-region AAAA02042085.1 1 4195
##sequence-region AAAA02049390.1 1 2135
##sequence-region AAAA02045602.1 1 2903
##sequence-region AAAA02045241.1 1 3006
##sequence-region AAAA02045673.1 1 2886
##sequence-region AAAA02049913.1 1 2048
##sequence-region AAAA02046095.1 1 2788
##sequence-region CH398297.1 1 30113
##sequence-region AAAA02044383.1 1 3257
##sequence-region AAAA02043229.1 1 3665
##sequence-region AAAA02046928.1 1 2583
##sequence-region CH400328.1 1 3261
##sequence-region CH400060.1 1 3806
##sequence-region CH399280.1 1 6307
##sequence-region AAAA02045876.1 1 2832
##sequence-region CH398774.1 1 10175
##sequence-region CH400164.1 1 3581
##sequence-region AAAA02039956.1 1 5675
##sequence-region AAAA02043342.1 1 3610
##sequence-region AAAA02045012.1 1 3065
##sequence-region AAAA02047947.1 1 2372
##sequence-region AAAA02040726.1 1 5037
##sequence-region CH401104.1 1 2069
##sequence-region AAAA02044156.1 1 3322
##sequence-region CH398405.1 1 19852
##sequence-region CH398304.1 1 28506
##sequence-region CH400549.1 1 2837
##sequence-region AAAA02036174.1 1 21049
##sequence-region CH398277.1 1 35239
##sequence-region AAAA02045716.1 1 2875
##sequence-region AAAA02045525.1 1 2921
##sequence-region AAAA02040364.1 1 5301
##sequence-region AAAA02041810.1 1 4362
##sequence-region CH400284.1 1 3336
##sequence-region AAAA02045138.1 1 3035
##sequence-region CH399015.1 1 7811
##sequence-region AAAA02041826.1 1 4357
##sequence-region CH399628.1 1 4942
##sequence-region CH399578.1 1 5102
##sequence-region CH399200.1 1 6806
##sequence-region AAAA02047428.1 1 2465
##sequence-region AAAA02047853.1 1 2391
##sequence-region AAAA02037304.1 1 11359
##sequence-region CH398621.1 1 12125
##sequence-region CH400519.1 1 2883
##sequence-region AAAA02038964.1 1 6989
##sequence-region AAAA02048539.1 1 2265
##sequence-region CH400971.1 1 2224
##sequence-region CH400994.1 1 2198
##sequence-region CH398801.1 1 9806
##sequence-region AAAA02039343.1 1 6420
##sequence-region AAAA02048292.1 1 2309
##sequence-region AAAA02036719.1 1 15259
##sequence-region CH401100.1 1 2074
##sequence-region AAAA02036011.1 1 24010
##sequence-region AAAA02044578.1 1 3188
##sequence-region AAAA02046587.1 1 2663
##sequence-region AAAA02042606.1 1 3946
##sequence-region AAAA02048181.1 1 2328
##sequence-region AAAA02041525.1 1 4534
##sequence-region AAAA02039048.1 1 6890
##sequence-region AAAA02048811.1 1 2221
##sequence-region AAAA02049919.1 1 2047
##sequence-region AAAA02041447.1 1 4589
##sequence-region AAAA02050058.1 1 2024
##sequence-region AAAA02040962.1 1 4886
##sequence-region AAAA02045502.1 1 2930
##sequence-region AAAA02043794.1 1 3432
##sequence-region CH400272.1 1 3352
##sequence-region CH400316.1 1 3277
##sequence-region CH399963.1 1 4074
##sequence-region AAAA02043178.1 1 3689
##sequence-region AAAA02049001.1 1 2195
##sequence-region CH399625.1 1 4947
##sequence-region AAAA02047040.1 1 2557
##sequence-region CH401159.1 1 2004
##sequence-region AAAA02043975.1 1 3384
##sequence-region AAAA02047142.1 1 2534
##sequence-region AAAA02038404.1 1 7910
##sequence-region AAAA02037356.1 1 11169
##sequence-region AAAA02039575.1 1 6122
##sequence-region CH398776.1 1 10109
##sequence-region AAAA02046553.1 1 2673
##sequence-region CH400632.1 1 2716
##sequence-region CH400052.1 1 3818
##sequence-region AAAA02041190.1 1 4728
##sequence-region CH400195.1 1 3514
##sequence-region AAAA02040375.1 1 5293
##sequence-region CH400820.1 1 2409
##sequence-region AAAA02048565.1 1 2261
##sequence-region CH398938.1 1 8390
##sequence-region CH398337.1 1 24778
##sequence-region AAAA02040207.1 1 5438
##sequence-region AAAA02045010.1 1 3066
##sequence-region AAAA02048100.1 1 2346
##sequence-region AAAA02038507.1 1 7736
##sequence-region CH401073.1 1 2113
##sequence-region CH400601.1 1 2776
##sequence-region CH399785.1 1 4512
##sequence-region AAAA02039085.1 1 6841
##sequence-region AAAA02045779.1 1 2858
##sequence-region CH398712.1 1 10855
##sequence-region CH400846.1 1 2371
##sequence-region CH399122.1 1 7181
##sequence-region AAAA02046521.1 1 2680
##sequence-region CH400533.1 1 2859
##sequence-region AAAA02046325.1 1 2730
##sequence-region AAAA02042116.1 1 4178
##sequence-region AAAA02045888.1 1 2830
##sequence-region AAAA02044182.1 1 3315
##sequence-region AAAA02045805.1 1 2850
##sequence-region AAAA02036314.1 1 19739
##sequence-region AAAA02043746.1 1 3450
##sequence-region CH399420.1 1 5683
##sequence-region AAAA02046182.1 1 2766
##sequence-region CH400025.1 1 3876
##sequence-region AAAA02045029.1 1 3061
##sequence-region AAAA02048523.1 1 2268
##sequence-region AAAA02044325.1 1 3270
##sequence-region CH400746.1 1 2537
##sequence-region AAAA02048048.1 1 2357
##sequence-region AAAA02044362.1 1 3261
##sequence-region CH398340.1 1 24443
##sequence-region AAAA02040756.1 1 5011
##sequence-region CH399645.1 1 4905
##sequence-region AAAA02044031.1 1 3358
##sequence-region CH399253.1 1 6497
##sequence-region AAAA02044989.1 1 3072
##sequence-region AAAA02043554.1 1 3528
##sequence-region AAAA02038925.1 1 7067
##sequence-region AAAA02036486.1 1 17493
##sequence-region CH399516.1 1 5307
##sequence-region CH399473.1 1 5463
##sequence-region AAAA02039862.1 1 5775
##sequence-region AAAA02046770.1 1 2619
##sequence-region AAAA02048711.1 1 2237
##sequence-region AAAA02044413.1 1 3245
##sequence-region CH399599.1 1 5040
##sequence-region CH400645.1 1 2707
##sequence-region AAAA02044245.1 1 3293
##sequence-region AAAA02040080.1 1 5545
##sequence-region CH399435.1 1 5600
##sequence-region AAAA02047375.1 1 2477
##sequence-region CH399228.1 1 6674
##sequence-region AAAA02043548.1 1 3530
##sequence-region AAAA02043911.1 1 3400
##sequence-region AAAA02046536.1 1 2676
##sequence-region AAAA02042605.1 1 3947
##sequence-region AAAA02042420.1 1 4047
##sequence-region AAAA02046034.1 1 2802
##sequence-region AAAA02049642.1 1 2096
##sequence-region AAAA02039921.1 1 5722
##sequence-region AAAA02045295.1 1 2993
##sequence-region AAAA02039097.1 1 6832
##sequence-region CH400922.1 1 2282
##sequence-region CH398465.1 1 17119
##sequence-region AAAA02043375.1 1 3599
##sequence-region AAAA02040526.1 1 5178
##sequence-region AAAA02038558.1 1 7670
##sequence-region AAAA02042623.1 1 3939
##sequence-region CH401058.1 1 2128
##sequence-region AAAA02042355.1 1 4077
##sequence-region AAAA02050146.1 1 2012
##sequence-region AAAA02037025.1 1 12832
##sequence-region CH399180.1 1 6905
##sequence-region AAAA02042243.1 1 4132
##sequence-region AAAA02036623.1 1 16120
##sequence-region AAAA02042712.1 1 3879
##sequence-region AAAA02044215.1 1 3302
##sequence-region AAAA02045842.1 1 2843
##sequence-region AAAA02045732.1 1 2870
##sequence-region AAAA02044950.1 1 3082
##sequence-region AAAA02039681.1 1 5981
##sequence-region CH398937.1 1 8391
##sequence-region AAAA02042461.1 1 4023
##sequence-region AAAA02042794.1 1 3845
##sequence-region AAAA02041134.1 1 4759
##sequence-region CH398353.1 1 22871
##sequence-region AAAA02036789.1 1 14814
##sequence-region AAAA02049415.1 1 2131
##sequence-region CH399509.1 1 5330
##sequence-region CH399957.1 1 4090
##sequence-region AAAA02044336.1 1 3267
##sequence-region AAAA02042817.1 1 3837
##sequence-region CH400529.1 1 2863
##sequence-region AAAA02043064.1 1 3725
##sequence-region CH399777.1 1 4549
##sequence-region AAAA02044856.1 1 3106
##sequence-region CH398255.1 1 44746
##sequence-region CH399224.1 1 6703
##sequence-region AAAA02048772.1 1 2227
##sequence-region AAAA02039599.1 1 6085
##sequence-region AAAA02044244.1 1 3294
##sequence-region AAAA02042497.1 1 4005
##sequence-region AAAA02048543.1 1 2264
##sequence-region AAAA02048991.1 1 2196
##sequence-region AAAA02047092.1 1 2544
##sequence-region AAAA02039616.1 1 6069
##sequence-region CH399474.1 1 5462
##sequence-region CH400895.1 1 2312
##sequence-region AAAA02047695.1 1 2420
##sequence-region AAAA02043180.1 1 3687
##sequence-region AAAA02046867.1 1 2598
##sequence-region CH398319.1 1 26367
##sequence-region AAAA02045001.1 1 3068
##sequence-region AAAA02047456.1 1 2460
##sequence-region CH400413.1 1 3087
##sequence-region CH400270.1 1 3355
##sequence-region AAAA02044549.1 1 3196
##sequence-region AAAA02049668.1 1 2089
##sequence-region AAAA02042607.1 1 3946
##sequence-region AAAA02040161.1 1 5481
##sequence-region CH398515.1 1 15236
##sequence-region AAAA02046188.1 1 2765
##sequence-region AAAA02041326.1 1 4651
##sequence-region AAAA02048717.1 1 2237
##sequence-region AAAA02049222.1 1 2160
##sequence-region AAAA02049061.1 1 2185
##sequence-region AAAA02043595.1 1 3511
##sequence-region CH399089.1 1 7347
##sequence-region CH399259.1 1 6432
##sequence-region CH400604.1 1 2769
##sequence-region AAAA02038709.1 1 7372
##sequence-region AAAA02045344.1 1 2978
##sequence-region CH400023.1 1 3885
##sequence-region CH399029.1 1 7707
##sequence-region AAAA02044732.1 1 3141
##sequence-region AAAA02037419.1 1 10874
##sequence-region AAAA02041581.1 1 4495
##sequence-region AAAA02047904.1 1 2382
##sequence-region AAAA02043055.1 1 3728
##sequence-region CH400394.1 1 3116
##sequence-region CH400998.1 1 2191
##sequence-region AAAA02036173.1 1 21076
##sequence-region AAAA02043417.1 1 3585
##sequence-region AAAA02046931.1 1 2582
##sequence-region CH398406.1 1 19846
##sequence-region AAAA02036587.1 1 16689
##sequence-region AAAA02049105.1 1 2178
##sequence-region CH401032.1 1 2156
##sequence-region AAAA02047745.1 1 2411
##sequence-region AAAA02039754.1 1 5903
##sequence-region CH400943.1 1 2261
##sequence-region CH398804.1 1 9795
##sequence-region CH398725.1 1 10710
##sequence-region CH398618.1 1 12227
##sequence-region CH398445.1 1 17845
##sequence-region CH398373.1 1 21252
##sequence-region CH398931.1 1 8428
##sequence-region CH398287.1 1 32215
##sequence-region AAAA02037938.1 1 9117
##sequence-region AAAA02038774.1 1 7269
##sequence-region AAAA02039962.1 1 5669
##sequence-region AAAA02041831.1 1 4354
##sequence-region AAAA02040506.1 1 5198
##sequence-region AAAA02045734.1 1 2870
##sequence-region CH399178.1 1 6910
##sequence-region AAAA02039191.1 1 6688
##sequence-region AAAA02042446.1 1 4032
##sequence-region AAAA02041972.1 1 4267
##sequence-region AAAA02048947.1 1 2202
##sequence-region CH399156.1 1 7020
##sequence-region AAAA02047594.1 1 2437
##sequence-region AAAA02045975.1 1 2813
##sequence-region AAAA02039857.1 1 5781
##sequence-region AAAA02040261.1 1 5379
##sequence-region AAAA02039646.1 1 6024
##sequence-region AAAA02049964.1 1 2040
##sequence-region AAAA02046527.1 1 2678
##sequence-region AAAA02049579.1 1 2105
##sequence-region AAAA02042124.1 1 4173
##sequence-region CH400617.1 1 2746
##sequence-region AAAA02036900.1 1 13794
##sequence-region AAAA02045739.1 1 2869
##sequence-region CH399141.1 1 7102
##sequence-region AAAA02046584.1 1 2665
##sequence-region CH398492.1 1 15986
##sequence-region AAAA02045129.1 1 3038
##sequence-region AAAA02045980.1 1 2812
##sequence-region AAAA02040005.1 1 5623
##sequence-region CH400489.1 1 2934
##sequence-region AAAA02036209.1 1 20778
##sequence-region AAAA02042531.1 1 3989
##sequence-region CH398739.1 1 10511
##sequence-region AAAA02043123.1 1 3708
##sequence-region AAAA02036430.1 1 18331
##sequence-region AAAA02035993.1 1 24832
##sequence-region CH398635.1 1 11917
##sequence-region CH398759.1 1 10294
##sequence-region AAAA02035659.1 1 39467
##sequence-region AAAA02041643.1 1 4454
##sequence-region AAAA02038067.1 1 8698
##sequence-region CH398262.1 1 42686
##sequence-region CH399047.1 1 7600
##sequence-region CH400904.1 1 2306
##sequence-region CH398438.1 1 18185
##sequence-region AAAA02045011.1 1 3065
##sequence-region AAAA02043639.1 1 3498
##sequence-region CH398310.1 1 27483
##sequence-region AAAA02043668.1 1 3485
##sequence-region AAAA02047138.1 1 2535
##sequence-region AAAA02047458.1 1 2459
##sequence-region CH398479.1 1 16793
##sequence-region AAAA02045998.1 1 2808
##sequence-region CH398906.1 1 8656
##sequence-region CH398596.1 1 12856
##sequence-region AAAA02047137.1 1 2535
##sequence-region CH398466.1 1 17086
##sequence-region CH399411.1 1 5729
##sequence-region AAAA02042463.1 1 4023
##sequence-region AAAA02044023.1 1 3362
##sequence-region CH400595.1 1 2784
##sequence-region CH401088.1 1 2093
##sequence-region CH399266.1 1 6390
##sequence-region CH398779.1 1 10088
##sequence-region AAAA02048290.1 1 2309
##sequence-region AAAA02042611.1 1 3944
##sequence-region CH399949.1 1 4119
##sequence-region AAAA02035838.1 1 29822
##sequence-region CH398543.1 1 14363
##sequence-region AAAA02042052.1 1 4216
##sequence-region CH399094.1 1 7311
##sequence-region CH400104.1 1 3709
##sequence-region CH400976.1 1 2220
##sequence-region CH400908.1 1 2303
##sequence-region AAAA02044539.1 1 3198
##sequence-region CH398907.1 1 8645
##sequence-region CH398917.1 1 8589
##sequence-region AAAA02038794.1 1 7233
##sequence-region AAAA02044071.1 1 3347
##sequence-region CH400260.1 1 3389
##sequence-region AAAA02046422.1 1 2705
##sequence-region CH398518.1 1 15204
##sequence-region AAAA02044172.1 1 3317
##sequence-region AAAA02036432.1 1 18229
##sequence-region AAAA02049861.1 1 2056
##sequence-region AAAA02046552.1 1 2673
##sequence-region CH398498.1 1 15755
##sequence-region CH399170.1 1 6956
##sequence-region AAAA02043318.1 1 3620
##sequence-region AAAA02045224.1 1 3014
##sequence-region CH398929.1 1 8434
##sequence-region AAAA02043071.1 1 3723
##sequence-region AAAA02038753.1 1 7301
##sequence-region AAAA02036378.1 1 18939
##sequence-region AAAA02042874.1 1 3808
##sequence-region AAAA02041510.1 1 4545
##sequence-region AAAA02049876.1 1 2053
##sequence-region CH399688.1 1 4771
##sequence-region CH401080.1 1 2102
##sequence-region AAAA02040521.1 1 5183
##sequence-region AAAA02043274.1 1 3646
##sequence-region AAAA02038649.1 1 7501
##sequence-region CH398442.1 1 17969
##sequence-region AAAA02039510.1 1 6200
##sequence-region AAAA02041198.1 1 4721
##sequence-region AAAA02040508.1 1 5195
##sequence-region AAAA02044769.1 1 3130
##sequence-region CH398787.1 1 10021
##sequence-region CH399945.1 1 4122
##sequence-region CH400046.1 1 3835
##sequence-region AAAA02046753.1 1 2624
##sequence-region AAAA02043543.1 1 3531
##sequence-region AAAA02045931.1 1 2821
##sequence-region AAAA02049400.1 1 2134
##sequence-region CH400045.1 1 3842
##sequence-region CH399489.1 1 5385
##sequence-region AAAA02036891.1 1 13886
##sequence-region AAAA02038318.1 1 8145
##sequence-region AAAA02041694.1 1 4428
##sequence-region AAAA02035900.1 1 26433
##sequence-region CH398321.1 1 26224
##sequence-region AAAA02038883.1 1 7122
##sequence-region CH400837.1 1 2387
##sequence-region CH399146.1 1 7071
##sequence-region CH399538.1 1 5232
##sequence-region CH398268.1 1 38358
##sequence-region CH399164.1 1 6968
##sequence-region AAAA02035882.1 1 27269
##sequence-region AAAA02048969.1 1 2199
##sequence-region AAAA02040658.1 1 5096
##sequence-region AAAA02044891.1 1 3098
##sequence-region AAAA02041704.1 1 4417
##sequence-region AAAA02044603.1 1 3181
##sequence-region AAAA02044796.1 1 3120
##sequence-region AAAA02047052.1 1 2553
##sequence-region CH398411.1 1 19476
##sequence-region AAAA02047931.1 1 2376
##sequence-region AAAA02047363.1 1 2479
##sequence-region CH398300.1 1 29186
##sequence-region AAAA02041005.1 1 4854
##sequence-region AAAA02046885.1 1 2592
##sequence-region AAAA02038246.1 1 8293
##sequence-region AAAA02049835.1 1 2060
##sequence-region AAAA02049257.1 1 2154
##sequence-region AAAA02049040.1 1 2188
##sequence-region CH398833.1 1 9448
##sequence-region AAAA02043363.1 1 3605
##sequence-region AAAA02041785.1 1 4377
##sequence-region AAAA02038766.1 1 7276
##sequence-region AAAA02043196.1 1 3678
##sequence-region AAAA02049307.1 1 2145
##sequence-region AAAA02045762.1 1 2862
##sequence-region AAAA02048794.1 1 2224
##sequence-region CH400569.1 1 2815
##sequence-region AAAA02039107.1 1 6817
##sequence-region AAAA02041625.1 1 4467
##sequence-region CH398710.1 1 10927
##sequence-region AAAA02039321.1 1 6462
##sequence-region AAAA02042788.1 1 3847
##sequence-region CH400268.1 1 3364
##sequence-region AAAA02036300.1 1 19954
##sequence-region CH398388.1 1 20441
##sequence-region AAAA02037077.1 1 12468
##sequence-region CH399726.1 1 4675
##sequence-region CH400435.1 1 3040
##sequence-region CH400970.1 1 2227
##sequence-region AAAA02050220.1 1 2001
##sequence-region CH399416.1 1 5701
##sequence-region CH399255.1 1 6464
##sequence-region AAAA02040229.1 1 5413
##sequence-region AAAA02049994.1 1 2035
##sequence-region AAAA02040326.1 1 5333
##sequence-region AAAA02038955.1 1 6994
##sequence-region AAAA02043352.1 1 3607
##sequence-region CH398266.1 1 39924
##sequence-region CH398627.1 1 12051
##sequence-region CH400880.1 1 2327
##sequence-region AAAA02049053.1 1 2186
##sequence-region AAAA02042961.1 1 3773
##sequence-region CH399998.1 1 3974
##sequence-region AAAA02045358.1 1 2973
##sequence-region CH398506.1 1 15491
##sequence-region CH400188.1 1 3527
##sequence-region AAAA02043991.1 1 3374
##sequence-region CH398925.1 1 8505
##sequence-region AAAA02038880.1 1 7132
##sequence-region AAAA02043308.1 1 3625
##sequence-region AAAA02048958.1 1 2201
##sequence-region CH399557.1 1 5164
##sequence-region AAAA02049125.1 1 2174
##sequence-region CH398945.1 1 8348
##sequence-region AAAA02046105.1 1 2785
##sequence-region AAAA02039579.1 1 6116
##sequence-region CH400957.1 1 2243
##sequence-region AAAA02044663.1 1 3164
##sequence-region AAAA02043059.1 1 3727
##sequence-region AAAA02036513.1 1 17261
##sequence-region CH401075.1 1 2110
##sequence-region AAAA02045758.1 1 2863
##sequence-region CH398580.1 1 13272
##sequence-region AAAA02042141.1 1 4164
##sequence-region CH400769.1 1 2491
##sequence-region AAAA02041363.1 1 4634
##sequence-region AAAA02041966.1 1 4269
##sequence-region AAAA02047361.1 1 2479
##sequence-region AAAA02044399.1 1 3250
##sequence-region CH398587.1 1 13116
##sequence-region AAAA02048165.1 1 2332
##sequence-region AAAA02037511.1 1 10498
##sequence-region CH398470.1 1 16988
##sequence-region CH399127.1 1 7173
##sequence-region AAAA02039188.1 1 6690
##sequence-region AAAA02043248.1 1 3658
##sequence-region AAAA02043217.1 1 3672
##sequence-region CH400444.1 1 3030
##sequence-region AAAA02046913.1 1 2587
##sequence-region AAAA02040788.1 1 4995
##sequence-region CH400275.1 1 3349
##sequence-region AAAA02046651.1 1 2646
##sequence-region AAAA02044434.1 1 3236
##sequence-region CH399173.1 1 6940
##sequence-region AAAA02043985.1 1 3378
##sequence-region AAAA02048651.1 1 2248
##sequence-region CH398522.1 1 15114
##sequence-region AAAA02041430.1 1 4600
##sequence-region AAAA02047662.1 1 2426
##sequence-region CH398257.1 1 43721
##sequence-region AAAA02042246.1 1 4131
##sequence-region AAAA02037989.1 1 8923
##sequence-region CH398354.1 1 22867
##sequence-region AAAA02037329.1 1 11262
##sequence-region AAAA02048784.1 1 2226
##sequence-region AAAA02043776.1 1 3440
##sequence-region AAAA02042561.1 1 3973
##sequence-region CH398538.1 1 14686
##sequence-region AAAA02048110.1 1 2345
##sequence-region AAAA02047276.1 1 2502
##sequence-region AAAA02038443.1 1 7852
##sequence-region AAAA02038259.1 1 8272
##sequence-region CH398243.1 1 59457
##sequence-region CH398315.1 1 26696
##sequence-region AAAA02041638.1 1 4456
##sequence-region CH398900.1 1 8701
##sequence-region AAAA02047538.1 1 2446
##sequence-region AAAA02044717.1 1 3144
##sequence-region CH398510.1 1 15332
##sequence-region CH400562.1 1 2823
##sequence-region CH400973.1 1 2221
##sequence-region CH400129.1 1 3656
##sequence-region CH399135.1 1 7138
##sequence-region AAAA02037513.1 1 10496
##sequence-region CH399431.1 1 5620
##sequence-region CH398363.1 1 21980
##sequence-region AAAA02047225.1 1 2516
##sequence-region AAAA02043733.1 1 3455
##sequence-region CH399261.1 1 6419
##sequence-region AAAA02042468.1 1 4018
##sequence-region CH398559.1 1 13870
##sequence-region CH398281.1 1 33792
##sequence-region AAAA02043132.1 1 3703
##sequence-region AAAA02045947.1 1 2819
##sequence-region AAAA02047169.1 1 2529
##sequence-region CH399506.1 1 5335
##sequence-region AAAA02037954.1 1 9058
##sequence-region CH399906.1 1 4186
##sequence-region CH399058.1 1 7569
##sequence-region AAAA02048383.1 1 2293
##sequence-region AAAA02047654.1 1 2427
##sequence-region AAAA02039708.1 1 5950
##sequence-region CH398284.1 1 32948
##sequence-region CH398671.1 1 11459
##sequence-region CH400474.1 1 2963
##sequence-region AAAA02039342.1 1 6423
##sequence-region AAAA02039725.1 1 5931
##sequence-region AAAA02049233.1 1 2157
##sequence-region AAAA02044729.1 1 3142
##sequence-region AAAA02040205.1 1 5440
##sequence-region CH400384.1 1 3130
##sequence-region AAAA02047409.1 1 2469
##sequence-region AAAA02045606.1 1 2902
##sequence-region AAAA02045034.1 1 3060
##sequence-region AAAA02044289.1 1 3282
##sequence-region AAAA02042910.1 1 3798
##sequence-region AAAA02043317.1 1 3621
##sequence-region CH398740.1 1 10498
##sequence-region AAAA02039046.1 1 6894
##sequence-region CH400286.1 1 3333
##sequence-region AAAA02040385.1 1 5285
##sequence-region AAAA02042934.1 1 3786
##sequence-region CH398783.1 1 10060
##sequence-region AAAA02048009.1 1 2362
##sequence-region AAAA02049276.1 1 2151
##sequence-region AAAA02049540.1 1 2110
##sequence-region AAAA02042869.1 1 3809
##sequence-region CH398829.1 1 9500
##sequence-region AAAA02040200.1 1 5445
##sequence-region AAAA02037512.1 1 10497
##sequence-region AAAA02044835.1 1 3111
##sequence-region AAAA02040056.1 1 5565
##sequence-region CH399395.1 1 5766
##sequence-region CH399338.1 1 6035
##sequence-region CH399279.1 1 6309
##sequence-region AAAA02044310.1 1 3275
##sequence-region AAAA02044739.1 1 3138
##sequence-region AAAA02041323.1 1 4652
##sequence-region AAAA02040338.1 1 5326
##sequence-region AAAA02039168.1 1 6727
##sequence-region CH400264.1 1 3368
##sequence-region CH400218.1 1 3473
##sequence-region AAAA02048720.1 1 2236
##sequence-region AAAA02046592.1 1 2661
##sequence-region AAAA02045305.1 1 2990
##sequence-region AAAA02039818.1 1 5832
##sequence-region CH399126.1 1 7173
##sequence-region AAAA02039727.1 1 5931
##sequence-region AAAA02045627.1 1 2900
##sequence-region CH398295.1 1 30844
##sequence-region AAAA02037473.1 1 10638
##sequence-region CH398802.1 1 9796
##sequence-region CH398520.1 1 15164
##sequence-region AAAA02047356.1 1 2481
##sequence-region AAAA02044403.1 1 3248
##sequence-region AAAA02042125.1 1 4173
##sequence-region AAAA02049024.1 1 2190
##sequence-region AAAA02039489.1 1 6231
##sequence-region CH399128.1 1 7150
##sequence-region AAAA02045436.1 1 2949
##sequence-region AAAA02042834.1 1 3829
##sequence-region AAAA02041303.1 1 4663
##sequence-region AAAA02039381.1 1 6363
##sequence-region CH398956.1 1 8280
##sequence-region CH399225.1 1 6702
##sequence-region AAAA02039933.1 1 5714
##sequence-region AAAA02040296.1 1 5355
##sequence-region AAAA02040319.1 1 5338
##sequence-region CH400285.1 1 3333
##sequence-region AAAA02048158.1 1 2334
##sequence-region CH398620.1 1 12132
##sequence-region CH399236.1 1 6618
##sequence-region 6 1 32913967
##sequence-region AAAA02045825.1 1 2846
##sequence-region CH399952.1 1 4112
##sequence-region AAAA02036980.1 1 13252
##sequence-region AAAA02042868.1 1 3810
##sequence-region AAAA02045526.1 1 2921
##sequence-region AAAA02044414.1 1 3244
##sequence-region CH399622.1 1 4955
##sequence-region CH400618.1 1 2744
##sequence-region AAAA02045204.1 1 3018
##sequence-region AAAA02039435.1 1 6301
##sequence-region CH401067.1 1 2121
##sequence-region AAAA02045592.1 1 2905
##sequence-region AAAA02042499.1 1 4004
##sequence-region AAAA02049957.1 1 2041
##sequence-region AAAA02045162.1 1 3029
##sequence-region AAAA02042231.1 1 4137
##sequence-region AAAA02047865.1 1 2389
##sequence-region AAAA02048857.1 1 2215
##sequence-region AAAA02046324.1 1 2730
##sequence-region AAAA02045536.1 1 2919
##sequence-region CH400804.1 1 2432
##sequence-region AAAA02044681.1 1 3156
##sequence-region AAAA02050167.1 1 2008
##sequence-region AAAA02038853.1 1 7167
##sequence-region AAAA02049600.1 1 2101
##sequence-region AAAA02041978.1 1 4265
##sequence-region AAAA02043978.1 1 3381
##sequence-region AAAA02045707.1 1 2878
##sequence-region AAAA02047002.1 1 2564
##sequence-region CH398341.1 1 24001
##sequence-region AAAA02042083.1 1 4195
##sequence-region CH400457.1 1 3003
##sequence-region AAAA02039253.1 1 6593
##sequence-region AAAA02043460.1 1 3565
##sequence-region AAAA02047215.1 1 2518
##sequence-region 8 1 30396518
CH398455.1	dbSNP	SNV	116	116	.	+	.	ID=1;Variant_seq=A;Dbxref=dbSNP_129:rs18159634;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398455.1	dbSNP	SNV	496	496	.	+	.	ID=2;Variant_seq=A;Dbxref=dbSNP_129:rs20776885;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398455.1	dbSNP	SNV	1241	1241	.	+	.	ID=3;Variant_seq=T;Dbxref=dbSNP_129:rs18159697;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398455.1	dbSNP	SNV	2543	2543	.	+	.	ID=4;Variant_seq=A;Dbxref=dbSNP_129:rs19116736;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398455.1	dbSNP	SNV	2620	2620	.	+	.	ID=5;Variant_seq=A;Dbxref=dbSNP_129:rs53378700;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398455.1	dbSNP	SNV	2938	2938	.	+	.	ID=6;Variant_seq=T;Dbxref=dbSNP_129:rs53355987;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398455.1	dbSNP	SNV	3287	3287	.	+	.	ID=7;Variant_seq=C;Dbxref=dbSNP_129:rs21468164;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398455.1	dbSNP	SNV	3571	3571	.	+	.	ID=8;Variant_seq=A;Dbxref=dbSNP_129:rs21468184;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398455.1	dbSNP	SNV	3932	3932	.	+	.	ID=9;Variant_seq=C;Dbxref=dbSNP_129:rs54101086;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398455.1	dbSNP	SNV	3933	3933	.	+	.	ID=10;Variant_seq=A;Dbxref=dbSNP_129:rs53931564;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398455.1	dbSNP	SNV	3941	3941	.	+	.	ID=11;Variant_seq=G;Dbxref=dbSNP_129:rs53283745;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398455.1	dbSNP	SNV	3971	3971	.	+	.	ID=12;Variant_seq=C;Dbxref=dbSNP_129:rs53021149;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398455.1	dbSNP	SNV	3974	3974	.	+	.	ID=13;Variant_seq=T;Dbxref=dbSNP_129:rs53777938;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398455.1	dbSNP	SNV	3978	3978	.	+	.	ID=14;Variant_seq=T;Dbxref=dbSNP_129:rs53670767;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398455.1	dbSNP	SNV	3979	3979	.	+	.	ID=15;Variant_seq=A;Dbxref=dbSNP_129:rs54380693;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398455.1	dbSNP	SNV	3982	3982	.	+	.	ID=16;Variant_seq=T;Dbxref=dbSNP_129:rs53395016;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398455.1	dbSNP	SNV	4046	4046	.	+	.	ID=17;Variant_seq=A;Dbxref=dbSNP_129:rs21468264;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398455.1	dbSNP	SNV	7816	7816	.	+	.	ID=18;Variant_seq=A;Dbxref=dbSNP_129:rs21655710;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398455.1	dbSNP	SNV	11751	11751	.	+	.	ID=19;Variant_seq=T;Dbxref=dbSNP_129:rs18159616;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398455.1	dbSNP	SNV	12392	12392	.	+	.	ID=20;Variant_seq=A;Dbxref=dbSNP_129:rs20776855;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398455.1	dbSNP	SNV	14036	14036	.	+	.	ID=21;Variant_seq=A;Dbxref=dbSNP_129:rs18520009;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398455.1	dbSNP	SNV	14078	14078	.	+	.	ID=22;Variant_seq=A;Dbxref=dbSNP_129:rs19872543;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398455.1	dbSNP	SNV	14147	14147	.	+	.	ID=23;Variant_seq=A;Dbxref=dbSNP_129:rs18187926;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398455.1	dbSNP	SNV	14192	14192	.	+	.	ID=24;Variant_seq=T;Dbxref=dbSNP_129:rs20776605;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398455.1	dbSNP	SNV	14579	14579	.	+	.	ID=25;Variant_seq=T;Dbxref=dbSNP_129:rs18159913;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398455.1	dbSNP	SNV	14661	14661	.	+	.	ID=26;Variant_seq=T;Dbxref=dbSNP_129:rs18159922;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398455.1	dbSNP	SNV	15552	15552	.	+	.	ID=27;Variant_seq=C;Dbxref=dbSNP_129:rs20776475;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398455.1	dbSNP	SNV	17194	17194	.	+	.	ID=28;Variant_seq=A;Dbxref=dbSNP_129:rs21507222;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399874.1	dbSNP	SNV	2090	2090	.	+	.	ID=29;Variant_seq=A;Dbxref=dbSNP_129:rs53849397;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400166.1	dbSNP	SNV	99	99	.	+	.	ID=30;Variant_seq=G;Dbxref=dbSNP_129:rs20966209;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400166.1	dbSNP	SNV	440	440	.	+	.	ID=31;Variant_seq=C;Dbxref=dbSNP_129:rs20966289;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400166.1	dbSNP	SNV	1489	1489	.	+	.	ID=32;Variant_seq=A;Dbxref=dbSNP_129:rs20966569;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400166.1	dbSNP	SNV	1552	1552	.	+	.	ID=33;Variant_seq=A;Dbxref=dbSNP_129:rs20966579;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400166.1	dbSNP	SNV	1765	1765	.	+	.	ID=34;Variant_seq=G;Dbxref=dbSNP_129:rs20966639;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400166.1	dbSNP	SNV	2164	2164	.	+	.	ID=35;Variant_seq=A;Dbxref=dbSNP_129:rs20966699;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400166.1	dbSNP	SNV	2524	2524	.	+	.	ID=36;Variant_seq=A;Dbxref=dbSNP_129:rs18484888;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400166.1	dbSNP	SNV	2555	2555	.	+	.	ID=37;Variant_seq=T;Dbxref=dbSNP_129:rs18484915;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400166.1	dbSNP	SNV	2690	2690	.	+	.	ID=38;Variant_seq=C;Dbxref=dbSNP_129:rs20966829;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400166.1	dbSNP	SNV	3437	3437	.	+	.	ID=39;Variant_seq=A;Dbxref=dbSNP_129:rs20966949;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037089.1	dbSNP	SNV	9387	9387	.	+	.	ID=40;Variant_seq=A;Dbxref=dbSNP_129:rs21515472;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037089.1	dbSNP	SNV	9602	9602	.	+	.	ID=41;Variant_seq=T;Dbxref=dbSNP_129:rs20582067;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400062.1	dbSNP	SNV	873	873	.	+	.	ID=42;Variant_seq=C;Dbxref=dbSNP_129:rs19131730;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400062.1	dbSNP	SNV	1880	1880	.	+	.	ID=43;Variant_seq=C;Dbxref=dbSNP_129:rs53446681;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045985.1	dbSNP	SNV	1660	1660	.	+	.	ID=44;Variant_seq=A;Dbxref=dbSNP_129:rs20299930;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399755.1	dbSNP	SNV	4415	4415	.	+	.	ID=45;Variant_seq=T;Dbxref=dbSNP_129:rs53126575;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399743.1	dbSNP	SNV	886	886	.	+	.	ID=46;Variant_seq=G;Dbxref=dbSNP_129:rs19066856;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399743.1	dbSNP	SNV	1625	1625	.	+	.	ID=47;Variant_seq=A;Dbxref=dbSNP_129:rs18017789;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049309.1	dbSNP	SNV	329	329	.	+	.	ID=48;Variant_seq=C;Dbxref=dbSNP_129:rs54169917;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049309.1	dbSNP	SNV	476	476	.	+	.	ID=49;Variant_seq=A;Dbxref=dbSNP_129:rs53911551;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047261.1	dbSNP	SNV	308	308	.	+	.	ID=50;Variant_seq=A;Dbxref=dbSNP_129:rs52973491;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400874.1	dbSNP	SNV	653	653	.	+	.	ID=51;Variant_seq=G;Dbxref=dbSNP_129:rs17948420;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400874.1	dbSNP	SNV	2162	2162	.	+	.	ID=52;Variant_seq=T;Dbxref=dbSNP_129:rs19134927;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400874.1	dbSNP	SNV	2173	2173	.	+	.	ID=53;Variant_seq=G;Dbxref=dbSNP_129:rs19134917;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400874.1	dbSNP	SNV	2177	2177	.	+	.	ID=54;Variant_seq=A;Dbxref=dbSNP_129:rs19134907;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041857.1	dbSNP	SNV	228	228	.	+	.	ID=55;Variant_seq=C,G;Dbxref=dbSNP_129:rs53069173;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041857.1	dbSNP	SNV	273	273	.	+	.	ID=56;Variant_seq=G;Dbxref=dbSNP_129:rs54044494;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041857.1	dbSNP	SNV	2946	2946	.	+	.	ID=57;Variant_seq=A;Dbxref=dbSNP_129:rs53135454;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041857.1	dbSNP	SNV	2948	2948	.	+	.	ID=58;Variant_seq=G;Dbxref=dbSNP_129:rs53772295;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041857.1	dbSNP	SNV	2971	2971	.	+	.	ID=59;Variant_seq=C;Dbxref=dbSNP_129:rs54065206;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041857.1	dbSNP	SNV	2975	2975	.	+	.	ID=60;Variant_seq=A;Dbxref=dbSNP_129:rs53294790;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041857.1	dbSNP	SNV	2980	2980	.	+	.	ID=61;Variant_seq=A;Dbxref=dbSNP_129:rs54339687;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041857.1	dbSNP	SNV	3149	3149	.	+	.	ID=62;Variant_seq=G;Dbxref=dbSNP_129:rs54103976;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041857.1	dbSNP	SNV	3974	3974	.	+	.	ID=63;Variant_seq=A;Dbxref=dbSNP_129:rs53865664;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043871.1	dbSNP	SNV	1069	1069	.	+	.	ID=64;Variant_seq=A;Dbxref=dbSNP_129:rs19980201;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043871.1	dbSNP	SNV	1102	1102	.	+	.	ID=65;Variant_seq=G;Dbxref=dbSNP_129:rs19980221;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049486.1	dbSNP	SNV	70	70	.	+	.	ID=66;Variant_seq=A;Dbxref=dbSNP_129:rs19104010;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049486.1	dbSNP	SNV	96	96	.	+	.	ID=67;Variant_seq=T;Dbxref=dbSNP_129:rs19427637;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049486.1	dbSNP	SNV	364	364	.	+	.	ID=68;Variant_seq=T,C,G;Dbxref=dbSNP_129:rs17891232;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048260.1	dbSNP	SNV	992	992	.	+	.	ID=69;Variant_seq=A;Dbxref=dbSNP_129:rs54051044;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048260.1	dbSNP	SNV	1001	1001	.	+	.	ID=70;Variant_seq=T;Dbxref=dbSNP_129:rs54199515;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048260.1	dbSNP	SNV	1002	1002	.	+	.	ID=71;Variant_seq=T;Dbxref=dbSNP_129:rs54047247;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048260.1	dbSNP	SNV	1004	1004	.	+	.	ID=72;Variant_seq=T;Dbxref=dbSNP_129:rs53067029;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048260.1	dbSNP	SNV	1007	1007	.	+	.	ID=73;Variant_seq=C;Dbxref=dbSNP_129:rs53416455;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048260.1	dbSNP	deletion	1016	1017	.	+	.	ID=74;Variant_seq=-;Dbxref=dbSNP_129:rs53103490;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=TT
AAAA02048260.1	dbSNP	deletion	1020	1020	.	+	.	ID=75;Variant_seq=-;Dbxref=dbSNP_129:rs53959917;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048260.1	dbSNP	deletion	1022	1028	.	+	.	ID=76;Variant_seq=-;Dbxref=dbSNP_129:rs53763970;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=GGCACTT
AAAA02041150.1	dbSNP	SNV	161	161	.	+	.	ID=77;Variant_seq=A;Dbxref=dbSNP_129:rs19923562;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041150.1	dbSNP	SNV	571	571	.	+	.	ID=78;Variant_seq=G;Dbxref=dbSNP_129:rs19923622;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041150.1	dbSNP	SNV	580	580	.	+	.	ID=79;Variant_seq=A;Dbxref=dbSNP_129:rs19923632;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041150.1	dbSNP	SNV	583	583	.	+	.	ID=80;Variant_seq=T;Dbxref=dbSNP_129:rs19923642;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041150.1	dbSNP	SNV	584	584	.	+	.	ID=81;Variant_seq=A;Dbxref=dbSNP_129:rs19923652;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041150.1	dbSNP	SNV	592	592	.	+	.	ID=82;Variant_seq=G;Dbxref=dbSNP_129:rs19923662;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041150.1	dbSNP	SNV	615	615	.	+	.	ID=83;Variant_seq=T;Dbxref=dbSNP_129:rs19923672;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041150.1	dbSNP	SNV	616	616	.	+	.	ID=84;Variant_seq=A;Dbxref=dbSNP_129:rs19923682;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041150.1	dbSNP	SNV	617	617	.	+	.	ID=85;Variant_seq=G;Dbxref=dbSNP_129:rs19923692;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041150.1	dbSNP	SNV	622	622	.	+	.	ID=86;Variant_seq=G;Dbxref=dbSNP_129:rs19923702;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041150.1	dbSNP	SNV	625	625	.	+	.	ID=87;Variant_seq=G;Dbxref=dbSNP_129:rs19923712;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041150.1	dbSNP	SNV	628	628	.	+	.	ID=88;Variant_seq=G;Dbxref=dbSNP_129:rs19923722;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041150.1	dbSNP	SNV	629	629	.	+	.	ID=89;Variant_seq=C;Dbxref=dbSNP_129:rs19923732;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041150.1	dbSNP	SNV	647	647	.	+	.	ID=90;Variant_seq=G;Dbxref=dbSNP_129:rs19923772;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041150.1	dbSNP	SNV	688	688	.	+	.	ID=91;Variant_seq=T;Dbxref=dbSNP_129:rs19923792;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041150.1	dbSNP	SNV	732	732	.	+	.	ID=92;Variant_seq=G;Dbxref=dbSNP_129:rs19923812;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041150.1	dbSNP	SNV	733	733	.	+	.	ID=93;Variant_seq=C;Dbxref=dbSNP_129:rs19923822;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041150.1	dbSNP	SNV	1509	1509	.	+	.	ID=94;Variant_seq=G;Dbxref=dbSNP_129:rs19924012;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041150.1	dbSNP	SNV	1514	1514	.	+	.	ID=95;Variant_seq=G;Dbxref=dbSNP_129:rs19924022;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041150.1	dbSNP	SNV	1516	1516	.	+	.	ID=96;Variant_seq=A;Dbxref=dbSNP_129:rs19924032;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041150.1	dbSNP	SNV	1608	1608	.	+	.	ID=97;Variant_seq=T;Dbxref=dbSNP_129:rs19924122;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041150.1	dbSNP	SNV	1614	1614	.	+	.	ID=98;Variant_seq=T;Dbxref=dbSNP_129:rs19924132;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041150.1	dbSNP	SNV	1615	1615	.	+	.	ID=99;Variant_seq=T;Dbxref=dbSNP_129:rs19924142;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041150.1	dbSNP	SNV	1984	1984	.	+	.	ID=100;Variant_seq=T;Dbxref=dbSNP_129:rs19646306;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041150.1	dbSNP	SNV	2873	2873	.	+	.	ID=101;Variant_seq=G;Dbxref=dbSNP_129:rs19924272;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041150.1	dbSNP	SNV	2944	2944	.	+	.	ID=102;Variant_seq=A;Dbxref=dbSNP_129:rs19924302;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041150.1	dbSNP	SNV	2953	2953	.	+	.	ID=103;Variant_seq=A;Dbxref=dbSNP_129:rs19924322;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041150.1	dbSNP	SNV	3295	3295	.	+	.	ID=104;Variant_seq=T;Dbxref=dbSNP_129:rs21121219;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039951.1	dbSNP	SNV	5226	5226	.	+	.	ID=105;Variant_seq=C;Dbxref=dbSNP_129:rs53049614;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039951.1	dbSNP	SNV	5274	5274	.	+	.	ID=106;Variant_seq=T;Dbxref=dbSNP_129:rs54256770;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398431.1	dbSNP	SNV	274	274	.	+	.	ID=107;Variant_seq=T;Dbxref=dbSNP_129:rs53869714;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398431.1	dbSNP	SNV	313	313	.	+	.	ID=108;Variant_seq=T;Dbxref=dbSNP_129:rs53644630;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398431.1	dbSNP	SNV	3071	3071	.	+	.	ID=109;Variant_seq=T;Dbxref=dbSNP_129:rs20019697;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398431.1	dbSNP	SNV	13872	13872	.	+	.	ID=110;Variant_seq=T;Dbxref=dbSNP_129:rs53295162;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043361.1	dbSNP	SNV	52	52	.	+	.	ID=111;Variant_seq=C;Dbxref=dbSNP_129:rs19088927;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043361.1	dbSNP	SNV	172	172	.	+	.	ID=112;Variant_seq=A;Dbxref=dbSNP_129:rs19088967;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043361.1	dbSNP	SNV	179	179	.	+	.	ID=113;Variant_seq=C;Dbxref=dbSNP_129:rs19088977;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043361.1	dbSNP	SNV	211	211	.	+	.	ID=114;Variant_seq=T;Dbxref=dbSNP_129:rs19088987;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043361.1	dbSNP	SNV	223	223	.	+	.	ID=115;Variant_seq=T;Dbxref=dbSNP_129:rs19088997;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043361.1	dbSNP	SNV	243	243	.	+	.	ID=116;Variant_seq=T;Dbxref=dbSNP_129:rs19089007;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043361.1	dbSNP	SNV	257	257	.	+	.	ID=117;Variant_seq=T;Dbxref=dbSNP_129:rs19089027;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043361.1	dbSNP	SNV	268	268	.	+	.	ID=118;Variant_seq=G;Dbxref=dbSNP_129:rs19089037;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043361.1	dbSNP	SNV	280	280	.	+	.	ID=119;Variant_seq=T;Dbxref=dbSNP_129:rs19089047;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043361.1	dbSNP	SNV	358	358	.	+	.	ID=120;Variant_seq=G;Dbxref=dbSNP_129:rs19089107;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043361.1	dbSNP	SNV	1073	1073	.	+	.	ID=121;Variant_seq=T;Dbxref=dbSNP_129:rs19089197;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043361.1	dbSNP	SNV	1076	1076	.	+	.	ID=122;Variant_seq=A;Dbxref=dbSNP_129:rs19089207;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043361.1	dbSNP	SNV	1097	1097	.	+	.	ID=123;Variant_seq=G;Dbxref=dbSNP_129:rs19089230;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400640.1	dbSNP	SNV	346	346	.	+	.	ID=124;Variant_seq=G;Dbxref=dbSNP_129:rs19119220;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400640.1	dbSNP	SNV	583	583	.	+	.	ID=125;Variant_seq=T;Dbxref=dbSNP_129:rs19119250;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400640.1	dbSNP	SNV	1940	1940	.	+	.	ID=126;Variant_seq=A;Dbxref=dbSNP_129:rs53646771;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400640.1	dbSNP	SNV	1942	1942	.	+	.	ID=127;Variant_seq=G;Dbxref=dbSNP_129:rs53796421;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042055.1	dbSNP	SNV	377	377	.	+	.	ID=128;Variant_seq=T;Dbxref=dbSNP_129:rs53980028;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042055.1	dbSNP	SNV	453	453	.	+	.	ID=129;Variant_seq=G;Dbxref=dbSNP_129:rs54092615;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042055.1	dbSNP	SNV	1282	1282	.	+	.	ID=130;Variant_seq=G;Dbxref=dbSNP_129:rs18004087;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042055.1	dbSNP	SNV	1286	1286	.	+	.	ID=131;Variant_seq=T;Dbxref=dbSNP_129:rs18004078;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042055.1	dbSNP	SNV	1294	1294	.	+	.	ID=132;Variant_seq=A;Dbxref=dbSNP_129:rs18004042;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042055.1	dbSNP	SNV	1295	1295	.	+	.	ID=133;Variant_seq=T;Dbxref=dbSNP_129:rs18004033;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042055.1	dbSNP	SNV	1296	1296	.	+	.	ID=134;Variant_seq=G;Dbxref=dbSNP_129:rs18004024;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042055.1	dbSNP	SNV	1299	1299	.	+	.	ID=135;Variant_seq=A;Dbxref=dbSNP_129:rs18004015;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042055.1	dbSNP	SNV	1304	1304	.	+	.	ID=136;Variant_seq=C;Dbxref=dbSNP_129:rs18004006;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042055.1	dbSNP	SNV	1307	1307	.	+	.	ID=137;Variant_seq=C;Dbxref=dbSNP_129:rs18003997;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042055.1	dbSNP	SNV	1308	1308	.	+	.	ID=138;Variant_seq=C;Dbxref=dbSNP_129:rs18003988;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042055.1	dbSNP	SNV	1310	1310	.	+	.	ID=139;Variant_seq=T;Dbxref=dbSNP_129:rs18003979;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042055.1	dbSNP	SNV	1463	1463	.	+	.	ID=140;Variant_seq=G;Dbxref=dbSNP_129:rs18003483;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042055.1	dbSNP	SNV	1464	1464	.	+	.	ID=141;Variant_seq=G;Dbxref=dbSNP_129:rs18003474;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042055.1	dbSNP	SNV	1467	1467	.	+	.	ID=142;Variant_seq=C;Dbxref=dbSNP_129:rs18003465;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042055.1	dbSNP	SNV	1475	1475	.	+	.	ID=143;Variant_seq=G;Dbxref=dbSNP_129:rs18003447;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042055.1	dbSNP	SNV	2536	2536	.	+	.	ID=144;Variant_seq=C;Dbxref=dbSNP_129:rs54409608;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042055.1	dbSNP	SNV	2589	2589	.	+	.	ID=145;Variant_seq=C;Dbxref=dbSNP_129:rs19657116;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042055.1	dbSNP	SNV	2591	2591	.	+	.	ID=146;Variant_seq=T;Dbxref=dbSNP_129:rs53561834;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044679.1	dbSNP	SNV	2780	2780	.	+	.	ID=147;Variant_seq=A;Dbxref=dbSNP_129:rs21697763;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044679.1	dbSNP	SNV	2902	2902	.	+	.	ID=148;Variant_seq=G;Dbxref=dbSNP_129:rs21697781;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042462.1	dbSNP	SNV	727	727	.	+	.	ID=149;Variant_seq=C;Dbxref=dbSNP_129:rs53574985;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042462.1	dbSNP	SNV	738	738	.	+	.	ID=150;Variant_seq=T;Dbxref=dbSNP_129:rs53504678;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042462.1	dbSNP	SNV	2532	2532	.	+	.	ID=151;Variant_seq=A;Dbxref=dbSNP_129:rs18914162;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399154.1	dbSNP	SNV	3196	3196	.	+	.	ID=152;Variant_seq=A;Dbxref=dbSNP_129:rs53670830;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399154.1	dbSNP	SNV	3199	3199	.	+	.	ID=153;Variant_seq=T;Dbxref=dbSNP_129:rs54228533;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399154.1	dbSNP	SNV	3202	3202	.	+	.	ID=154;Variant_seq=T;Dbxref=dbSNP_129:rs53000770;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399154.1	dbSNP	SNV	3208	3208	.	+	.	ID=155;Variant_seq=T;Dbxref=dbSNP_129:rs54186791;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399154.1	dbSNP	SNV	3217	3217	.	+	.	ID=156;Variant_seq=T;Dbxref=dbSNP_129:rs53386556;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399154.1	dbSNP	SNV	3219	3219	.	+	.	ID=157;Variant_seq=G;Dbxref=dbSNP_129:rs52953283;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399154.1	dbSNP	SNV	3223	3223	.	+	.	ID=158;Variant_seq=T;Dbxref=dbSNP_129:rs53738273;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399154.1	dbSNP	SNV	3232	3232	.	+	.	ID=159;Variant_seq=C;Dbxref=dbSNP_129:rs53726767;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399154.1	dbSNP	SNV	3233	3233	.	+	.	ID=160;Variant_seq=G;Dbxref=dbSNP_129:rs53144492;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399154.1	dbSNP	SNV	3234	3234	.	+	.	ID=161;Variant_seq=T;Dbxref=dbSNP_129:rs53295614;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399154.1	dbSNP	SNV	3239	3239	.	+	.	ID=162;Variant_seq=C;Dbxref=dbSNP_129:rs53864668;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399154.1	dbSNP	SNV	3240	3240	.	+	.	ID=163;Variant_seq=A;Dbxref=dbSNP_129:rs54076933;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399154.1	dbSNP	SNV	3247	3247	.	+	.	ID=164;Variant_seq=A;Dbxref=dbSNP_129:rs54239254;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399154.1	dbSNP	SNV	4915	4915	.	+	.	ID=165;Variant_seq=T;Dbxref=dbSNP_129:rs52969484;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399154.1	dbSNP	SNV	4918	4918	.	+	.	ID=166;Variant_seq=G;Dbxref=dbSNP_129:rs54280939;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399154.1	dbSNP	SNV	4921	4921	.	+	.	ID=167;Variant_seq=G;Dbxref=dbSNP_129:rs53955145;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399154.1	dbSNP	SNV	4930	4930	.	+	.	ID=168;Variant_seq=G;Dbxref=dbSNP_129:rs53261941;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399154.1	dbSNP	SNV	4936	4936	.	+	.	ID=169;Variant_seq=A;Dbxref=dbSNP_129:rs52913478;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399154.1	dbSNP	SNV	4940	4940	.	+	.	ID=170;Variant_seq=G;Dbxref=dbSNP_129:rs53132243;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399154.1	dbSNP	SNV	4946	4946	.	+	.	ID=171;Variant_seq=T;Dbxref=dbSNP_129:rs53414534;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399154.1	dbSNP	SNV	4951	4951	.	+	.	ID=172;Variant_seq=T;Dbxref=dbSNP_129:rs53577522;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399154.1	dbSNP	SNV	4963	4963	.	+	.	ID=173;Variant_seq=C;Dbxref=dbSNP_129:rs53472545;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399154.1	dbSNP	SNV	4969	4969	.	+	.	ID=174;Variant_seq=A;Dbxref=dbSNP_129:rs52899204;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399154.1	dbSNP	SNV	4975	4975	.	+	.	ID=175;Variant_seq=C;Dbxref=dbSNP_129:rs53079389;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399154.1	dbSNP	SNV	4978	4978	.	+	.	ID=176;Variant_seq=T;Dbxref=dbSNP_129:rs53557237;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399154.1	dbSNP	SNV	4982	4982	.	+	.	ID=177;Variant_seq=A;Dbxref=dbSNP_129:rs53306357;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399154.1	dbSNP	SNV	4988	4988	.	+	.	ID=178;Variant_seq=A;Dbxref=dbSNP_129:rs53582504;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399154.1	dbSNP	SNV	4990	4990	.	+	.	ID=179;Variant_seq=C;Dbxref=dbSNP_129:rs53807547;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399154.1	dbSNP	SNV	4996	4996	.	+	.	ID=180;Variant_seq=C;Dbxref=dbSNP_129:rs54020088;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399154.1	dbSNP	SNV	5001	5001	.	+	.	ID=181;Variant_seq=G;Dbxref=dbSNP_129:rs53048334;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399154.1	dbSNP	SNV	5011	5011	.	+	.	ID=182;Variant_seq=C;Dbxref=dbSNP_129:rs53069412;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399154.1	dbSNP	SNV	5017	5017	.	+	.	ID=183;Variant_seq=A;Dbxref=dbSNP_129:rs53839321;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399154.1	dbSNP	SNV	5470	5470	.	+	.	ID=184;Variant_seq=C;Dbxref=dbSNP_129:rs53332978;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046237.1	dbSNP	SNV	184	184	.	+	.	ID=185;Variant_seq=T;Dbxref=dbSNP_129:rs53203515;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046237.1	dbSNP	SNV	186	186	.	+	.	ID=186;Variant_seq=A;Dbxref=dbSNP_129:rs53259183;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046237.1	dbSNP	SNV	2149	2149	.	+	.	ID=187;Variant_seq=A;Dbxref=dbSNP_129:rs53205317;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046237.1	dbSNP	SNV	2456	2456	.	+	.	ID=188;Variant_seq=A;Dbxref=dbSNP_129:rs53337594;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046237.1	dbSNP	SNV	2462	2462	.	+	.	ID=189;Variant_seq=G;Dbxref=dbSNP_129:rs53779156;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046237.1	dbSNP	SNV	2464	2464	.	+	.	ID=190;Variant_seq=C;Dbxref=dbSNP_129:rs53047842;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046237.1	dbSNP	SNV	2470	2470	.	+	.	ID=191;Variant_seq=C;Dbxref=dbSNP_129:rs53469773;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046237.1	dbSNP	SNV	2474	2474	.	+	.	ID=192;Variant_seq=A;Dbxref=dbSNP_129:rs53955840;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046237.1	dbSNP	deletion	2557	2557	.	+	.	ID=193;Variant_seq=-;Dbxref=dbSNP_129:rs52860733;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046237.1	dbSNP	SNV	2685	2685	.	+	.	ID=194;Variant_seq=C;Dbxref=dbSNP_129:rs20715036;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398696.1	dbSNP	SNV	1888	1888	.	+	.	ID=195;Variant_seq=A;Dbxref=dbSNP_129:rs19742014;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398696.1	dbSNP	SNV	5985	5985	.	+	.	ID=196;Variant_seq=A;Dbxref=dbSNP_129:rs18812414;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398696.1	dbSNP	SNV	7806	7806	.	+	.	ID=197;Variant_seq=A;Dbxref=dbSNP_129:rs53031927;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398696.1	dbSNP	SNV	7806	7806	.	+	.	ID=198;Variant_seq=A;Dbxref=dbSNP_129:rs53257034;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398963.1	dbSNP	SNV	159	159	.	+	.	ID=199;Variant_seq=T;Dbxref=dbSNP_129:rs20948306;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398963.1	dbSNP	SNV	1425	1425	.	+	.	ID=200;Variant_seq=A;Dbxref=dbSNP_129:rs21435703;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398963.1	dbSNP	SNV	3822	3822	.	+	.	ID=201;Variant_seq=T;Dbxref=dbSNP_129:rs21623878;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045004.1	dbSNP	SNV	1330	1330	.	+	.	ID=202;Variant_seq=T;Dbxref=dbSNP_129:rs20957753;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045004.1	dbSNP	SNV	2126	2126	.	+	.	ID=203;Variant_seq=A;Dbxref=dbSNP_129:rs18952918;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	1703	1703	.	+	.	ID=204;Variant_seq=T;Dbxref=dbSNP_129:rs20938797;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398496.1	dbSNP	SNV	5964	5964	.	+	.	ID=205;Variant_seq=T;Dbxref=dbSNP_129:rs53742690;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398496.1	dbSNP	insertion	9021	9021	.	+	.	ID=206;Variant_seq=T;Dbxref=dbSNP_129:rs53580271;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398496.1	dbSNP	SNV	13997	13997	.	+	.	ID=207;Variant_seq=C;Dbxref=dbSNP_129:rs54014226;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398496.1	dbSNP	SNV	14018	14018	.	+	.	ID=208;Variant_seq=A;Dbxref=dbSNP_129:rs54142770;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398496.1	dbSNP	SNV	14019	14019	.	+	.	ID=209;Variant_seq=C;Dbxref=dbSNP_129:rs53950486;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398496.1	dbSNP	SNV	14025	14025	.	+	.	ID=210;Variant_seq=A;Dbxref=dbSNP_129:rs54012777;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398496.1	dbSNP	SNV	14028	14028	.	+	.	ID=211;Variant_seq=C;Dbxref=dbSNP_129:rs21410823;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398496.1	dbSNP	SNV	14044	14044	.	+	.	ID=212;Variant_seq=A;Dbxref=dbSNP_129:rs53686353;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	14061	14061	.	+	.	ID=213;Variant_seq=A;Dbxref=dbSNP_129:rs53771585;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398496.1	dbSNP	SNV	14073	14073	.	+	.	ID=214;Variant_seq=G;Dbxref=dbSNP_129:rs54342705;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398496.1	dbSNP	SNV	14090	14090	.	+	.	ID=215;Variant_seq=A;Dbxref=dbSNP_129:rs54062743;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398496.1	dbSNP	SNV	14091	14091	.	+	.	ID=216;Variant_seq=C;Dbxref=dbSNP_129:rs53620451;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	14093	14093	.	+	.	ID=217;Variant_seq=C;Dbxref=dbSNP_129:rs52925239;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398496.1	dbSNP	SNV	14102	14102	.	+	.	ID=218;Variant_seq=C;Dbxref=dbSNP_129:rs54083543;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398496.1	dbSNP	SNV	14108	14108	.	+	.	ID=219;Variant_seq=G;Dbxref=dbSNP_129:rs53927576;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398496.1	dbSNP	SNV	14111	14111	.	+	.	ID=220;Variant_seq=T;Dbxref=dbSNP_129:rs52928973;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398496.1	dbSNP	SNV	14114	14114	.	+	.	ID=221;Variant_seq=A;Dbxref=dbSNP_129:rs21410833;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	14124	14124	.	+	.	ID=222;Variant_seq=A;Dbxref=dbSNP_129:rs52980114;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	14127	14127	.	+	.	ID=223;Variant_seq=C;Dbxref=dbSNP_129:rs53315196;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398496.1	dbSNP	SNV	14132	14132	.	+	.	ID=224;Variant_seq=T;Dbxref=dbSNP_129:rs53844354;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	14135	14135	.	+	.	ID=225;Variant_seq=A;Dbxref=dbSNP_129:rs54344647;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	14145	14145	.	+	.	ID=226;Variant_seq=T;Dbxref=dbSNP_129:rs53262313;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398496.1	dbSNP	SNV	14149	14149	.	+	.	ID=227;Variant_seq=G;Dbxref=dbSNP_129:rs53377265;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398496.1	dbSNP	SNV	14154	14154	.	+	.	ID=228;Variant_seq=T;Dbxref=dbSNP_129:rs53337962;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	14155	14155	.	+	.	ID=229;Variant_seq=T;Dbxref=dbSNP_129:rs54133308;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398496.1	dbSNP	SNV	14167	14167	.	+	.	ID=230;Variant_seq=G;Dbxref=dbSNP_129:rs53299659;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398496.1	dbSNP	insertion	14172	14172	.	+	.	ID=231;Variant_seq=T;Dbxref=dbSNP_129:rs53756854;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398496.1	dbSNP	SNV	14176	14176	.	+	.	ID=232;Variant_seq=T;Dbxref=dbSNP_129:rs54379738;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398496.1	dbSNP	SNV	14181	14181	.	+	.	ID=233;Variant_seq=T;Dbxref=dbSNP_129:rs54236775;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398496.1	dbSNP	SNV	14182	14182	.	+	.	ID=234;Variant_seq=G;Dbxref=dbSNP_129:rs53064782;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398496.1	dbSNP	deletion	14190	14190	.	+	.	ID=235;Variant_seq=-;Dbxref=dbSNP_129:rs53524791;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398496.1	dbSNP	SNV	14198	14198	.	+	.	ID=236;Variant_seq=G;Dbxref=dbSNP_129:rs54192321;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398496.1	dbSNP	SNV	14205	14205	.	+	.	ID=237;Variant_seq=C;Dbxref=dbSNP_129:rs53877999;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398496.1	dbSNP	SNV	14208	14208	.	+	.	ID=238;Variant_seq=G;Dbxref=dbSNP_129:rs21410843;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398496.1	dbSNP	SNV	14211	14211	.	+	.	ID=239;Variant_seq=T;Dbxref=dbSNP_129:rs53225024;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398496.1	dbSNP	SNV	14220	14220	.	+	.	ID=240;Variant_seq=T;Dbxref=dbSNP_129:rs53558962;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398496.1	dbSNP	SNV	14228	14228	.	+	.	ID=241;Variant_seq=C;Dbxref=dbSNP_129:rs53810020;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398496.1	dbSNP	deletion	14232	14232	.	+	.	ID=242;Variant_seq=-;Dbxref=dbSNP_129:rs54310988;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	deletion	14236	14238	.	+	.	ID=243;Variant_seq=-;Dbxref=dbSNP_129:rs54144880;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=CGG
CH398496.1	dbSNP	SNV	14244	14244	.	+	.	ID=244;Variant_seq=T;Dbxref=dbSNP_129:rs53294405;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398496.1	dbSNP	SNV	14249	14249	.	+	.	ID=245;Variant_seq=T;Dbxref=dbSNP_129:rs53893140;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398496.1	dbSNP	SNV	14255	14255	.	+	.	ID=246;Variant_seq=T;Dbxref=dbSNP_129:rs53771469;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398496.1	dbSNP	SNV	14262	14262	.	+	.	ID=247;Variant_seq=A;Dbxref=dbSNP_129:rs54365513;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398496.1	dbSNP	insertion	14262	14262	.	+	.	ID=248;Variant_seq=A;Dbxref=dbSNP_129:rs53307371;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398496.1	dbSNP	SNV	14264	14264	.	+	.	ID=249;Variant_seq=T;Dbxref=dbSNP_129:rs21410853;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	insertion	14265	14265	.	+	.	ID=250;Variant_seq=A;Dbxref=dbSNP_129:rs53803270;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398496.1	dbSNP	SNV	14274	14274	.	+	.	ID=251;Variant_seq=A;Dbxref=dbSNP_129:rs53953371;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	14279	14279	.	+	.	ID=252;Variant_seq=T;Dbxref=dbSNP_129:rs53060706;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398496.1	dbSNP	SNV	14281	14281	.	+	.	ID=253;Variant_seq=C;Dbxref=dbSNP_129:rs21410863;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398496.1	dbSNP	SNV	14282	14282	.	+	.	ID=254;Variant_seq=A;Dbxref=dbSNP_129:rs52992732;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398496.1	dbSNP	SNV	14289	14289	.	+	.	ID=255;Variant_seq=A;Dbxref=dbSNP_129:rs53231839;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	14292	14292	.	+	.	ID=256;Variant_seq=A;Dbxref=dbSNP_129:rs54100639;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	14305	14305	.	+	.	ID=257;Variant_seq=A;Dbxref=dbSNP_129:rs53549505;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	14323	14323	.	+	.	ID=258;Variant_seq=C;Dbxref=dbSNP_129:rs53990188;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398496.1	dbSNP	SNV	14324	14324	.	+	.	ID=259;Variant_seq=G;Dbxref=dbSNP_129:rs53391798;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398496.1	dbSNP	SNV	14332	14332	.	+	.	ID=260;Variant_seq=C;Dbxref=dbSNP_129:rs54026149;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	14972	14972	.	+	.	ID=261;Variant_seq=T;Dbxref=dbSNP_129:rs21410983;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398496.1	dbSNP	SNV	14993	14993	.	+	.	ID=262;Variant_seq=C;Dbxref=dbSNP_129:rs21410993;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398496.1	dbSNP	SNV	15281	15281	.	+	.	ID=263;Variant_seq=G;Dbxref=dbSNP_129:rs21411003;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398496.1	dbSNP	SNV	15442	15442	.	+	.	ID=264;Variant_seq=A;Dbxref=dbSNP_129:rs21411013;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	15511	15511	.	+	.	ID=265;Variant_seq=C;Dbxref=dbSNP_129:rs21411043;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398496.1	dbSNP	SNV	15527	15527	.	+	.	ID=266;Variant_seq=A;Dbxref=dbSNP_129:rs21411053;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	15541	15541	.	+	.	ID=267;Variant_seq=T;Dbxref=dbSNP_129:rs21411063;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	15577	15577	.	+	.	ID=268;Variant_seq=A;Dbxref=dbSNP_129:rs21411083;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	15587	15587	.	+	.	ID=269;Variant_seq=T;Dbxref=dbSNP_129:rs21197492;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398496.1	dbSNP	SNV	15597	15597	.	+	.	ID=270;Variant_seq=A;Dbxref=dbSNP_129:rs21411093;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398496.1	dbSNP	SNV	15624	15624	.	+	.	ID=271;Variant_seq=A;Dbxref=dbSNP_129:rs21411113;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398496.1	dbSNP	SNV	15687	15687	.	+	.	ID=272;Variant_seq=G;Dbxref=dbSNP_129:rs21411143;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398496.1	dbSNP	SNV	15698	15698	.	+	.	ID=273;Variant_seq=G;Dbxref=dbSNP_129:rs21411153;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398496.1	dbSNP	SNV	15712	15712	.	+	.	ID=274;Variant_seq=T;Dbxref=dbSNP_129:rs21411163;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046367.1	dbSNP	SNV	69	69	.	+	.	ID=275;Variant_seq=G;Dbxref=dbSNP_129:rs18276126;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046367.1	dbSNP	SNV	105	105	.	+	.	ID=276;Variant_seq=C;Dbxref=dbSNP_129:rs18276135;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046367.1	dbSNP	SNV	133	133	.	+	.	ID=277;Variant_seq=T;Dbxref=dbSNP_129:rs18276144;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046367.1	dbSNP	SNV	134	134	.	+	.	ID=278;Variant_seq=C;Dbxref=dbSNP_129:rs18276153;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046367.1	dbSNP	SNV	324	324	.	+	.	ID=279;Variant_seq=T;Dbxref=dbSNP_129:rs18276171;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH401044.1	dbSNP	SNV	756	756	.	+	.	ID=280;Variant_seq=T;Dbxref=dbSNP_129:rs20848733;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398480.1	dbSNP	SNV	12772	12772	.	+	.	ID=281;Variant_seq=T;Dbxref=dbSNP_129:rs53562902;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398480.1	dbSNP	SNV	12774	12774	.	+	.	ID=282;Variant_seq=G;Dbxref=dbSNP_129:rs54138508;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398480.1	dbSNP	SNV	12775	12775	.	+	.	ID=283;Variant_seq=T;Dbxref=dbSNP_129:rs53623578;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398480.1	dbSNP	SNV	12784	12784	.	+	.	ID=284;Variant_seq=G;Dbxref=dbSNP_129:rs53666074;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398480.1	dbSNP	SNV	12789	12789	.	+	.	ID=285;Variant_seq=C;Dbxref=dbSNP_129:rs53654406;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398480.1	dbSNP	SNV	12793	12793	.	+	.	ID=286;Variant_seq=G;Dbxref=dbSNP_129:rs54400735;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398480.1	dbSNP	SNV	12806	12806	.	+	.	ID=287;Variant_seq=A;Dbxref=dbSNP_129:rs53194844;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398480.1	dbSNP	SNV	12807	12807	.	+	.	ID=288;Variant_seq=A;Dbxref=dbSNP_129:rs54173807;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398480.1	dbSNP	SNV	12808	12808	.	+	.	ID=289;Variant_seq=C;Dbxref=dbSNP_129:rs53804961;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398480.1	dbSNP	SNV	12822	12822	.	+	.	ID=290;Variant_seq=C;Dbxref=dbSNP_129:rs54087966;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398480.1	dbSNP	SNV	12827	12827	.	+	.	ID=291;Variant_seq=G;Dbxref=dbSNP_129:rs53011402;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398480.1	dbSNP	SNV	12836	12836	.	+	.	ID=292;Variant_seq=A;Dbxref=dbSNP_129:rs53292718;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040763.1	dbSNP	SNV	702	702	.	+	.	ID=293;Variant_seq=T;Dbxref=dbSNP_129:rs21453029;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040763.1	dbSNP	SNV	713	713	.	+	.	ID=294;Variant_seq=T;Dbxref=dbSNP_129:rs21453040;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399119.1	dbSNP	SNV	131	131	.	+	.	ID=295;Variant_seq=G;Dbxref=dbSNP_129:rs52996869;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399119.1	dbSNP	SNV	197	197	.	+	.	ID=296;Variant_seq=G;Dbxref=dbSNP_129:rs54363670;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399119.1	dbSNP	SNV	2840	2840	.	+	.	ID=297;Variant_seq=T;Dbxref=dbSNP_129:rs20325942;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399119.1	dbSNP	SNV	2864	2864	.	+	.	ID=298;Variant_seq=G;Dbxref=dbSNP_129:rs20325862;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399119.1	dbSNP	SNV	3165	3165	.	+	.	ID=299;Variant_seq=T;Dbxref=dbSNP_129:rs52848055;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399119.1	dbSNP	SNV	3172	3172	.	+	.	ID=300;Variant_seq=C;Dbxref=dbSNP_129:rs53730242;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399119.1	dbSNP	SNV	3181	3181	.	+	.	ID=301;Variant_seq=A;Dbxref=dbSNP_129:rs53876231;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399119.1	dbSNP	SNV	3188	3188	.	+	.	ID=302;Variant_seq=T;Dbxref=dbSNP_129:rs52975620;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399119.1	dbSNP	SNV	3196	3196	.	+	.	ID=303;Variant_seq=G;Dbxref=dbSNP_129:rs53206816;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399119.1	dbSNP	SNV	3208	3208	.	+	.	ID=304;Variant_seq=T;Dbxref=dbSNP_129:rs53240659;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399119.1	dbSNP	SNV	3212	3212	.	+	.	ID=305;Variant_seq=A;Dbxref=dbSNP_129:rs53826975;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399119.1	dbSNP	SNV	3610	3610	.	+	.	ID=306;Variant_seq=T;Dbxref=dbSNP_129:rs19405993;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399119.1	dbSNP	SNV	3763	3763	.	+	.	ID=307;Variant_seq=T;Dbxref=dbSNP_129:rs19405803;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399119.1	dbSNP	SNV	3982	3982	.	+	.	ID=308;Variant_seq=G;Dbxref=dbSNP_129:rs19405473;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399119.1	dbSNP	SNV	3994	3994	.	+	.	ID=309;Variant_seq=T;Dbxref=dbSNP_129:rs19405433;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399119.1	dbSNP	SNV	4006	4006	.	+	.	ID=310;Variant_seq=G;Dbxref=dbSNP_129:rs19405403;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399119.1	dbSNP	SNV	4010	4010	.	+	.	ID=311;Variant_seq=T;Dbxref=dbSNP_129:rs19405393;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399119.1	dbSNP	SNV	4012	4012	.	+	.	ID=312;Variant_seq=G;Dbxref=dbSNP_129:rs19405383;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399119.1	dbSNP	SNV	4024	4024	.	+	.	ID=313;Variant_seq=G;Dbxref=dbSNP_129:rs19405353;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399119.1	dbSNP	SNV	4036	4036	.	+	.	ID=314;Variant_seq=C;Dbxref=dbSNP_129:rs19405343;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399119.1	dbSNP	SNV	4042	4042	.	+	.	ID=315;Variant_seq=C;Dbxref=dbSNP_129:rs19405323;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399119.1	dbSNP	SNV	4045	4045	.	+	.	ID=316;Variant_seq=T;Dbxref=dbSNP_129:rs19405313;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399119.1	dbSNP	SNV	4054	4054	.	+	.	ID=317;Variant_seq=G;Dbxref=dbSNP_129:rs19405303;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399119.1	dbSNP	SNV	4066	4066	.	+	.	ID=318;Variant_seq=G;Dbxref=dbSNP_129:rs19405293;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399119.1	dbSNP	SNV	4069	4069	.	+	.	ID=319;Variant_seq=T;Dbxref=dbSNP_129:rs19405283;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399119.1	dbSNP	SNV	4078	4078	.	+	.	ID=320;Variant_seq=G;Dbxref=dbSNP_129:rs19405273;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399119.1	dbSNP	SNV	4079	4079	.	+	.	ID=321;Variant_seq=C;Dbxref=dbSNP_129:rs19405263;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399119.1	dbSNP	SNV	4080	4080	.	+	.	ID=322;Variant_seq=T;Dbxref=dbSNP_129:rs19405253;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399119.1	dbSNP	SNV	4084	4084	.	+	.	ID=323;Variant_seq=C;Dbxref=dbSNP_129:rs19405233;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399119.1	dbSNP	SNV	4096	4096	.	+	.	ID=324;Variant_seq=A;Dbxref=dbSNP_129:rs19405223;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399119.1	dbSNP	SNV	4102	4102	.	+	.	ID=325;Variant_seq=T;Dbxref=dbSNP_129:rs19405213;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399119.1	dbSNP	SNV	4109	4109	.	+	.	ID=326;Variant_seq=G;Dbxref=dbSNP_129:rs19405203;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399119.1	dbSNP	SNV	4118	4118	.	+	.	ID=327;Variant_seq=C;Dbxref=dbSNP_129:rs19405183;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399119.1	dbSNP	SNV	4153	4153	.	+	.	ID=328;Variant_seq=T;Dbxref=dbSNP_129:rs19405173;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399119.1	dbSNP	SNV	4156	4156	.	+	.	ID=329;Variant_seq=C;Dbxref=dbSNP_129:rs19405163;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399119.1	dbSNP	SNV	4337	4337	.	+	.	ID=330;Variant_seq=A;Dbxref=dbSNP_129:rs19404953;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399119.1	dbSNP	SNV	4691	4691	.	+	.	ID=331;Variant_seq=G;Dbxref=dbSNP_129:rs21742960;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399119.1	dbSNP	SNV	4693	4693	.	+	.	ID=332;Variant_seq=C;Dbxref=dbSNP_129:rs21742951;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399119.1	dbSNP	SNV	5699	5699	.	+	.	ID=333;Variant_seq=A;Dbxref=dbSNP_129:rs21742871;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399119.1	dbSNP	SNV	5708	5708	.	+	.	ID=334;Variant_seq=A;Dbxref=dbSNP_129:rs21742862;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399119.1	dbSNP	SNV	5711	5711	.	+	.	ID=335;Variant_seq=G;Dbxref=dbSNP_129:rs21742853;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399119.1	dbSNP	SNV	5818	5818	.	+	.	ID=336;Variant_seq=A;Dbxref=dbSNP_129:rs21742745;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399119.1	dbSNP	SNV	5845	5845	.	+	.	ID=337;Variant_seq=A;Dbxref=dbSNP_129:rs21742736;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399119.1	dbSNP	SNV	5884	5884	.	+	.	ID=338;Variant_seq=T;Dbxref=dbSNP_129:rs21742700;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399119.1	dbSNP	SNV	6857	6857	.	+	.	ID=339;Variant_seq=A;Dbxref=dbSNP_129:rs21742205;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048833.1	dbSNP	SNV	1345	1345	.	+	.	ID=340;Variant_seq=G;Dbxref=dbSNP_129:rs53401782;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048833.1	dbSNP	SNV	1348	1348	.	+	.	ID=341;Variant_seq=T;Dbxref=dbSNP_129:rs54137966;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048833.1	dbSNP	SNV	1499	1499	.	+	.	ID=342;Variant_seq=C;Dbxref=dbSNP_129:rs18863058;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043121.1	dbSNP	SNV	3327	3327	.	+	.	ID=343;Variant_seq=T;Dbxref=dbSNP_129:rs53523523;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039853.1	dbSNP	SNV	260	260	.	+	.	ID=344;Variant_seq=C;Dbxref=dbSNP_129:rs20628332;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039853.1	dbSNP	SNV	972	972	.	+	.	ID=345;Variant_seq=A;Dbxref=dbSNP_129:rs20627472;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039853.1	dbSNP	SNV	1767	1767	.	+	.	ID=346;Variant_seq=G;Dbxref=dbSNP_129:rs19087054;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039853.1	dbSNP	SNV	1773	1773	.	+	.	ID=347;Variant_seq=G;Dbxref=dbSNP_129:rs19087074;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039853.1	dbSNP	SNV	1775	1775	.	+	.	ID=348;Variant_seq=T;Dbxref=dbSNP_129:rs19087084;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039853.1	dbSNP	SNV	2184	2184	.	+	.	ID=349;Variant_seq=T;Dbxref=dbSNP_129:rs20323262;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400900.1	dbSNP	SNV	232	232	.	+	.	ID=350;Variant_seq=C;Dbxref=dbSNP_129:rs19882412;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400900.1	dbSNP	SNV	1441	1441	.	+	.	ID=351;Variant_seq=G;Dbxref=dbSNP_129:rs20087843;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400900.1	dbSNP	SNV	1456	1456	.	+	.	ID=352;Variant_seq=A;Dbxref=dbSNP_129:rs20667283;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400900.1	dbSNP	SNV	1892	1892	.	+	.	ID=353;Variant_seq=A;Dbxref=dbSNP_129:rs18940310;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400900.1	dbSNP	SNV	1893	1893	.	+	.	ID=354;Variant_seq=C;Dbxref=dbSNP_129:rs18940320;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02050016.1	dbSNP	SNV	1562	1562	.	+	.	ID=355;Variant_seq=T;Dbxref=dbSNP_129:rs18019341;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02050016.1	dbSNP	SNV	1563	1563	.	+	.	ID=356;Variant_seq=G;Dbxref=dbSNP_129:rs18019332;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02050016.1	dbSNP	SNV	1564	1564	.	+	.	ID=357;Variant_seq=G;Dbxref=dbSNP_129:rs18019323;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043090.1	dbSNP	SNV	3440	3440	.	+	.	ID=358;Variant_seq=A;Dbxref=dbSNP_129:rs21623122;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399311.1	dbSNP	SNV	160	160	.	+	.	ID=359;Variant_seq=G;Dbxref=dbSNP_129:rs21142023;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399311.1	dbSNP	SNV	209	209	.	+	.	ID=360;Variant_seq=C;Dbxref=dbSNP_129:rs21142033;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399311.1	dbSNP	SNV	256	256	.	+	.	ID=361;Variant_seq=G;Dbxref=dbSNP_129:rs21142043;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399311.1	dbSNP	SNV	5813	5813	.	+	.	ID=362;Variant_seq=G;Dbxref=dbSNP_129:rs53240384;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399311.1	dbSNP	SNV	5860	5860	.	+	.	ID=363;Variant_seq=G;Dbxref=dbSNP_129:rs53889331;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400222.1	dbSNP	SNV	892	892	.	+	.	ID=364;Variant_seq=T;Dbxref=dbSNP_129:rs21084527;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400222.1	dbSNP	SNV	920	920	.	+	.	ID=365;Variant_seq=C;Dbxref=dbSNP_129:rs21084537;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400222.1	dbSNP	SNV	932	932	.	+	.	ID=366;Variant_seq=A;Dbxref=dbSNP_129:rs17906231;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400222.1	dbSNP	SNV	1310	1310	.	+	.	ID=367;Variant_seq=A;Dbxref=dbSNP_129:rs53078487;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400222.1	dbSNP	SNV	1370	1370	.	+	.	ID=368;Variant_seq=T;Dbxref=dbSNP_129:rs54209110;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400222.1	dbSNP	SNV	1531	1531	.	+	.	ID=369;Variant_seq=A;Dbxref=dbSNP_129:rs21084607;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400222.1	dbSNP	SNV	1595	1595	.	+	.	ID=370;Variant_seq=A;Dbxref=dbSNP_129:rs21084617;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400222.1	dbSNP	SNV	1642	1642	.	+	.	ID=371;Variant_seq=C;Dbxref=dbSNP_129:rs21084637;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400222.1	dbSNP	SNV	1960	1960	.	+	.	ID=372;Variant_seq=G;Dbxref=dbSNP_129:rs21084697;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400222.1	dbSNP	SNV	2139	2139	.	+	.	ID=373;Variant_seq=A;Dbxref=dbSNP_129:rs21084707;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400222.1	dbSNP	SNV	2196	2196	.	+	.	ID=374;Variant_seq=C;Dbxref=dbSNP_129:rs21084717;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400222.1	dbSNP	SNV	2221	2221	.	+	.	ID=375;Variant_seq=C;Dbxref=dbSNP_129:rs21084727;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400222.1	dbSNP	SNV	2357	2357	.	+	.	ID=376;Variant_seq=G;Dbxref=dbSNP_129:rs21084747;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044412.1	dbSNP	SNV	1454	1454	.	+	.	ID=377;Variant_seq=G;Dbxref=dbSNP_129:rs19125638;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044412.1	dbSNP	SNV	2665	2665	.	+	.	ID=378;Variant_seq=A;Dbxref=dbSNP_129:rs17887201;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044412.1	dbSNP	SNV	2667	2667	.	+	.	ID=379;Variant_seq=T;Dbxref=dbSNP_129:rs18926293;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044412.1	dbSNP	SNV	2856	2856	.	+	.	ID=380;Variant_seq=C;Dbxref=dbSNP_129:rs18926392;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044412.1	dbSNP	SNV	2858	2858	.	+	.	ID=381;Variant_seq=T;Dbxref=dbSNP_129:rs18926402;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044412.1	dbSNP	SNV	2865	2865	.	+	.	ID=382;Variant_seq=T;Dbxref=dbSNP_129:rs18926412;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400294.1	dbSNP	SNV	1389	1389	.	+	.	ID=383;Variant_seq=G;Dbxref=dbSNP_129:rs52860934;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400294.1	dbSNP	SNV	1416	1416	.	+	.	ID=384;Variant_seq=A;Dbxref=dbSNP_129:rs53314966;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400294.1	dbSNP	SNV	1422	1422	.	+	.	ID=385;Variant_seq=T;Dbxref=dbSNP_129:rs54078594;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049593.1	dbSNP	SNV	1521	1521	.	+	.	ID=386;Variant_seq=G;Dbxref=dbSNP_129:rs19241200;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049593.1	dbSNP	SNV	1522	1522	.	+	.	ID=387;Variant_seq=C;Dbxref=dbSNP_129:rs19241190;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045938.1	dbSNP	SNV	1954	1954	.	+	.	ID=388;Variant_seq=T;Dbxref=dbSNP_129:rs20927188;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02040026.1	dbSNP	SNV	2744	2744	.	+	.	ID=389;Variant_seq=T;Dbxref=dbSNP_129:rs53475956;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040026.1	dbSNP	SNV	3801	3801	.	+	.	ID=390;Variant_seq=T;Dbxref=dbSNP_129:rs20251334;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040026.1	dbSNP	SNV	4641	4641	.	+	.	ID=391;Variant_seq=C;Dbxref=dbSNP_129:rs20409298;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040026.1	dbSNP	SNV	4644	4644	.	+	.	ID=392;Variant_seq=A;Dbxref=dbSNP_129:rs20409288;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043905.1	dbSNP	SNV	106	106	.	+	.	ID=393;Variant_seq=G;Dbxref=dbSNP_129:rs20422388;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399853.1	dbSNP	SNV	3970	3970	.	+	.	ID=394;Variant_seq=A;Dbxref=dbSNP_129:rs19413891;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399890.1	dbSNP	SNV	1094	1094	.	+	.	ID=395;Variant_seq=T;Dbxref=dbSNP_129:rs17947322;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399890.1	dbSNP	SNV	1293	1293	.	+	.	ID=396;Variant_seq=C;Dbxref=dbSNP_129:rs17946710;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399890.1	dbSNP	SNV	1294	1294	.	+	.	ID=397;Variant_seq=A;Dbxref=dbSNP_129:rs17946701;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399890.1	dbSNP	SNV	1295	1295	.	+	.	ID=398;Variant_seq=A;Dbxref=dbSNP_129:rs17946692;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399890.1	dbSNP	SNV	1296	1296	.	+	.	ID=399;Variant_seq=C;Dbxref=dbSNP_129:rs17946683;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399890.1	dbSNP	SNV	1299	1299	.	+	.	ID=400;Variant_seq=T;Dbxref=dbSNP_129:rs17946674;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399890.1	dbSNP	SNV	1300	1300	.	+	.	ID=401;Variant_seq=G;Dbxref=dbSNP_129:rs17946665;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399890.1	dbSNP	SNV	1311	1311	.	+	.	ID=402;Variant_seq=G;Dbxref=dbSNP_129:rs17946656;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399890.1	dbSNP	SNV	1315	1315	.	+	.	ID=403;Variant_seq=A;Dbxref=dbSNP_129:rs17946647;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399890.1	dbSNP	SNV	1318	1318	.	+	.	ID=404;Variant_seq=G;Dbxref=dbSNP_129:rs17946638;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399890.1	dbSNP	SNV	1328	1328	.	+	.	ID=405;Variant_seq=G;Dbxref=dbSNP_129:rs17946593;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399890.1	dbSNP	SNV	1332	1332	.	+	.	ID=406;Variant_seq=G;Dbxref=dbSNP_129:rs17946584;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399890.1	dbSNP	SNV	1335	1335	.	+	.	ID=407;Variant_seq=G;Dbxref=dbSNP_129:rs17946575;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399890.1	dbSNP	SNV	1341	1341	.	+	.	ID=408;Variant_seq=C;Dbxref=dbSNP_129:rs17946566;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399890.1	dbSNP	SNV	1344	1344	.	+	.	ID=409;Variant_seq=G;Dbxref=dbSNP_129:rs17946557;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399890.1	dbSNP	SNV	1346	1346	.	+	.	ID=410;Variant_seq=C;Dbxref=dbSNP_129:rs17946548;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049445.1	dbSNP	SNV	74	74	.	+	.	ID=411;Variant_seq=T;Dbxref=dbSNP_129:rs18477116;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049445.1	dbSNP	SNV	81	81	.	+	.	ID=412;Variant_seq=G;Dbxref=dbSNP_129:rs18477125;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049445.1	dbSNP	SNV	141	141	.	+	.	ID=413;Variant_seq=T;Dbxref=dbSNP_129:rs18477143;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049445.1	dbSNP	SNV	218	218	.	+	.	ID=414;Variant_seq=T;Dbxref=dbSNP_129:rs18477160;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047672.1	dbSNP	SNV	145	145	.	+	.	ID=415;Variant_seq=T;Dbxref=dbSNP_129:rs20762219;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047672.1	dbSNP	SNV	195	195	.	+	.	ID=416;Variant_seq=T,C,G;Dbxref=dbSNP_129:rs17905270;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047672.1	dbSNP	SNV	307	307	.	+	.	ID=417;Variant_seq=A;Dbxref=dbSNP_129:rs20762279;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047672.1	dbSNP	SNV	308	308	.	+	.	ID=418;Variant_seq=A;Dbxref=dbSNP_129:rs20762289;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047672.1	dbSNP	SNV	311	311	.	+	.	ID=419;Variant_seq=T;Dbxref=dbSNP_129:rs20762299;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047672.1	dbSNP	SNV	469	469	.	+	.	ID=420;Variant_seq=A;Dbxref=dbSNP_129:rs20762319;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047672.1	dbSNP	SNV	506	506	.	+	.	ID=421;Variant_seq=A;Dbxref=dbSNP_129:rs20762339;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047672.1	dbSNP	SNV	655	655	.	+	.	ID=422;Variant_seq=T;Dbxref=dbSNP_129:rs20762359;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047672.1	dbSNP	SNV	659	659	.	+	.	ID=423;Variant_seq=C;Dbxref=dbSNP_129:rs20762369;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047672.1	dbSNP	SNV	662	662	.	+	.	ID=424;Variant_seq=T;Dbxref=dbSNP_129:rs20762379;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047672.1	dbSNP	SNV	663	663	.	+	.	ID=425;Variant_seq=T;Dbxref=dbSNP_129:rs20762389;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047672.1	dbSNP	SNV	668	668	.	+	.	ID=426;Variant_seq=C;Dbxref=dbSNP_129:rs20762399;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047672.1	dbSNP	SNV	674	674	.	+	.	ID=427;Variant_seq=T;Dbxref=dbSNP_129:rs20762409;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047672.1	dbSNP	SNV	698	698	.	+	.	ID=428;Variant_seq=T;Dbxref=dbSNP_129:rs20762439;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047672.1	dbSNP	SNV	700	700	.	+	.	ID=429;Variant_seq=T;Dbxref=dbSNP_129:rs20762449;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047672.1	dbSNP	SNV	703	703	.	+	.	ID=430;Variant_seq=A;Dbxref=dbSNP_129:rs20762459;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047672.1	dbSNP	SNV	752	752	.	+	.	ID=431;Variant_seq=T;Dbxref=dbSNP_129:rs20762499;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047672.1	dbSNP	SNV	761	761	.	+	.	ID=432;Variant_seq=C;Dbxref=dbSNP_129:rs20762509;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047672.1	dbSNP	SNV	764	764	.	+	.	ID=433;Variant_seq=A;Dbxref=dbSNP_129:rs20762519;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047672.1	dbSNP	SNV	766	766	.	+	.	ID=434;Variant_seq=T;Dbxref=dbSNP_129:rs20762529;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047672.1	dbSNP	SNV	767	767	.	+	.	ID=435;Variant_seq=A;Dbxref=dbSNP_129:rs20762539;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047672.1	dbSNP	SNV	768	768	.	+	.	ID=436;Variant_seq=T;Dbxref=dbSNP_129:rs20762549;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047672.1	dbSNP	SNV	778	778	.	+	.	ID=437;Variant_seq=C;Dbxref=dbSNP_129:rs20762559;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047672.1	dbSNP	SNV	783	783	.	+	.	ID=438;Variant_seq=C;Dbxref=dbSNP_129:rs20762569;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047672.1	dbSNP	SNV	792	792	.	+	.	ID=439;Variant_seq=T;Dbxref=dbSNP_129:rs20762579;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047672.1	dbSNP	SNV	808	808	.	+	.	ID=440;Variant_seq=G;Dbxref=dbSNP_129:rs20762589;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047672.1	dbSNP	SNV	824	824	.	+	.	ID=441;Variant_seq=C;Dbxref=dbSNP_129:rs20762599;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047672.1	dbSNP	SNV	828	828	.	+	.	ID=442;Variant_seq=A;Dbxref=dbSNP_129:rs20762609;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047672.1	dbSNP	SNV	830	830	.	+	.	ID=443;Variant_seq=A;Dbxref=dbSNP_129:rs20762619;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047672.1	dbSNP	SNV	836	836	.	+	.	ID=444;Variant_seq=T;Dbxref=dbSNP_129:rs20762629;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047672.1	dbSNP	SNV	1090	1090	.	+	.	ID=445;Variant_seq=G;Dbxref=dbSNP_129:rs20762749;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047672.1	dbSNP	SNV	1092	1092	.	+	.	ID=446;Variant_seq=G;Dbxref=dbSNP_129:rs20762759;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047672.1	dbSNP	SNV	1150	1150	.	+	.	ID=447;Variant_seq=A;Dbxref=dbSNP_129:rs20762799;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047672.1	dbSNP	SNV	1153	1153	.	+	.	ID=448;Variant_seq=C;Dbxref=dbSNP_129:rs20762809;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047672.1	dbSNP	SNV	1157	1157	.	+	.	ID=449;Variant_seq=C;Dbxref=dbSNP_129:rs20762819;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047672.1	dbSNP	SNV	1180	1180	.	+	.	ID=450;Variant_seq=G;Dbxref=dbSNP_129:rs20762829;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047672.1	dbSNP	SNV	1201	1201	.	+	.	ID=451;Variant_seq=C;Dbxref=dbSNP_129:rs20762839;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047672.1	dbSNP	SNV	1216	1216	.	+	.	ID=452;Variant_seq=A;Dbxref=dbSNP_129:rs20762849;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040642.1	dbSNP	insertion	1490	1490	.	+	.	ID=453;Variant_seq=C;Dbxref=dbSNP_129:rs54369210;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02040642.1	dbSNP	SNV	1491	1491	.	+	.	ID=454;Variant_seq=C;Dbxref=dbSNP_129:rs53551439;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040642.1	dbSNP	SNV	1493	1493	.	+	.	ID=455;Variant_seq=A;Dbxref=dbSNP_129:rs52982545;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040642.1	dbSNP	SNV	1511	1511	.	+	.	ID=456;Variant_seq=C;Dbxref=dbSNP_129:rs53455372;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040642.1	dbSNP	SNV	1530	1530	.	+	.	ID=457;Variant_seq=C;Dbxref=dbSNP_129:rs53052726;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040642.1	dbSNP	SNV	1557	1557	.	+	.	ID=458;Variant_seq=A;Dbxref=dbSNP_129:rs53663965;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040642.1	dbSNP	SNV	1563	1563	.	+	.	ID=459;Variant_seq=G;Dbxref=dbSNP_129:rs53634713;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02040642.1	dbSNP	SNV	1702	1702	.	+	.	ID=460;Variant_seq=A;Dbxref=dbSNP_129:rs52924003;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040642.1	dbSNP	SNV	1781	1781	.	+	.	ID=461;Variant_seq=A;Dbxref=dbSNP_129:rs53896992;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040642.1	dbSNP	SNV	1788	1788	.	+	.	ID=462;Variant_seq=T;Dbxref=dbSNP_129:rs53199326;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045030.1	dbSNP	SNV	530	530	.	+	.	ID=463;Variant_seq=T;Dbxref=dbSNP_129:rs19765137;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399940.1	dbSNP	SNV	2736	2736	.	+	.	ID=464;Variant_seq=T;Dbxref=dbSNP_129:rs21663794;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038077.1	dbSNP	SNV	436	436	.	+	.	ID=465;Variant_seq=G;Dbxref=dbSNP_129:rs21173440;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038077.1	dbSNP	SNV	447	447	.	+	.	ID=466;Variant_seq=C;Dbxref=dbSNP_129:rs21173430;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038077.1	dbSNP	SNV	448	448	.	+	.	ID=467;Variant_seq=A;Dbxref=dbSNP_129:rs21173420;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038077.1	dbSNP	SNV	577	577	.	+	.	ID=468;Variant_seq=C;Dbxref=dbSNP_129:rs21173180;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038077.1	dbSNP	SNV	580	580	.	+	.	ID=469;Variant_seq=G;Dbxref=dbSNP_129:rs21173160;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038077.1	dbSNP	SNV	591	591	.	+	.	ID=470;Variant_seq=T;Dbxref=dbSNP_129:rs21173150;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038077.1	dbSNP	SNV	6595	6595	.	+	.	ID=471;Variant_seq=A;Dbxref=dbSNP_129:rs53572311;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038077.1	dbSNP	SNV	6602	6602	.	+	.	ID=472;Variant_seq=A;Dbxref=dbSNP_129:rs54254908;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038077.1	dbSNP	SNV	6609	6609	.	+	.	ID=473;Variant_seq=T;Dbxref=dbSNP_129:rs53618539;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038077.1	dbSNP	insertion	6628	6628	.	+	.	ID=474;Variant_seq=CCATCGATACATCCACGTCCCCCCCATGTACA;Dbxref=dbSNP_129:rs53606251;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02038077.1	dbSNP	SNV	6633	6633	.	+	.	ID=475;Variant_seq=G;Dbxref=dbSNP_129:rs53108956;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038077.1	dbSNP	insertion	6635	6635	.	+	.	ID=476;Variant_seq=C;Dbxref=dbSNP_129:rs52976043;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02038077.1	dbSNP	deletion	6636	6636	.	+	.	ID=477;Variant_seq=-;Dbxref=dbSNP_129:rs54075110;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038077.1	dbSNP	SNV	6655	6655	.	+	.	ID=478;Variant_seq=T;Dbxref=dbSNP_129:rs53073490;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038077.1	dbSNP	SNV	6657	6657	.	+	.	ID=479;Variant_seq=G;Dbxref=dbSNP_129:rs53449592;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038077.1	dbSNP	SNV	6666	6666	.	+	.	ID=480;Variant_seq=G;Dbxref=dbSNP_129:rs53744004;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038077.1	dbSNP	SNV	6667	6667	.	+	.	ID=481;Variant_seq=A;Dbxref=dbSNP_129:rs53798073;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046132.1	dbSNP	SNV	2405	2405	.	+	.	ID=482;Variant_seq=A;Dbxref=dbSNP_129:rs53674295;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049062.1	dbSNP	SNV	804	804	.	+	.	ID=483;Variant_seq=G;Dbxref=dbSNP_129:rs53625284;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043326.1	dbSNP	SNV	1036	1036	.	+	.	ID=484;Variant_seq=C;Dbxref=dbSNP_129:rs54409684;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043326.1	dbSNP	SNV	1052	1052	.	+	.	ID=485;Variant_seq=C;Dbxref=dbSNP_129:rs53437834;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043326.1	dbSNP	SNV	1074	1074	.	+	.	ID=486;Variant_seq=G;Dbxref=dbSNP_129:rs53182272;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043326.1	dbSNP	SNV	1092	1092	.	+	.	ID=487;Variant_seq=T;Dbxref=dbSNP_129:rs52899419;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043326.1	dbSNP	SNV	1095	1095	.	+	.	ID=488;Variant_seq=C;Dbxref=dbSNP_129:rs53735181;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043326.1	dbSNP	SNV	1098	1098	.	+	.	ID=489;Variant_seq=T;Dbxref=dbSNP_129:rs52995704;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043326.1	dbSNP	SNV	1103	1103	.	+	.	ID=490;Variant_seq=G;Dbxref=dbSNP_129:rs53612614;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043326.1	dbSNP	SNV	3476	3476	.	+	.	ID=491;Variant_seq=T;Dbxref=dbSNP_129:rs52858971;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043326.1	dbSNP	SNV	3483	3483	.	+	.	ID=492;Variant_seq=A;Dbxref=dbSNP_129:rs52863669;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043326.1	dbSNP	SNV	3489	3489	.	+	.	ID=493;Variant_seq=T;Dbxref=dbSNP_129:rs53834601;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043326.1	dbSNP	SNV	3494	3494	.	+	.	ID=494;Variant_seq=T;Dbxref=dbSNP_129:rs53361598;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040531.1	dbSNP	SNV	1487	1487	.	+	.	ID=495;Variant_seq=T;Dbxref=dbSNP_129:rs19096982;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046344.1	dbSNP	SNV	2345	2345	.	+	.	ID=496;Variant_seq=T;Dbxref=dbSNP_129:rs19556218;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048834.1	dbSNP	SNV	1328	1328	.	+	.	ID=497;Variant_seq=G;Dbxref=dbSNP_129:rs54350058;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039238.1	dbSNP	SNV	315	315	.	+	.	ID=498;Variant_seq=A;Dbxref=dbSNP_129:rs19741984;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039238.1	dbSNP	SNV	4575	4575	.	+	.	ID=499;Variant_seq=A;Dbxref=dbSNP_129:rs20828667;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044353.1	dbSNP	SNV	435	435	.	+	.	ID=500;Variant_seq=T;Dbxref=dbSNP_129:rs53964965;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH401016.1	dbSNP	SNV	2068	2068	.	+	.	ID=501;Variant_seq=A;Dbxref=dbSNP_129:rs17968490;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038122.1	dbSNP	SNV	2529	2529	.	+	.	ID=502;Variant_seq=C;Dbxref=dbSNP_129:rs53103741;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038122.1	dbSNP	SNV	2532	2532	.	+	.	ID=503;Variant_seq=A;Dbxref=dbSNP_129:rs53838334;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038122.1	dbSNP	SNV	2552	2552	.	+	.	ID=504;Variant_seq=T;Dbxref=dbSNP_129:rs53197671;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038122.1	dbSNP	insertion	6599	6599	.	+	.	ID=505;Variant_seq=ATAT;Dbxref=dbSNP_129:rs54332149;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02038122.1	dbSNP	insertion	6599	6599	.	+	.	ID=506;Variant_seq=AT;Dbxref=dbSNP_129:rs52874273;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02038122.1	dbSNP	SNV	8362	8362	.	+	.	ID=507;Variant_seq=T;Dbxref=dbSNP_129:rs18792969;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399028.1	dbSNP	SNV	269	269	.	+	.	ID=508;Variant_seq=C;Dbxref=dbSNP_129:rs52886175;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399028.1	dbSNP	SNV	352	352	.	+	.	ID=509;Variant_seq=T;Dbxref=dbSNP_129:rs19297260;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399028.1	dbSNP	SNV	3075	3075	.	+	.	ID=510;Variant_seq=T;Dbxref=dbSNP_129:rs53538658;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399028.1	dbSNP	SNV	3167	3167	.	+	.	ID=511;Variant_seq=T;Dbxref=dbSNP_129:rs54317233;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399028.1	dbSNP	SNV	3169	3169	.	+	.	ID=512;Variant_seq=A;Dbxref=dbSNP_129:rs53429860;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399028.1	dbSNP	SNV	3171	3171	.	+	.	ID=513;Variant_seq=T;Dbxref=dbSNP_129:rs53529586;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400399.1	dbSNP	SNV	1760	1760	.	+	.	ID=514;Variant_seq=C;Dbxref=dbSNP_129:rs20215098;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038317.1	dbSNP	SNV	46	46	.	+	.	ID=515;Variant_seq=A;Dbxref=dbSNP_129:rs21043686;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038317.1	dbSNP	SNV	1763	1763	.	+	.	ID=516;Variant_seq=T;Dbxref=dbSNP_129:rs20636425;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038317.1	dbSNP	SNV	2369	2369	.	+	.	ID=517;Variant_seq=A;Dbxref=dbSNP_129:rs18236572;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038317.1	dbSNP	SNV	2930	2930	.	+	.	ID=518;Variant_seq=T;Dbxref=dbSNP_129:rs19471503;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041700.1	dbSNP	SNV	531	531	.	+	.	ID=519;Variant_seq=C;Dbxref=dbSNP_129:rs21019459;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400400.1	dbSNP	SNV	439	439	.	+	.	ID=520;Variant_seq=G;Dbxref=dbSNP_129:rs20719368;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400400.1	dbSNP	SNV	526	526	.	+	.	ID=521;Variant_seq=C;Dbxref=dbSNP_129:rs20719338;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400400.1	dbSNP	SNV	711	711	.	+	.	ID=522;Variant_seq=G;Dbxref=dbSNP_129:rs20719308;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400400.1	dbSNP	SNV	719	719	.	+	.	ID=523;Variant_seq=A;Dbxref=dbSNP_129:rs20719298;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400400.1	dbSNP	SNV	751	751	.	+	.	ID=524;Variant_seq=A;Dbxref=dbSNP_129:rs20719288;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400400.1	dbSNP	SNV	1929	1929	.	+	.	ID=525;Variant_seq=T;Dbxref=dbSNP_129:rs21306681;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400400.1	dbSNP	SNV	2537	2537	.	+	.	ID=526;Variant_seq=A;Dbxref=dbSNP_129:rs20718818;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400400.1	dbSNP	SNV	2573	2573	.	+	.	ID=527;Variant_seq=G;Dbxref=dbSNP_129:rs20718808;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400400.1	dbSNP	SNV	2591	2591	.	+	.	ID=528;Variant_seq=G;Dbxref=dbSNP_129:rs20718798;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400400.1	dbSNP	SNV	2754	2754	.	+	.	ID=529;Variant_seq=T;Dbxref=dbSNP_129:rs20718778;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400400.1	dbSNP	SNV	2976	2976	.	+	.	ID=530;Variant_seq=A;Dbxref=dbSNP_129:rs20718708;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	105	105	.	+	.	ID=531;Variant_seq=C;Dbxref=dbSNP_129:rs18882335;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	117	117	.	+	.	ID=532;Variant_seq=A;Dbxref=dbSNP_129:rs18882325;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	118	118	.	+	.	ID=533;Variant_seq=G;Dbxref=dbSNP_129:rs18882315;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	120	120	.	+	.	ID=534;Variant_seq=T;Dbxref=dbSNP_129:rs18882305;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	123	123	.	+	.	ID=535;Variant_seq=T;Dbxref=dbSNP_129:rs18882295;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	131	131	.	+	.	ID=536;Variant_seq=C;Dbxref=dbSNP_129:rs18882275;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	132	132	.	+	.	ID=537;Variant_seq=C;Dbxref=dbSNP_129:rs18882265;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	135	135	.	+	.	ID=538;Variant_seq=G;Dbxref=dbSNP_129:rs18882255;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	141	141	.	+	.	ID=539;Variant_seq=G;Dbxref=dbSNP_129:rs18882245;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	142	142	.	+	.	ID=540;Variant_seq=T;Dbxref=dbSNP_129:rs18882235;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	144	144	.	+	.	ID=541;Variant_seq=A;Dbxref=dbSNP_129:rs18882225;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	146	146	.	+	.	ID=542;Variant_seq=C;Dbxref=dbSNP_129:rs18882215;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	147	147	.	+	.	ID=543;Variant_seq=C;Dbxref=dbSNP_129:rs18882205;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	149	149	.	+	.	ID=544;Variant_seq=T;Dbxref=dbSNP_129:rs18882195;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	153	153	.	+	.	ID=545;Variant_seq=G;Dbxref=dbSNP_129:rs18882185;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	154	154	.	+	.	ID=546;Variant_seq=A;Dbxref=dbSNP_129:rs18882175;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	155	155	.	+	.	ID=547;Variant_seq=C;Dbxref=dbSNP_129:rs18882165;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	156	156	.	+	.	ID=548;Variant_seq=A;Dbxref=dbSNP_129:rs18882155;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	159	159	.	+	.	ID=549;Variant_seq=T;Dbxref=dbSNP_129:rs18882145;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	160	160	.	+	.	ID=550;Variant_seq=T;Dbxref=dbSNP_129:rs18882135;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	162	162	.	+	.	ID=551;Variant_seq=T;Dbxref=dbSNP_129:rs18882125;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	183	183	.	+	.	ID=552;Variant_seq=C;Dbxref=dbSNP_129:rs18882105;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	186	186	.	+	.	ID=553;Variant_seq=T;Dbxref=dbSNP_129:rs18882095;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	189	189	.	+	.	ID=554;Variant_seq=G;Dbxref=dbSNP_129:rs18882085;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	195	195	.	+	.	ID=555;Variant_seq=G;Dbxref=dbSNP_129:rs18882075;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	202	202	.	+	.	ID=556;Variant_seq=A;Dbxref=dbSNP_129:rs18882055;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	213	213	.	+	.	ID=557;Variant_seq=A;Dbxref=dbSNP_129:rs18882035;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	214	214	.	+	.	ID=558;Variant_seq=G;Dbxref=dbSNP_129:rs18882025;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	216	216	.	+	.	ID=559;Variant_seq=A;Dbxref=dbSNP_129:rs18882015;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	219	219	.	+	.	ID=560;Variant_seq=C;Dbxref=dbSNP_129:rs18882005;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	234	234	.	+	.	ID=561;Variant_seq=T;Dbxref=dbSNP_129:rs18881985;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	238	238	.	+	.	ID=562;Variant_seq=G;Dbxref=dbSNP_129:rs18881975;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	240	240	.	+	.	ID=563;Variant_seq=G;Dbxref=dbSNP_129:rs18881965;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	243	243	.	+	.	ID=564;Variant_seq=G;Dbxref=dbSNP_129:rs18881955;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	327	327	.	+	.	ID=565;Variant_seq=G;Dbxref=dbSNP_129:rs18881895;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	328	328	.	+	.	ID=566;Variant_seq=T;Dbxref=dbSNP_129:rs18881885;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	333	333	.	+	.	ID=567;Variant_seq=A;Dbxref=dbSNP_129:rs18881875;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	334	334	.	+	.	ID=568;Variant_seq=A;Dbxref=dbSNP_129:rs18881865;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	338	338	.	+	.	ID=569;Variant_seq=A;Dbxref=dbSNP_129:rs18881855;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	339	339	.	+	.	ID=570;Variant_seq=G;Dbxref=dbSNP_129:rs18881845;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	345	345	.	+	.	ID=571;Variant_seq=G;Dbxref=dbSNP_129:rs18881805;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	346	346	.	+	.	ID=572;Variant_seq=T;Dbxref=dbSNP_129:rs18881795;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	348	348	.	+	.	ID=573;Variant_seq=A;Dbxref=dbSNP_129:rs18881785;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	352	352	.	+	.	ID=574;Variant_seq=G;Dbxref=dbSNP_129:rs18881775;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	353	353	.	+	.	ID=575;Variant_seq=G;Dbxref=dbSNP_129:rs18881765;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	354	354	.	+	.	ID=576;Variant_seq=G;Dbxref=dbSNP_129:rs18881755;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	362	362	.	+	.	ID=577;Variant_seq=G;Dbxref=dbSNP_129:rs18881745;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	365	365	.	+	.	ID=578;Variant_seq=G;Dbxref=dbSNP_129:rs18881735;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	366	366	.	+	.	ID=579;Variant_seq=T;Dbxref=dbSNP_129:rs18881725;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	372	372	.	+	.	ID=580;Variant_seq=C;Dbxref=dbSNP_129:rs18881715;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	376	376	.	+	.	ID=581;Variant_seq=C;Dbxref=dbSNP_129:rs18881705;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	377	377	.	+	.	ID=582;Variant_seq=G;Dbxref=dbSNP_129:rs18881695;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	381	381	.	+	.	ID=583;Variant_seq=C;Dbxref=dbSNP_129:rs18881665;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	393	393	.	+	.	ID=584;Variant_seq=T;Dbxref=dbSNP_129:rs18881605;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	396	396	.	+	.	ID=585;Variant_seq=A;Dbxref=dbSNP_129:rs18881595;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	397	397	.	+	.	ID=586;Variant_seq=C;Dbxref=dbSNP_129:rs18881585;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	400	400	.	+	.	ID=587;Variant_seq=G;Dbxref=dbSNP_129:rs18881575;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	441	441	.	+	.	ID=588;Variant_seq=G;Dbxref=dbSNP_129:rs18881495;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	448	448	.	+	.	ID=589;Variant_seq=T;Dbxref=dbSNP_129:rs18881485;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	453	453	.	+	.	ID=590;Variant_seq=G;Dbxref=dbSNP_129:rs18881455;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	456	456	.	+	.	ID=591;Variant_seq=C;Dbxref=dbSNP_129:rs18881445;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	459	459	.	+	.	ID=592;Variant_seq=A;Dbxref=dbSNP_129:rs18881435;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	465	465	.	+	.	ID=593;Variant_seq=C;Dbxref=dbSNP_129:rs18881405;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	473	473	.	+	.	ID=594;Variant_seq=G;Dbxref=dbSNP_129:rs18881395;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	477	477	.	+	.	ID=595;Variant_seq=G;Dbxref=dbSNP_129:rs18881375;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	480	480	.	+	.	ID=596;Variant_seq=C;Dbxref=dbSNP_129:rs18881365;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	483	483	.	+	.	ID=597;Variant_seq=A;Dbxref=dbSNP_129:rs18881355;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	485	485	.	+	.	ID=598;Variant_seq=C;Dbxref=dbSNP_129:rs18881345;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	490	490	.	+	.	ID=599;Variant_seq=G;Dbxref=dbSNP_129:rs18881325;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	491	491	.	+	.	ID=600;Variant_seq=A;Dbxref=dbSNP_129:rs18881315;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	492	492	.	+	.	ID=601;Variant_seq=G;Dbxref=dbSNP_129:rs18881305;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	503	503	.	+	.	ID=602;Variant_seq=T;Dbxref=dbSNP_129:rs18881295;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	506	506	.	+	.	ID=603;Variant_seq=G;Dbxref=dbSNP_129:rs18881285;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	516	516	.	+	.	ID=604;Variant_seq=G;Dbxref=dbSNP_129:rs18881265;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	517	517	.	+	.	ID=605;Variant_seq=C;Dbxref=dbSNP_129:rs18881255;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	518	518	.	+	.	ID=606;Variant_seq=G;Dbxref=dbSNP_129:rs18881245;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	519	519	.	+	.	ID=607;Variant_seq=A;Dbxref=dbSNP_129:rs18881235;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	526	526	.	+	.	ID=608;Variant_seq=T;Dbxref=dbSNP_129:rs18881225;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	527	527	.	+	.	ID=609;Variant_seq=G;Dbxref=dbSNP_129:rs18881215;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	537	537	.	+	.	ID=610;Variant_seq=T;Dbxref=dbSNP_129:rs18881205;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	540	540	.	+	.	ID=611;Variant_seq=G;Dbxref=dbSNP_129:rs18881195;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	547	547	.	+	.	ID=612;Variant_seq=G;Dbxref=dbSNP_129:rs18881175;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	553	553	.	+	.	ID=613;Variant_seq=T;Dbxref=dbSNP_129:rs18881165;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	554	554	.	+	.	ID=614;Variant_seq=T;Dbxref=dbSNP_129:rs18881155;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	555	555	.	+	.	ID=615;Variant_seq=G;Dbxref=dbSNP_129:rs18881145;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	559	559	.	+	.	ID=616;Variant_seq=T;Dbxref=dbSNP_129:rs18881125;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	561	561	.	+	.	ID=617;Variant_seq=A;Dbxref=dbSNP_129:rs18881115;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	562	562	.	+	.	ID=618;Variant_seq=G;Dbxref=dbSNP_129:rs18881105;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	564	564	.	+	.	ID=619;Variant_seq=C;Dbxref=dbSNP_129:rs18881095;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	565	565	.	+	.	ID=620;Variant_seq=C;Dbxref=dbSNP_129:rs18881085;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	567	567	.	+	.	ID=621;Variant_seq=T;Dbxref=dbSNP_129:rs18881075;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	573	573	.	+	.	ID=622;Variant_seq=A;Dbxref=dbSNP_129:rs18881055;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	576	576	.	+	.	ID=623;Variant_seq=T;Dbxref=dbSNP_129:rs18881045;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	577	577	.	+	.	ID=624;Variant_seq=C;Dbxref=dbSNP_129:rs18881035;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	579	579	.	+	.	ID=625;Variant_seq=A;Dbxref=dbSNP_129:rs18881025;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	581	581	.	+	.	ID=626;Variant_seq=C;Dbxref=dbSNP_129:rs18881015;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	588	588	.	+	.	ID=627;Variant_seq=G;Dbxref=dbSNP_129:rs18880995;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	603	603	.	+	.	ID=628;Variant_seq=T;Dbxref=dbSNP_129:rs18880975;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	606	606	.	+	.	ID=629;Variant_seq=T;Dbxref=dbSNP_129:rs18880965;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	609	609	.	+	.	ID=630;Variant_seq=C;Dbxref=dbSNP_129:rs18880935;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	690	690	.	+	.	ID=631;Variant_seq=C;Dbxref=dbSNP_129:rs53572838;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	788	788	.	+	.	ID=632;Variant_seq=G;Dbxref=dbSNP_129:rs18880665;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	885	885	.	+	.	ID=633;Variant_seq=T;Dbxref=dbSNP_129:rs52879807;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	888	888	.	+	.	ID=634;Variant_seq=T;Dbxref=dbSNP_129:rs53053882;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	891	891	.	+	.	ID=635;Variant_seq=G;Dbxref=dbSNP_129:rs53825429;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	957	957	.	+	.	ID=636;Variant_seq=G;Dbxref=dbSNP_129:rs18880176;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	960	960	.	+	.	ID=637;Variant_seq=G;Dbxref=dbSNP_129:rs18880166;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	961	961	.	+	.	ID=638;Variant_seq=A;Dbxref=dbSNP_129:rs18880156;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	963	963	.	+	.	ID=639;Variant_seq=G;Dbxref=dbSNP_129:rs18880146;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	972	972	.	+	.	ID=640;Variant_seq=G;Dbxref=dbSNP_129:rs18880126;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	976	976	.	+	.	ID=641;Variant_seq=T;Dbxref=dbSNP_129:rs18880116;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	981	981	.	+	.	ID=642;Variant_seq=G;Dbxref=dbSNP_129:rs18880096;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	1005	1005	.	+	.	ID=643;Variant_seq=T;Dbxref=dbSNP_129:rs18880066;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	1012	1012	.	+	.	ID=644;Variant_seq=T;Dbxref=dbSNP_129:rs18880056;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	1017	1017	.	+	.	ID=645;Variant_seq=T;Dbxref=dbSNP_129:rs18880036;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	1020	1020	.	+	.	ID=646;Variant_seq=G;Dbxref=dbSNP_129:rs18880026;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1023	1023	.	+	.	ID=647;Variant_seq=T;Dbxref=dbSNP_129:rs18880016;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	1029	1029	.	+	.	ID=648;Variant_seq=G;Dbxref=dbSNP_129:rs18879996;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1032	1032	.	+	.	ID=649;Variant_seq=A;Dbxref=dbSNP_129:rs18879986;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	1033	1033	.	+	.	ID=650;Variant_seq=G;Dbxref=dbSNP_129:rs18879976;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	1066	1066	.	+	.	ID=651;Variant_seq=T;Dbxref=dbSNP_129:rs18879936;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1069	1069	.	+	.	ID=652;Variant_seq=G;Dbxref=dbSNP_129:rs18879926;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	1070	1070	.	+	.	ID=653;Variant_seq=C;Dbxref=dbSNP_129:rs18879916;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	1071	1071	.	+	.	ID=654;Variant_seq=T;Dbxref=dbSNP_129:rs18879906;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	1072	1072	.	+	.	ID=655;Variant_seq=A;Dbxref=dbSNP_129:rs18879896;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	1077	1077	.	+	.	ID=656;Variant_seq=A;Dbxref=dbSNP_129:rs18879886;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	1080	1080	.	+	.	ID=657;Variant_seq=G;Dbxref=dbSNP_129:rs18879876;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1083	1083	.	+	.	ID=658;Variant_seq=G;Dbxref=dbSNP_129:rs18879866;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1210	1210	.	+	.	ID=659;Variant_seq=G;Dbxref=dbSNP_129:rs18879586;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1225	1225	.	+	.	ID=660;Variant_seq=G;Dbxref=dbSNP_129:rs18879566;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1234	1234	.	+	.	ID=661;Variant_seq=G;Dbxref=dbSNP_129:rs18879556;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1237	1237	.	+	.	ID=662;Variant_seq=G;Dbxref=dbSNP_129:rs18879546;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1238	1238	.	+	.	ID=663;Variant_seq=T;Dbxref=dbSNP_129:rs18879536;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	1240	1240	.	+	.	ID=664;Variant_seq=T;Dbxref=dbSNP_129:rs18879526;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1243	1243	.	+	.	ID=665;Variant_seq=T;Dbxref=dbSNP_129:rs18879516;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	1249	1249	.	+	.	ID=666;Variant_seq=T;Dbxref=dbSNP_129:rs18879506;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1253	1253	.	+	.	ID=667;Variant_seq=A;Dbxref=dbSNP_129:rs18879496;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	1261	1261	.	+	.	ID=668;Variant_seq=C;Dbxref=dbSNP_129:rs18879476;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	1262	1262	.	+	.	ID=669;Variant_seq=A;Dbxref=dbSNP_129:rs18879466;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	1270	1270	.	+	.	ID=670;Variant_seq=C;Dbxref=dbSNP_129:rs18879456;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1273	1273	.	+	.	ID=671;Variant_seq=G;Dbxref=dbSNP_129:rs18879446;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	1276	1276	.	+	.	ID=672;Variant_seq=T;Dbxref=dbSNP_129:rs18879436;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	1282	1282	.	+	.	ID=673;Variant_seq=C;Dbxref=dbSNP_129:rs18879426;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039565.1	dbSNP	SNV	1285	1285	.	+	.	ID=674;Variant_seq=T;Dbxref=dbSNP_129:rs18879416;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1300	1300	.	+	.	ID=675;Variant_seq=T,C,G;Dbxref=dbSNP_129:rs17894444;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1306	1306	.	+	.	ID=676;Variant_seq=A;Dbxref=dbSNP_129:rs18879376;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	1459	1459	.	+	.	ID=677;Variant_seq=T;Dbxref=dbSNP_129:rs18878986;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039565.1	dbSNP	SNV	1468	1468	.	+	.	ID=678;Variant_seq=C;Dbxref=dbSNP_129:rs18878976;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1477	1477	.	+	.	ID=679;Variant_seq=T;Dbxref=dbSNP_129:rs18878966;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1480	1480	.	+	.	ID=680;Variant_seq=C;Dbxref=dbSNP_129:rs18878946;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1486	1486	.	+	.	ID=681;Variant_seq=A;Dbxref=dbSNP_129:rs18878936;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039565.1	dbSNP	SNV	1489	1489	.	+	.	ID=682;Variant_seq=T;Dbxref=dbSNP_129:rs18878926;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1492	1492	.	+	.	ID=683;Variant_seq=G;Dbxref=dbSNP_129:rs18878916;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039565.1	dbSNP	SNV	1501	1501	.	+	.	ID=684;Variant_seq=C;Dbxref=dbSNP_129:rs18878876;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043425.1	dbSNP	SNV	1493	1493	.	+	.	ID=685;Variant_seq=A;Dbxref=dbSNP_129:rs18691434;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041379.1	dbSNP	SNV	4089	4089	.	+	.	ID=686;Variant_seq=T;Dbxref=dbSNP_129:rs21483895;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399887.1	dbSNP	SNV	2471	2471	.	+	.	ID=687;Variant_seq=C;Dbxref=dbSNP_129:rs18664742;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399887.1	dbSNP	SNV	2710	2710	.	+	.	ID=688;Variant_seq=A;Dbxref=dbSNP_129:rs18664724;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044700.1	dbSNP	SNV	2212	2212	.	+	.	ID=689;Variant_seq=T;Dbxref=dbSNP_129:rs18671163;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044700.1	dbSNP	SNV	2214	2214	.	+	.	ID=690;Variant_seq=T;Dbxref=dbSNP_129:rs18671154;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044700.1	dbSNP	SNV	3015	3015	.	+	.	ID=691;Variant_seq=T;Dbxref=dbSNP_129:rs53899796;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039303.1	dbSNP	SNV	1049	1049	.	+	.	ID=692;Variant_seq=A;Dbxref=dbSNP_129:rs54179982;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039303.1	dbSNP	SNV	1388	1388	.	+	.	ID=693;Variant_seq=A;Dbxref=dbSNP_129:rs19880399;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039303.1	dbSNP	SNV	1415	1415	.	+	.	ID=694;Variant_seq=C;Dbxref=dbSNP_129:rs53251811;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039303.1	dbSNP	SNV	1441	1441	.	+	.	ID=695;Variant_seq=G;Dbxref=dbSNP_129:rs53578400;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039303.1	dbSNP	SNV	1449	1449	.	+	.	ID=696;Variant_seq=T;Dbxref=dbSNP_129:rs53719427;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039303.1	dbSNP	SNV	5068	5068	.	+	.	ID=697;Variant_seq=C;Dbxref=dbSNP_129:rs53004501;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039303.1	dbSNP	SNV	5071	5071	.	+	.	ID=698;Variant_seq=A;Dbxref=dbSNP_129:rs52913070;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040674.1	dbSNP	SNV	947	947	.	+	.	ID=699;Variant_seq=T;Dbxref=dbSNP_129:rs21333540;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040262.1	dbSNP	SNV	1564	1564	.	+	.	ID=700;Variant_seq=G;Dbxref=dbSNP_129:rs17890287;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02040262.1	dbSNP	SNV	4129	4129	.	+	.	ID=701;Variant_seq=A;Dbxref=dbSNP_129:rs53341628;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040262.1	dbSNP	SNV	4835	4835	.	+	.	ID=702;Variant_seq=A;Dbxref=dbSNP_129:rs20826209;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399065.1	dbSNP	insertion	1316	1316	.	+	.	ID=703;Variant_seq=A;Dbxref=dbSNP_129:rs53930174;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH399065.1	dbSNP	SNV	1321	1321	.	+	.	ID=704;Variant_seq=T;Dbxref=dbSNP_129:rs54370529;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399270.1	dbSNP	SNV	5082	5082	.	+	.	ID=705;Variant_seq=T;Dbxref=dbSNP_129:rs18541683;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399270.1	dbSNP	SNV	5083	5083	.	+	.	ID=706;Variant_seq=T;Dbxref=dbSNP_129:rs18541675;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399270.1	dbSNP	SNV	5092	5092	.	+	.	ID=707;Variant_seq=T;Dbxref=dbSNP_129:rs18541668;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399270.1	dbSNP	SNV	5123	5123	.	+	.	ID=708;Variant_seq=C;Dbxref=dbSNP_129:rs18541661;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399270.1	dbSNP	SNV	5220	5220	.	+	.	ID=709;Variant_seq=C;Dbxref=dbSNP_129:rs18541638;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399270.1	dbSNP	SNV	5230	5230	.	+	.	ID=710;Variant_seq=C;Dbxref=dbSNP_129:rs18541630;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399270.1	dbSNP	SNV	5343	5343	.	+	.	ID=711;Variant_seq=T;Dbxref=dbSNP_129:rs18541593;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399270.1	dbSNP	SNV	5361	5361	.	+	.	ID=712;Variant_seq=A;Dbxref=dbSNP_129:rs18541585;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399270.1	dbSNP	SNV	5469	5469	.	+	.	ID=713;Variant_seq=T;Dbxref=dbSNP_129:rs18541554;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399270.1	dbSNP	SNV	5470	5470	.	+	.	ID=714;Variant_seq=C;Dbxref=dbSNP_129:rs18541546;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399270.1	dbSNP	SNV	5501	5501	.	+	.	ID=715;Variant_seq=A;Dbxref=dbSNP_129:rs18541516;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399270.1	dbSNP	SNV	5504	5504	.	+	.	ID=716;Variant_seq=T;Dbxref=dbSNP_129:rs18541500;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399270.1	dbSNP	SNV	5517	5517	.	+	.	ID=717;Variant_seq=C;Dbxref=dbSNP_129:rs18541492;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399270.1	dbSNP	SNV	5714	5714	.	+	.	ID=718;Variant_seq=T;Dbxref=dbSNP_129:rs20340974;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399270.1	dbSNP	SNV	5726	5726	.	+	.	ID=719;Variant_seq=T;Dbxref=dbSNP_129:rs20340924;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399270.1	dbSNP	SNV	5891	5891	.	+	.	ID=720;Variant_seq=A;Dbxref=dbSNP_129:rs18541340;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399270.1	dbSNP	SNV	5893	5893	.	+	.	ID=721;Variant_seq=A;Dbxref=dbSNP_129:rs18541331;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399270.1	dbSNP	SNV	5919	5919	.	+	.	ID=722;Variant_seq=A;Dbxref=dbSNP_129:rs18541313;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399270.1	dbSNP	SNV	5933	5933	.	+	.	ID=723;Variant_seq=T;Dbxref=dbSNP_129:rs18541304;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399270.1	dbSNP	SNV	5941	5941	.	+	.	ID=724;Variant_seq=T;Dbxref=dbSNP_129:rs18541295;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399270.1	dbSNP	SNV	6105	6105	.	+	.	ID=725;Variant_seq=A,T,G;Dbxref=dbSNP_129:rs17891611;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399270.1	dbSNP	SNV	6117	6117	.	+	.	ID=726;Variant_seq=T;Dbxref=dbSNP_129:rs18541268;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399270.1	dbSNP	SNV	6149	6149	.	+	.	ID=727;Variant_seq=A;Dbxref=dbSNP_129:rs18541250;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399270.1	dbSNP	SNV	6150	6150	.	+	.	ID=728;Variant_seq=T;Dbxref=dbSNP_129:rs18541241;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399270.1	dbSNP	SNV	6204	6204	.	+	.	ID=729;Variant_seq=G;Dbxref=dbSNP_129:rs18541223;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399270.1	dbSNP	SNV	6216	6216	.	+	.	ID=730;Variant_seq=G;Dbxref=dbSNP_129:rs18541214;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399270.1	dbSNP	SNV	6217	6217	.	+	.	ID=731;Variant_seq=C;Dbxref=dbSNP_129:rs18541205;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399270.1	dbSNP	SNV	6237	6237	.	+	.	ID=732;Variant_seq=C;Dbxref=dbSNP_129:rs18541187;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399270.1	dbSNP	SNV	6261	6261	.	+	.	ID=733;Variant_seq=T;Dbxref=dbSNP_129:rs18541160;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399270.1	dbSNP	SNV	6288	6288	.	+	.	ID=734;Variant_seq=T;Dbxref=dbSNP_129:rs18541151;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399270.1	dbSNP	SNV	6312	6312	.	+	.	ID=735;Variant_seq=A;Dbxref=dbSNP_129:rs18541133;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399270.1	dbSNP	SNV	6313	6313	.	+	.	ID=736;Variant_seq=C;Dbxref=dbSNP_129:rs18541124;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399270.1	dbSNP	SNV	6328	6328	.	+	.	ID=737;Variant_seq=C;Dbxref=dbSNP_129:rs18541115;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399270.1	dbSNP	SNV	6329	6329	.	+	.	ID=738;Variant_seq=T;Dbxref=dbSNP_129:rs18541106;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399270.1	dbSNP	SNV	6330	6330	.	+	.	ID=739;Variant_seq=T;Dbxref=dbSNP_129:rs18541097;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398822.1	dbSNP	SNV	7132	7132	.	+	.	ID=740;Variant_seq=G;Dbxref=dbSNP_129:rs18830003;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047399.1	dbSNP	SNV	528	528	.	+	.	ID=741;Variant_seq=T;Dbxref=dbSNP_129:rs19532293;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047399.1	dbSNP	SNV	540	540	.	+	.	ID=742;Variant_seq=C;Dbxref=dbSNP_129:rs19532343;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047399.1	dbSNP	SNV	2251	2251	.	+	.	ID=743;Variant_seq=G;Dbxref=dbSNP_129:rs18213444;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047399.1	dbSNP	SNV	2361	2361	.	+	.	ID=744;Variant_seq=T;Dbxref=dbSNP_129:rs18213453;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047399.1	dbSNP	SNV	2391	2391	.	+	.	ID=745;Variant_seq=A;Dbxref=dbSNP_129:rs18213462;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047399.1	dbSNP	SNV	2420	2420	.	+	.	ID=746;Variant_seq=T;Dbxref=dbSNP_129:rs18213480;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400309.1	dbSNP	SNV	362	362	.	+	.	ID=747;Variant_seq=C;Dbxref=dbSNP_129:rs18263326;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041531.1	dbSNP	SNV	601	601	.	+	.	ID=748;Variant_seq=C;Dbxref=dbSNP_129:rs53537507;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041531.1	dbSNP	SNV	626	626	.	+	.	ID=749;Variant_seq=G;Dbxref=dbSNP_129:rs54108011;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041531.1	dbSNP	SNV	3891	3891	.	+	.	ID=750;Variant_seq=C;Dbxref=dbSNP_129:rs53327464;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039287.1	dbSNP	SNV	2237	2237	.	+	.	ID=751;Variant_seq=G;Dbxref=dbSNP_129:rs53450572;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039287.1	dbSNP	SNV	3899	3899	.	+	.	ID=752;Variant_seq=G;Dbxref=dbSNP_129:rs18222591;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039287.1	dbSNP	SNV	4218	4218	.	+	.	ID=753;Variant_seq=T;Dbxref=dbSNP_129:rs21060024;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039287.1	dbSNP	SNV	4228	4228	.	+	.	ID=754;Variant_seq=T;Dbxref=dbSNP_129:rs21060014;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039287.1	dbSNP	SNV	4229	4229	.	+	.	ID=755;Variant_seq=C;Dbxref=dbSNP_129:rs21060004;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039287.1	dbSNP	SNV	4731	4731	.	+	.	ID=756;Variant_seq=C;Dbxref=dbSNP_129:rs21059984;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039287.1	dbSNP	SNV	4738	4738	.	+	.	ID=757;Variant_seq=A;Dbxref=dbSNP_129:rs21059974;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039287.1	dbSNP	SNV	4762	4762	.	+	.	ID=758;Variant_seq=G;Dbxref=dbSNP_129:rs21059964;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039287.1	dbSNP	SNV	5316	5316	.	+	.	ID=759;Variant_seq=G;Dbxref=dbSNP_129:rs21059944;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041608.1	dbSNP	SNV	339	339	.	+	.	ID=760;Variant_seq=C;Dbxref=dbSNP_129:rs19767015;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041608.1	dbSNP	SNV	351	351	.	+	.	ID=761;Variant_seq=C;Dbxref=dbSNP_129:rs19767005;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041608.1	dbSNP	SNV	357	357	.	+	.	ID=762;Variant_seq=T;Dbxref=dbSNP_129:rs19766995;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041608.1	dbSNP	SNV	3878	3878	.	+	.	ID=763;Variant_seq=T;Dbxref=dbSNP_129:rs21210913;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399166.1	dbSNP	SNV	4254	4254	.	+	.	ID=764;Variant_seq=T;Dbxref=dbSNP_129:rs19260427;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400849.1	dbSNP	SNV	2112	2112	.	+	.	ID=765;Variant_seq=T;Dbxref=dbSNP_129:rs17952560;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02040608.1	dbSNP	SNV	1518	1518	.	+	.	ID=766;Variant_seq=G;Dbxref=dbSNP_129:rs53140720;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398259.1	dbSNP	SNV	235	235	.	+	.	ID=767;Variant_seq=G;Dbxref=dbSNP_129:rs53927395;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398259.1	dbSNP	SNV	10676	10676	.	+	.	ID=768;Variant_seq=G;Dbxref=dbSNP_129:rs53886157;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398259.1	dbSNP	SNV	12592	12592	.	+	.	ID=769;Variant_seq=A;Dbxref=dbSNP_129:rs21058885;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398259.1	dbSNP	SNV	25428	25428	.	+	.	ID=770;Variant_seq=A;Dbxref=dbSNP_129:rs19336788;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039671.1	dbSNP	SNV	2630	2630	.	+	.	ID=771;Variant_seq=T;Dbxref=dbSNP_129:rs52861694;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039671.1	dbSNP	SNV	2699	2699	.	+	.	ID=772;Variant_seq=T;Dbxref=dbSNP_129:rs54012114;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398713.1	dbSNP	SNV	4354	4354	.	+	.	ID=773;Variant_seq=A;Dbxref=dbSNP_129:rs17970293;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398713.1	dbSNP	SNV	8170	8170	.	+	.	ID=774;Variant_seq=C;Dbxref=dbSNP_129:rs18095341;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398713.1	dbSNP	SNV	10365	10365	.	+	.	ID=775;Variant_seq=C;Dbxref=dbSNP_129:rs20213206;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398713.1	dbSNP	SNV	10382	10382	.	+	.	ID=776;Variant_seq=T;Dbxref=dbSNP_129:rs20213196;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398713.1	dbSNP	SNV	10384	10384	.	+	.	ID=777;Variant_seq=T;Dbxref=dbSNP_129:rs20213186;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398713.1	dbSNP	SNV	10610	10610	.	+	.	ID=778;Variant_seq=T;Dbxref=dbSNP_129:rs53776876;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398676.1	dbSNP	SNV	181	181	.	+	.	ID=779;Variant_seq=A,C,G;Dbxref=dbSNP_129:rs17896800;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398676.1	dbSNP	SNV	2395	2395	.	+	.	ID=780;Variant_seq=A;Dbxref=dbSNP_129:rs53074310;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398676.1	dbSNP	SNV	2408	2408	.	+	.	ID=781;Variant_seq=C;Dbxref=dbSNP_129:rs54348540;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047566.1	dbSNP	SNV	413	413	.	+	.	ID=782;Variant_seq=C;Dbxref=dbSNP_129:rs20034631;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047566.1	dbSNP	SNV	418	418	.	+	.	ID=783;Variant_seq=A;Dbxref=dbSNP_129:rs20034611;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047566.1	dbSNP	SNV	2271	2271	.	+	.	ID=784;Variant_seq=A;Dbxref=dbSNP_129:rs53870171;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047566.1	dbSNP	SNV	2285	2285	.	+	.	ID=785;Variant_seq=T;Dbxref=dbSNP_129:rs52948636;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399565.1	dbSNP	SNV	2982	2982	.	+	.	ID=786;Variant_seq=A;Dbxref=dbSNP_129:rs53082367;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398562.1	dbSNP	SNV	827	827	.	+	.	ID=787;Variant_seq=T;Dbxref=dbSNP_129:rs54114248;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398562.1	dbSNP	SNV	5478	5478	.	+	.	ID=788;Variant_seq=T;Dbxref=dbSNP_129:rs53980108;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398562.1	dbSNP	SNV	12878	12878	.	+	.	ID=789;Variant_seq=G;Dbxref=dbSNP_129:rs21662094;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400396.1	dbSNP	SNV	572	572	.	+	.	ID=790;Variant_seq=A;Dbxref=dbSNP_129:rs19409467;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398738.1	dbSNP	SNV	3807	3807	.	+	.	ID=791;Variant_seq=A;Dbxref=dbSNP_129:rs18528339;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399751.1	dbSNP	SNV	305	305	.	+	.	ID=792;Variant_seq=T;Dbxref=dbSNP_129:rs19207248;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399751.1	dbSNP	SNV	580	580	.	+	.	ID=793;Variant_seq=G;Dbxref=dbSNP_129:rs19207317;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399751.1	dbSNP	SNV	968	968	.	+	.	ID=794;Variant_seq=A;Dbxref=dbSNP_129:rs18945329;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399751.1	dbSNP	SNV	1476	1476	.	+	.	ID=795;Variant_seq=T;Dbxref=dbSNP_129:rs19207497;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399751.1	dbSNP	SNV	1519	1519	.	+	.	ID=796;Variant_seq=G;Dbxref=dbSNP_129:rs19207507;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399751.1	dbSNP	SNV	1663	1663	.	+	.	ID=797;Variant_seq=T;Dbxref=dbSNP_129:rs19207527;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399751.1	dbSNP	SNV	3022	3022	.	+	.	ID=798;Variant_seq=T;Dbxref=dbSNP_129:rs19207807;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399751.1	dbSNP	SNV	3277	3277	.	+	.	ID=799;Variant_seq=C;Dbxref=dbSNP_129:rs19207897;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399751.1	dbSNP	SNV	3507	3507	.	+	.	ID=800;Variant_seq=T;Dbxref=dbSNP_129:rs19207947;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399751.1	dbSNP	SNV	4024	4024	.	+	.	ID=801;Variant_seq=T;Dbxref=dbSNP_129:rs19207977;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399751.1	dbSNP	SNV	4476	4476	.	+	.	ID=802;Variant_seq=C;Dbxref=dbSNP_129:rs53417859;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037377.1	dbSNP	insertion	9477	9477	.	+	.	ID=803;Variant_seq=TGC;Dbxref=dbSNP_129:rs53487637;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02037377.1	dbSNP	SNV	9745	9745	.	+	.	ID=804;Variant_seq=T;Dbxref=dbSNP_129:rs20819660;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399637.1	dbSNP	SNV	3550	3550	.	+	.	ID=805;Variant_seq=A;Dbxref=dbSNP_129:rs53701588;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399637.1	dbSNP	SNV	3612	3612	.	+	.	ID=806;Variant_seq=T;Dbxref=dbSNP_129:rs19008427;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399637.1	dbSNP	SNV	3613	3613	.	+	.	ID=807;Variant_seq=T;Dbxref=dbSNP_129:rs19008437;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399637.1	dbSNP	SNV	3622	3622	.	+	.	ID=808;Variant_seq=T;Dbxref=dbSNP_129:rs19008457;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399637.1	dbSNP	SNV	3873	3873	.	+	.	ID=809;Variant_seq=T;Dbxref=dbSNP_129:rs19008619;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399221.1	dbSNP	SNV	161	161	.	+	.	ID=810;Variant_seq=C;Dbxref=dbSNP_129:rs19223299;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399221.1	dbSNP	SNV	833	833	.	+	.	ID=811;Variant_seq=G;Dbxref=dbSNP_129:rs53431034;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399221.1	dbSNP	SNV	1083	1083	.	+	.	ID=812;Variant_seq=T;Dbxref=dbSNP_129:rs20847235;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399221.1	dbSNP	SNV	3561	3561	.	+	.	ID=813;Variant_seq=T;Dbxref=dbSNP_129:rs17955917;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399221.1	dbSNP	SNV	3562	3562	.	+	.	ID=814;Variant_seq=G;Dbxref=dbSNP_129:rs17955926;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037593.1	dbSNP	SNV	4300	4300	.	+	.	ID=815;Variant_seq=A;Dbxref=dbSNP_129:rs18837203;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037593.1	dbSNP	SNV	4304	4304	.	+	.	ID=816;Variant_seq=C;Dbxref=dbSNP_129:rs18837213;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037593.1	dbSNP	SNV	5316	5316	.	+	.	ID=817;Variant_seq=G;Dbxref=dbSNP_129:rs20164135;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02037593.1	dbSNP	SNV	6970	6970	.	+	.	ID=818;Variant_seq=A;Dbxref=dbSNP_129:rs18458094;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037593.1	dbSNP	insertion	7821	7821	.	+	.	ID=819;Variant_seq=CTGTTGTG;Dbxref=dbSNP_129:rs54181171;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02037593.1	dbSNP	SNV	8737	8737	.	+	.	ID=820;Variant_seq=T;Dbxref=dbSNP_129:rs18457716;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038654.1	dbSNP	SNV	2885	2885	.	+	.	ID=821;Variant_seq=A;Dbxref=dbSNP_129:rs20040332;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038654.1	dbSNP	SNV	2918	2918	.	+	.	ID=822;Variant_seq=T;Dbxref=dbSNP_129:rs20040302;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038654.1	dbSNP	SNV	2922	2922	.	+	.	ID=823;Variant_seq=T;Dbxref=dbSNP_129:rs20040292;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038654.1	dbSNP	SNV	2943	2943	.	+	.	ID=824;Variant_seq=G;Dbxref=dbSNP_129:rs20040282;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038654.1	dbSNP	SNV	3008	3008	.	+	.	ID=825;Variant_seq=C;Dbxref=dbSNP_129:rs20040232;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038654.1	dbSNP	SNV	3068	3068	.	+	.	ID=826;Variant_seq=A;Dbxref=dbSNP_129:rs20040152;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038654.1	dbSNP	SNV	3080	3080	.	+	.	ID=827;Variant_seq=A;Dbxref=dbSNP_129:rs20040142;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038654.1	dbSNP	SNV	3101	3101	.	+	.	ID=828;Variant_seq=T;Dbxref=dbSNP_129:rs20040122;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038654.1	dbSNP	SNV	3111	3111	.	+	.	ID=829;Variant_seq=G;Dbxref=dbSNP_129:rs20040112;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038654.1	dbSNP	SNV	3128	3128	.	+	.	ID=830;Variant_seq=G;Dbxref=dbSNP_129:rs20040092;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038654.1	dbSNP	SNV	3132	3132	.	+	.	ID=831;Variant_seq=T;Dbxref=dbSNP_129:rs20040082;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038654.1	dbSNP	SNV	3133	3133	.	+	.	ID=832;Variant_seq=G;Dbxref=dbSNP_129:rs20040072;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038654.1	dbSNP	SNV	3183	3183	.	+	.	ID=833;Variant_seq=C;Dbxref=dbSNP_129:rs20040052;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038654.1	dbSNP	SNV	6314	6314	.	+	.	ID=834;Variant_seq=A;Dbxref=dbSNP_129:rs20011156;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041297.1	dbSNP	SNV	433	433	.	+	.	ID=835;Variant_seq=T;Dbxref=dbSNP_129:rs53261898;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041788.1	dbSNP	SNV	1547	1547	.	+	.	ID=836;Variant_seq=A;Dbxref=dbSNP_129:rs19319998;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041788.1	dbSNP	SNV	3180	3180	.	+	.	ID=837;Variant_seq=A;Dbxref=dbSNP_129:rs19319678;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041788.1	dbSNP	SNV	3218	3218	.	+	.	ID=838;Variant_seq=C;Dbxref=dbSNP_129:rs19319468;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041788.1	dbSNP	SNV	3685	3685	.	+	.	ID=839;Variant_seq=A;Dbxref=dbSNP_129:rs19317741;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041788.1	dbSNP	SNV	3792	3792	.	+	.	ID=840;Variant_seq=C;Dbxref=dbSNP_129:rs19314301;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041788.1	dbSNP	SNV	3899	3899	.	+	.	ID=841;Variant_seq=C;Dbxref=dbSNP_129:rs19314281;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041788.1	dbSNP	SNV	3911	3911	.	+	.	ID=842;Variant_seq=C;Dbxref=dbSNP_129:rs19314271;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041788.1	dbSNP	SNV	4004	4004	.	+	.	ID=843;Variant_seq=G;Dbxref=dbSNP_129:rs18501118;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041788.1	dbSNP	SNV	4016	4016	.	+	.	ID=844;Variant_seq=T;Dbxref=dbSNP_129:rs18501109;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041788.1	dbSNP	SNV	4034	4034	.	+	.	ID=845;Variant_seq=G;Dbxref=dbSNP_129:rs18501100;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041788.1	dbSNP	SNV	4036	4036	.	+	.	ID=846;Variant_seq=A;Dbxref=dbSNP_129:rs18501091;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041788.1	dbSNP	SNV	4037	4037	.	+	.	ID=847;Variant_seq=C;Dbxref=dbSNP_129:rs18501082;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041788.1	dbSNP	SNV	4052	4052	.	+	.	ID=848;Variant_seq=G;Dbxref=dbSNP_129:rs18501064;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041788.1	dbSNP	SNV	4073	4073	.	+	.	ID=849;Variant_seq=T;Dbxref=dbSNP_129:rs18501055;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041788.1	dbSNP	SNV	4079	4079	.	+	.	ID=850;Variant_seq=G;Dbxref=dbSNP_129:rs18501046;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041788.1	dbSNP	SNV	4112	4112	.	+	.	ID=851;Variant_seq=T;Dbxref=dbSNP_129:rs18501037;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041788.1	dbSNP	SNV	4121	4121	.	+	.	ID=852;Variant_seq=A;Dbxref=dbSNP_129:rs18501028;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041788.1	dbSNP	SNV	4146	4146	.	+	.	ID=853;Variant_seq=T;Dbxref=dbSNP_129:rs18501010;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041788.1	dbSNP	SNV	4175	4175	.	+	.	ID=854;Variant_seq=T;Dbxref=dbSNP_129:rs18501001;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041788.1	dbSNP	SNV	4197	4197	.	+	.	ID=855;Variant_seq=C;Dbxref=dbSNP_129:rs18500983;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041788.1	dbSNP	SNV	4227	4227	.	+	.	ID=856;Variant_seq=C;Dbxref=dbSNP_129:rs18500956;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041788.1	dbSNP	SNV	4234	4234	.	+	.	ID=857;Variant_seq=C;Dbxref=dbSNP_129:rs18500947;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047581.1	dbSNP	SNV	815	815	.	+	.	ID=858;Variant_seq=T;Dbxref=dbSNP_129:rs54078594;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047581.1	dbSNP	SNV	821	821	.	+	.	ID=859;Variant_seq=A;Dbxref=dbSNP_129:rs53314966;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH401057.1	dbSNP	SNV	273	273	.	+	.	ID=860;Variant_seq=A;Dbxref=dbSNP_129:rs54378262;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH401057.1	dbSNP	SNV	274	274	.	+	.	ID=861;Variant_seq=T;Dbxref=dbSNP_129:rs53432335;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH401057.1	dbSNP	SNV	277	277	.	+	.	ID=862;Variant_seq=C;Dbxref=dbSNP_129:rs52850684;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH401057.1	dbSNP	SNV	289	289	.	+	.	ID=863;Variant_seq=T;Dbxref=dbSNP_129:rs53561234;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH401057.1	dbSNP	SNV	299	299	.	+	.	ID=864;Variant_seq=T;Dbxref=dbSNP_129:rs53715534;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH401057.1	dbSNP	SNV	300	300	.	+	.	ID=865;Variant_seq=C;Dbxref=dbSNP_129:rs53588568;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH401057.1	dbSNP	SNV	301	301	.	+	.	ID=866;Variant_seq=T;Dbxref=dbSNP_129:rs54070623;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH401057.1	dbSNP	SNV	302	302	.	+	.	ID=867;Variant_seq=C;Dbxref=dbSNP_129:rs53900899;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH401057.1	dbSNP	SNV	305	305	.	+	.	ID=868;Variant_seq=A;Dbxref=dbSNP_129:rs53903944;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH401057.1	dbSNP	SNV	330	330	.	+	.	ID=869;Variant_seq=T;Dbxref=dbSNP_129:rs53903538;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH401057.1	dbSNP	SNV	331	331	.	+	.	ID=870;Variant_seq=C;Dbxref=dbSNP_129:rs53689441;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH401057.1	dbSNP	SNV	716	716	.	+	.	ID=871;Variant_seq=C;Dbxref=dbSNP_129:rs19435223;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043407.1	dbSNP	SNV	121	121	.	+	.	ID=872;Variant_seq=C;Dbxref=dbSNP_129:rs53988297;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043407.1	dbSNP	SNV	2332	2332	.	+	.	ID=873;Variant_seq=T;Dbxref=dbSNP_129:rs53654832;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043407.1	dbSNP	SNV	2359	2359	.	+	.	ID=874;Variant_seq=C;Dbxref=dbSNP_129:rs54194198;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043407.1	dbSNP	SNV	2375	2375	.	+	.	ID=875;Variant_seq=G;Dbxref=dbSNP_129:rs53315050;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043407.1	dbSNP	SNV	2380	2380	.	+	.	ID=876;Variant_seq=A,T;Dbxref=dbSNP_129:rs52923478;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043407.1	dbSNP	SNV	2383	2383	.	+	.	ID=877;Variant_seq=C;Dbxref=dbSNP_129:rs54143087;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043407.1	dbSNP	SNV	2384	2384	.	+	.	ID=878;Variant_seq=G;Dbxref=dbSNP_129:rs53227016;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043407.1	dbSNP	SNV	2385	2385	.	+	.	ID=879;Variant_seq=A;Dbxref=dbSNP_129:rs52866272;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043407.1	dbSNP	SNV	2460	2460	.	+	.	ID=880;Variant_seq=T;Dbxref=dbSNP_129:rs53383465;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043407.1	dbSNP	SNV	2461	2461	.	+	.	ID=881;Variant_seq=T;Dbxref=dbSNP_129:rs53979180;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043407.1	dbSNP	SNV	2467	2467	.	+	.	ID=882;Variant_seq=C;Dbxref=dbSNP_129:rs53830603;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043407.1	dbSNP	SNV	2598	2598	.	+	.	ID=883;Variant_seq=A;Dbxref=dbSNP_129:rs53189373;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043407.1	dbSNP	SNV	2613	2613	.	+	.	ID=884;Variant_seq=C;Dbxref=dbSNP_129:rs53158018;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037248.1	dbSNP	SNV	3135	3135	.	+	.	ID=885;Variant_seq=A;Dbxref=dbSNP_129:rs52877345;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037248.1	dbSNP	SNV	3136	3136	.	+	.	ID=886;Variant_seq=A;Dbxref=dbSNP_129:rs53587129;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037248.1	dbSNP	SNV	3945	3945	.	+	.	ID=887;Variant_seq=T;Dbxref=dbSNP_129:rs18888101;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042780.1	dbSNP	SNV	265	265	.	+	.	ID=888;Variant_seq=G;Dbxref=dbSNP_129:rs53956927;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042780.1	dbSNP	SNV	2343	2343	.	+	.	ID=889;Variant_seq=T;Dbxref=dbSNP_129:rs53573095;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042780.1	dbSNP	SNV	2768	2768	.	+	.	ID=890;Variant_seq=T;Dbxref=dbSNP_129:rs20442467;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045977.1	dbSNP	SNV	1584	1584	.	+	.	ID=891;Variant_seq=G;Dbxref=dbSNP_129:rs20719431;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045977.1	dbSNP	SNV	2281	2281	.	+	.	ID=892;Variant_seq=T;Dbxref=dbSNP_129:rs21783762;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045977.1	dbSNP	SNV	2437	2437	.	+	.	ID=893;Variant_seq=C;Dbxref=dbSNP_129:rs19409722;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398235.1	dbSNP	SNV	72	72	.	+	.	ID=894;Variant_seq=T;Dbxref=dbSNP_129:rs21715741;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	1268	1268	.	+	.	ID=895;Variant_seq=T;Dbxref=dbSNP_129:rs19196421;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398235.1	dbSNP	SNV	8644	8644	.	+	.	ID=896;Variant_seq=T;Dbxref=dbSNP_129:rs20597208;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	15313	15313	.	+	.	ID=897;Variant_seq=A;Dbxref=dbSNP_129:rs18835204;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398235.1	dbSNP	SNV	15514	15514	.	+	.	ID=898;Variant_seq=G;Dbxref=dbSNP_129:rs53480733;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398235.1	dbSNP	SNV	15750	15750	.	+	.	ID=899;Variant_seq=T;Dbxref=dbSNP_129:rs54050852;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398235.1	dbSNP	deletion	15759	15759	.	+	.	ID=900;Variant_seq=-;Dbxref=dbSNP_129:rs53173776;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398235.1	dbSNP	SNV	15760	15760	.	+	.	ID=901;Variant_seq=T;Dbxref=dbSNP_129:rs54395972;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398235.1	dbSNP	SNV	15762	15762	.	+	.	ID=902;Variant_seq=T;Dbxref=dbSNP_129:rs53069956;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	15772	15772	.	+	.	ID=903;Variant_seq=T;Dbxref=dbSNP_129:rs54007877;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	15775	15775	.	+	.	ID=904;Variant_seq=A;Dbxref=dbSNP_129:rs53020908;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	15793	15793	.	+	.	ID=905;Variant_seq=T;Dbxref=dbSNP_129:rs53347497;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	15797	15797	.	+	.	ID=906;Variant_seq=C;Dbxref=dbSNP_129:rs53413323;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398235.1	dbSNP	SNV	15798	15798	.	+	.	ID=907;Variant_seq=A;Dbxref=dbSNP_129:rs53735347;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398235.1	dbSNP	SNV	15802	15802	.	+	.	ID=908;Variant_seq=T;Dbxref=dbSNP_129:rs54377341;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398235.1	dbSNP	SNV	17283	17283	.	+	.	ID=909;Variant_seq=A;Dbxref=dbSNP_129:rs20622802;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	17290	17290	.	+	.	ID=910;Variant_seq=C;Dbxref=dbSNP_129:rs20622782;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398235.1	dbSNP	SNV	17291	17291	.	+	.	ID=911;Variant_seq=A;Dbxref=dbSNP_129:rs20622772;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	17292	17292	.	+	.	ID=912;Variant_seq=G;Dbxref=dbSNP_129:rs20622762;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	17301	17301	.	+	.	ID=913;Variant_seq=G;Dbxref=dbSNP_129:rs20622752;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	17447	17447	.	+	.	ID=914;Variant_seq=A;Dbxref=dbSNP_129:rs18835344;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398235.1	dbSNP	SNV	17637	17637	.	+	.	ID=915;Variant_seq=A;Dbxref=dbSNP_129:rs20621932;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398235.1	dbSNP	SNV	17683	17683	.	+	.	ID=916;Variant_seq=T;Dbxref=dbSNP_129:rs18835364;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	21372	21372	.	+	.	ID=917;Variant_seq=A;Dbxref=dbSNP_129:rs18717553;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	21383	21383	.	+	.	ID=918;Variant_seq=T;Dbxref=dbSNP_129:rs18717562;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	21398	21398	.	+	.	ID=919;Variant_seq=A;Dbxref=dbSNP_129:rs18717571;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398235.1	dbSNP	SNV	21413	21413	.	+	.	ID=920;Variant_seq=A;Dbxref=dbSNP_129:rs18717580;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398235.1	dbSNP	SNV	21431	21431	.	+	.	ID=921;Variant_seq=T;Dbxref=dbSNP_129:rs18717589;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398235.1	dbSNP	SNV	21590	21590	.	+	.	ID=922;Variant_seq=A;Dbxref=dbSNP_129:rs18717679;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398235.1	dbSNP	SNV	21620	21620	.	+	.	ID=923;Variant_seq=T;Dbxref=dbSNP_129:rs18717688;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	21624	21624	.	+	.	ID=924;Variant_seq=C;Dbxref=dbSNP_129:rs18717697;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398235.1	dbSNP	SNV	21702	21702	.	+	.	ID=925;Variant_seq=T;Dbxref=dbSNP_129:rs18717706;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	21745	21745	.	+	.	ID=926;Variant_seq=C;Dbxref=dbSNP_129:rs18717715;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398235.1	dbSNP	SNV	21770	21770	.	+	.	ID=927;Variant_seq=C;Dbxref=dbSNP_129:rs18717724;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398235.1	dbSNP	SNV	27710	27710	.	+	.	ID=928;Variant_seq=C;Dbxref=dbSNP_129:rs53327294;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398235.1	dbSNP	SNV	31189	31189	.	+	.	ID=929;Variant_seq=C;Dbxref=dbSNP_129:rs53327294;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398235.1	dbSNP	SNV	35115	35115	.	+	.	ID=930;Variant_seq=A;Dbxref=dbSNP_129:rs53020247;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398235.1	dbSNP	SNV	39661	39661	.	+	.	ID=931;Variant_seq=C;Dbxref=dbSNP_129:rs18737587;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398235.1	dbSNP	SNV	39662	39662	.	+	.	ID=932;Variant_seq=A;Dbxref=dbSNP_129:rs18737578;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	39672	39672	.	+	.	ID=933;Variant_seq=A;Dbxref=dbSNP_129:rs18737569;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398235.1	dbSNP	SNV	39675	39675	.	+	.	ID=934;Variant_seq=G;Dbxref=dbSNP_129:rs18737560;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398235.1	dbSNP	SNV	39689	39689	.	+	.	ID=935;Variant_seq=C;Dbxref=dbSNP_129:rs18737542;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398235.1	dbSNP	SNV	39693	39693	.	+	.	ID=936;Variant_seq=G;Dbxref=dbSNP_129:rs18737533;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398235.1	dbSNP	SNV	40675	40675	.	+	.	ID=937;Variant_seq=C;Dbxref=dbSNP_129:rs53713881;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398235.1	dbSNP	SNV	46743	46743	.	+	.	ID=938;Variant_seq=A;Dbxref=dbSNP_129:rs54235549;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398235.1	dbSNP	SNV	85481	85481	.	+	.	ID=939;Variant_seq=A;Dbxref=dbSNP_129:rs19180431;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	88112	88112	.	+	.	ID=940;Variant_seq=A;Dbxref=dbSNP_129:rs20338778;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398235.1	dbSNP	SNV	88683	88683	.	+	.	ID=941;Variant_seq=T;Dbxref=dbSNP_129:rs54317030;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	88890	88890	.	+	.	ID=942;Variant_seq=A;Dbxref=dbSNP_129:rs19063540;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	89132	89132	.	+	.	ID=943;Variant_seq=T;Dbxref=dbSNP_129:rs19929940;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398235.1	dbSNP	SNV	92294	92294	.	+	.	ID=944;Variant_seq=A;Dbxref=dbSNP_129:rs20590555;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398235.1	dbSNP	SNV	92528	92528	.	+	.	ID=945;Variant_seq=C;Dbxref=dbSNP_129:rs20590595;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398235.1	dbSNP	SNV	92561	92561	.	+	.	ID=946;Variant_seq=A;Dbxref=dbSNP_129:rs20590615;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398235.1	dbSNP	SNV	92932	92932	.	+	.	ID=947;Variant_seq=G;Dbxref=dbSNP_129:rs20590665;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049799.1	dbSNP	SNV	1838	1838	.	+	.	ID=948;Variant_seq=T;Dbxref=dbSNP_129:rs21582685;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049799.1	dbSNP	SNV	1884	1884	.	+	.	ID=949;Variant_seq=A;Dbxref=dbSNP_129:rs21582555;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043713.1	dbSNP	SNV	137	137	.	+	.	ID=950;Variant_seq=C;Dbxref=dbSNP_129:rs19847396;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043713.1	dbSNP	SNV	209	209	.	+	.	ID=951;Variant_seq=G;Dbxref=dbSNP_129:rs19847406;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043713.1	dbSNP	SNV	260	260	.	+	.	ID=952;Variant_seq=C;Dbxref=dbSNP_129:rs19847416;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043713.1	dbSNP	SNV	333	333	.	+	.	ID=953;Variant_seq=G;Dbxref=dbSNP_129:rs19847426;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043713.1	dbSNP	SNV	418	418	.	+	.	ID=954;Variant_seq=G;Dbxref=dbSNP_129:rs19847446;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043713.1	dbSNP	SNV	617	617	.	+	.	ID=955;Variant_seq=C;Dbxref=dbSNP_129:rs19847456;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043713.1	dbSNP	SNV	711	711	.	+	.	ID=956;Variant_seq=A;Dbxref=dbSNP_129:rs19847476;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043713.1	dbSNP	SNV	1351	1351	.	+	.	ID=957;Variant_seq=T;Dbxref=dbSNP_129:rs19847545;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043713.1	dbSNP	SNV	1649	1649	.	+	.	ID=958;Variant_seq=A;Dbxref=dbSNP_129:rs19847585;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043713.1	dbSNP	SNV	1878	1878	.	+	.	ID=959;Variant_seq=T;Dbxref=dbSNP_129:rs19847615;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043713.1	dbSNP	SNV	2020	2020	.	+	.	ID=960;Variant_seq=C;Dbxref=dbSNP_129:rs19847645;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043713.1	dbSNP	SNV	2048	2048	.	+	.	ID=961;Variant_seq=G;Dbxref=dbSNP_129:rs19847655;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043713.1	dbSNP	SNV	2172	2172	.	+	.	ID=962;Variant_seq=T;Dbxref=dbSNP_129:rs19847675;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043713.1	dbSNP	SNV	2219	2219	.	+	.	ID=963;Variant_seq=G;Dbxref=dbSNP_129:rs19847685;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399287.1	dbSNP	SNV	4343	4343	.	+	.	ID=964;Variant_seq=A;Dbxref=dbSNP_129:rs19888238;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399873.1	dbSNP	SNV	177	177	.	+	.	ID=965;Variant_seq=C;Dbxref=dbSNP_129:rs20682823;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039026.1	dbSNP	SNV	176	176	.	+	.	ID=966;Variant_seq=C;Dbxref=dbSNP_129:rs21763741;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039026.1	dbSNP	SNV	1068	1068	.	+	.	ID=967;Variant_seq=A;Dbxref=dbSNP_129:rs20526295;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039026.1	dbSNP	SNV	1069	1069	.	+	.	ID=968;Variant_seq=C;Dbxref=dbSNP_129:rs20526285;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039026.1	dbSNP	SNV	1080	1080	.	+	.	ID=969;Variant_seq=C;Dbxref=dbSNP_129:rs20526275;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039026.1	dbSNP	SNV	1096	1096	.	+	.	ID=970;Variant_seq=G;Dbxref=dbSNP_129:rs20526255;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039026.1	dbSNP	SNV	1105	1105	.	+	.	ID=971;Variant_seq=A;Dbxref=dbSNP_129:rs20526245;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039026.1	dbSNP	SNV	2137	2137	.	+	.	ID=972;Variant_seq=C;Dbxref=dbSNP_129:rs19087534;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039026.1	dbSNP	SNV	4366	4366	.	+	.	ID=973;Variant_seq=T;Dbxref=dbSNP_129:rs20324624;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039026.1	dbSNP	SNV	5484	5484	.	+	.	ID=974;Variant_seq=A;Dbxref=dbSNP_129:rs18836364;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039026.1	dbSNP	SNV	5823	5823	.	+	.	ID=975;Variant_seq=T;Dbxref=dbSNP_129:rs53885963;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039026.1	dbSNP	SNV	5826	5826	.	+	.	ID=976;Variant_seq=T;Dbxref=dbSNP_129:rs54322783;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039026.1	dbSNP	SNV	6668	6668	.	+	.	ID=977;Variant_seq=G;Dbxref=dbSNP_129:rs18835854;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039026.1	dbSNP	SNV	6672	6672	.	+	.	ID=978;Variant_seq=A;Dbxref=dbSNP_129:rs18835844;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039026.1	dbSNP	SNV	6673	6673	.	+	.	ID=979;Variant_seq=A;Dbxref=dbSNP_129:rs18835834;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039026.1	dbSNP	SNV	6680	6680	.	+	.	ID=980;Variant_seq=T;Dbxref=dbSNP_129:rs18835814;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039026.1	dbSNP	SNV	6686	6686	.	+	.	ID=981;Variant_seq=A;Dbxref=dbSNP_129:rs18835804;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039026.1	dbSNP	SNV	6693	6693	.	+	.	ID=982;Variant_seq=C;Dbxref=dbSNP_129:rs18835794;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039026.1	dbSNP	SNV	6697	6697	.	+	.	ID=983;Variant_seq=T;Dbxref=dbSNP_129:rs18835784;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044628.1	dbSNP	SNV	403	403	.	+	.	ID=984;Variant_seq=A;Dbxref=dbSNP_129:rs53874330;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044628.1	dbSNP	SNV	1762	1762	.	+	.	ID=985;Variant_seq=C;Dbxref=dbSNP_129:rs19829131;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044628.1	dbSNP	SNV	2142	2142	.	+	.	ID=986;Variant_seq=T;Dbxref=dbSNP_129:rs53803300;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044628.1	dbSNP	SNV	2159	2159	.	+	.	ID=987;Variant_seq=C;Dbxref=dbSNP_129:rs53769999;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044628.1	dbSNP	SNV	2261	2261	.	+	.	ID=988;Variant_seq=G;Dbxref=dbSNP_129:rs53298476;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044628.1	dbSNP	SNV	2265	2265	.	+	.	ID=989;Variant_seq=A;Dbxref=dbSNP_129:rs21246606;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044628.1	dbSNP	SNV	2276	2276	.	+	.	ID=990;Variant_seq=T;Dbxref=dbSNP_129:rs54165184;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044628.1	dbSNP	SNV	2287	2287	.	+	.	ID=991;Variant_seq=C;Dbxref=dbSNP_129:rs53704810;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044628.1	dbSNP	SNV	2290	2290	.	+	.	ID=992;Variant_seq=T;Dbxref=dbSNP_129:rs54199557;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044628.1	dbSNP	SNV	2296	2296	.	+	.	ID=993;Variant_seq=C;Dbxref=dbSNP_129:rs53851098;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044628.1	dbSNP	SNV	2303	2303	.	+	.	ID=994;Variant_seq=T;Dbxref=dbSNP_129:rs53697632;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044628.1	dbSNP	SNV	2310	2310	.	+	.	ID=995;Variant_seq=G;Dbxref=dbSNP_129:rs53674308;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044628.1	dbSNP	SNV	2314	2314	.	+	.	ID=996;Variant_seq=T;Dbxref=dbSNP_129:rs53252046;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044628.1	dbSNP	SNV	2749	2749	.	+	.	ID=997;Variant_seq=T;Dbxref=dbSNP_129:rs53597025;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398323.1	dbSNP	SNV	332	332	.	+	.	ID=998;Variant_seq=C;Dbxref=dbSNP_129:rs20293848;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398323.1	dbSNP	SNV	724	724	.	+	.	ID=999;Variant_seq=A;Dbxref=dbSNP_129:rs20293868;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398323.1	dbSNP	SNV	1072	1072	.	+	.	ID=1000;Variant_seq=T;Dbxref=dbSNP_129:rs20293878;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398323.1	dbSNP	SNV	1263	1263	.	+	.	ID=1001;Variant_seq=C;Dbxref=dbSNP_129:rs20293888;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398323.1	dbSNP	SNV	1477	1477	.	+	.	ID=1002;Variant_seq=A;Dbxref=dbSNP_129:rs20293898;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398323.1	dbSNP	SNV	1764	1764	.	+	.	ID=1003;Variant_seq=A;Dbxref=dbSNP_129:rs52935543;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398323.1	dbSNP	SNV	4970	4970	.	+	.	ID=1004;Variant_seq=G;Dbxref=dbSNP_129:rs20860290;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398323.1	dbSNP	deletion	4977	4977	.	+	.	ID=1005;Variant_seq=-;Dbxref=dbSNP_129:rs52892342;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398323.1	dbSNP	SNV	11087	11087	.	+	.	ID=1006;Variant_seq=T;Dbxref=dbSNP_129:rs53366040;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398323.1	dbSNP	SNV	12619	12619	.	+	.	ID=1007;Variant_seq=T;Dbxref=dbSNP_129:rs54209525;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398323.1	dbSNP	SNV	12620	12620	.	+	.	ID=1008;Variant_seq=C;Dbxref=dbSNP_129:rs53580151;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043709.1	dbSNP	SNV	3253	3253	.	+	.	ID=1009;Variant_seq=T;Dbxref=dbSNP_129:rs19261727;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043709.1	dbSNP	SNV	3257	3257	.	+	.	ID=1010;Variant_seq=T;Dbxref=dbSNP_129:rs19261737;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044116.1	dbSNP	SNV	889	889	.	+	.	ID=1011;Variant_seq=G;Dbxref=dbSNP_129:rs19472033;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044116.1	dbSNP	SNV	895	895	.	+	.	ID=1012;Variant_seq=T;Dbxref=dbSNP_129:rs18725235;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044116.1	dbSNP	SNV	2153	2153	.	+	.	ID=1013;Variant_seq=A;Dbxref=dbSNP_129:rs17989211;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044116.1	dbSNP	SNV	2888	2888	.	+	.	ID=1014;Variant_seq=A;Dbxref=dbSNP_129:rs54188834;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044116.1	dbSNP	SNV	3021	3021	.	+	.	ID=1015;Variant_seq=A;Dbxref=dbSNP_129:rs19024634;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044514.1	dbSNP	SNV	2607	2607	.	+	.	ID=1016;Variant_seq=T;Dbxref=dbSNP_129:rs19005586;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044514.1	dbSNP	SNV	2628	2628	.	+	.	ID=1017;Variant_seq=T;Dbxref=dbSNP_129:rs19005596;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044514.1	dbSNP	SNV	2637	2637	.	+	.	ID=1018;Variant_seq=C;Dbxref=dbSNP_129:rs19005606;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041533.1	dbSNP	SNV	3828	3828	.	+	.	ID=1019;Variant_seq=C;Dbxref=dbSNP_129:rs53852253;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038583.1	dbSNP	SNV	1436	1436	.	+	.	ID=1020;Variant_seq=T;Dbxref=dbSNP_129:rs17959216;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045900.1	dbSNP	SNV	2081	2081	.	+	.	ID=1021;Variant_seq=T;Dbxref=dbSNP_129:rs21305698;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036749.1	dbSNP	SNV	8818	8818	.	+	.	ID=1022;Variant_seq=G;Dbxref=dbSNP_129:rs53904229;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036749.1	dbSNP	SNV	8819	8819	.	+	.	ID=1023;Variant_seq=A;Dbxref=dbSNP_129:rs54254523;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036749.1	dbSNP	SNV	8824	8824	.	+	.	ID=1024;Variant_seq=C;Dbxref=dbSNP_129:rs54144395;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036749.1	dbSNP	SNV	12418	12418	.	+	.	ID=1025;Variant_seq=A;Dbxref=dbSNP_129:rs19802887;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037136.1	dbSNP	SNV	10252	10252	.	+	.	ID=1026;Variant_seq=A;Dbxref=dbSNP_129:rs53671391;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399315.1	dbSNP	SNV	214	214	.	+	.	ID=1027;Variant_seq=A;Dbxref=dbSNP_129:rs53979652;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399315.1	dbSNP	SNV	278	278	.	+	.	ID=1028;Variant_seq=T;Dbxref=dbSNP_129:rs53572589;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399315.1	dbSNP	SNV	280	280	.	+	.	ID=1029;Variant_seq=T;Dbxref=dbSNP_129:rs53736567;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399315.1	dbSNP	SNV	2909	2909	.	+	.	ID=1030;Variant_seq=T;Dbxref=dbSNP_129:rs53455870;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399315.1	dbSNP	SNV	3293	3293	.	+	.	ID=1031;Variant_seq=T;Dbxref=dbSNP_129:rs21046502;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399315.1	dbSNP	SNV	3855	3855	.	+	.	ID=1032;Variant_seq=A;Dbxref=dbSNP_129:rs18977859;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399315.1	dbSNP	SNV	5563	5563	.	+	.	ID=1033;Variant_seq=T;Dbxref=dbSNP_129:rs53375935;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399315.1	dbSNP	SNV	5578	5578	.	+	.	ID=1034;Variant_seq=C;Dbxref=dbSNP_129:rs54339708;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038501.1	dbSNP	SNV	993	993	.	+	.	ID=1035;Variant_seq=A;Dbxref=dbSNP_129:rs52998347;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038501.1	dbSNP	SNV	2667	2667	.	+	.	ID=1036;Variant_seq=T;Dbxref=dbSNP_129:rs18901110;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038501.1	dbSNP	SNV	3022	3022	.	+	.	ID=1037;Variant_seq=A;Dbxref=dbSNP_129:rs19146087;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038501.1	dbSNP	SNV	3468	3468	.	+	.	ID=1038;Variant_seq=G;Dbxref=dbSNP_129:rs53812133;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038501.1	dbSNP	SNV	3888	3888	.	+	.	ID=1039;Variant_seq=A;Dbxref=dbSNP_129:rs19145927;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038501.1	dbSNP	SNV	4024	4024	.	+	.	ID=1040;Variant_seq=T;Dbxref=dbSNP_129:rs54045553;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038501.1	dbSNP	SNV	5988	5988	.	+	.	ID=1041;Variant_seq=T;Dbxref=dbSNP_129:rs20626377;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038501.1	dbSNP	SNV	6569	6569	.	+	.	ID=1042;Variant_seq=A;Dbxref=dbSNP_129:rs20626257;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039273.1	dbSNP	SNV	462	462	.	+	.	ID=1043;Variant_seq=G;Dbxref=dbSNP_129:rs53836463;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039273.1	dbSNP	SNV	473	473	.	+	.	ID=1044;Variant_seq=G;Dbxref=dbSNP_129:rs53625859;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039273.1	dbSNP	SNV	2240	2240	.	+	.	ID=1045;Variant_seq=A;Dbxref=dbSNP_129:rs18884922;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039273.1	dbSNP	SNV	2243	2243	.	+	.	ID=1046;Variant_seq=C;Dbxref=dbSNP_129:rs18884912;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039273.1	dbSNP	SNV	2304	2304	.	+	.	ID=1047;Variant_seq=T;Dbxref=dbSNP_129:rs18661889;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039273.1	dbSNP	SNV	2475	2475	.	+	.	ID=1048;Variant_seq=T;Dbxref=dbSNP_129:rs53922553;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039273.1	dbSNP	deletion	2519	2519	.	+	.	ID=1049;Variant_seq=-;Dbxref=dbSNP_129:rs53588728;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039273.1	dbSNP	SNV	4101	4101	.	+	.	ID=1050;Variant_seq=C;Dbxref=dbSNP_129:rs19100253;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039273.1	dbSNP	insertion	4162	4162	.	+	.	ID=1051;Variant_seq=T;Dbxref=dbSNP_129:rs53125196;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02039273.1	dbSNP	SNV	4338	4338	.	+	.	ID=1052;Variant_seq=T;Dbxref=dbSNP_129:rs19100263;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039273.1	dbSNP	SNV	4446	4446	.	+	.	ID=1053;Variant_seq=T;Dbxref=dbSNP_129:rs19100273;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039273.1	dbSNP	SNV	4562	4562	.	+	.	ID=1054;Variant_seq=C;Dbxref=dbSNP_129:rs19100293;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039273.1	dbSNP	SNV	4689	4689	.	+	.	ID=1055;Variant_seq=T;Dbxref=dbSNP_129:rs19100313;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039273.1	dbSNP	SNV	4780	4780	.	+	.	ID=1056;Variant_seq=T;Dbxref=dbSNP_129:rs19100323;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039273.1	dbSNP	SNV	4788	4788	.	+	.	ID=1057;Variant_seq=G;Dbxref=dbSNP_129:rs19100333;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039273.1	dbSNP	SNV	4901	4901	.	+	.	ID=1058;Variant_seq=C;Dbxref=dbSNP_129:rs19100343;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039273.1	dbSNP	SNV	5041	5041	.	+	.	ID=1059;Variant_seq=C;Dbxref=dbSNP_129:rs19100353;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039273.1	dbSNP	SNV	5048	5048	.	+	.	ID=1060;Variant_seq=G;Dbxref=dbSNP_129:rs19100363;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039273.1	dbSNP	SNV	5101	5101	.	+	.	ID=1061;Variant_seq=T;Dbxref=dbSNP_129:rs19100373;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039273.1	dbSNP	SNV	5156	5156	.	+	.	ID=1062;Variant_seq=G;Dbxref=dbSNP_129:rs19100383;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039273.1	dbSNP	SNV	5161	5161	.	+	.	ID=1063;Variant_seq=A;Dbxref=dbSNP_129:rs19100393;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039273.1	dbSNP	SNV	5276	5276	.	+	.	ID=1064;Variant_seq=G;Dbxref=dbSNP_129:rs19100413;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039273.1	dbSNP	SNV	5291	5291	.	+	.	ID=1065;Variant_seq=T;Dbxref=dbSNP_129:rs19100423;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039273.1	dbSNP	SNV	5384	5384	.	+	.	ID=1066;Variant_seq=T;Dbxref=dbSNP_129:rs19100433;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039273.1	dbSNP	SNV	5444	5444	.	+	.	ID=1067;Variant_seq=G;Dbxref=dbSNP_129:rs19100443;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039273.1	dbSNP	SNV	5501	5501	.	+	.	ID=1068;Variant_seq=G;Dbxref=dbSNP_129:rs19100453;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039273.1	dbSNP	SNV	5519	5519	.	+	.	ID=1069;Variant_seq=T;Dbxref=dbSNP_129:rs19100463;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039273.1	dbSNP	SNV	5555	5555	.	+	.	ID=1070;Variant_seq=C;Dbxref=dbSNP_129:rs19100473;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039273.1	dbSNP	SNV	5625	5625	.	+	.	ID=1071;Variant_seq=T;Dbxref=dbSNP_129:rs19100493;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039273.1	dbSNP	SNV	5709	5709	.	+	.	ID=1072;Variant_seq=A;Dbxref=dbSNP_129:rs19100503;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039273.1	dbSNP	SNV	5773	5773	.	+	.	ID=1073;Variant_seq=C;Dbxref=dbSNP_129:rs19100513;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039273.1	dbSNP	SNV	5820	5820	.	+	.	ID=1074;Variant_seq=C;Dbxref=dbSNP_129:rs19100523;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039273.1	dbSNP	SNV	5913	5913	.	+	.	ID=1075;Variant_seq=A;Dbxref=dbSNP_129:rs19100533;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039273.1	dbSNP	SNV	5965	5965	.	+	.	ID=1076;Variant_seq=T;Dbxref=dbSNP_129:rs19100543;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039273.1	dbSNP	SNV	5973	5973	.	+	.	ID=1077;Variant_seq=A;Dbxref=dbSNP_129:rs19100553;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039273.1	dbSNP	SNV	6300	6300	.	+	.	ID=1078;Variant_seq=A;Dbxref=dbSNP_129:rs19100563;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039273.1	dbSNP	SNV	6500	6500	.	+	.	ID=1079;Variant_seq=G;Dbxref=dbSNP_129:rs19100573;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039273.1	dbSNP	SNV	6504	6504	.	+	.	ID=1080;Variant_seq=A;Dbxref=dbSNP_129:rs19100583;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036413.1	dbSNP	SNV	9015	9015	.	+	.	ID=1081;Variant_seq=T;Dbxref=dbSNP_129:rs20937878;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399278.1	dbSNP	SNV	1437	1437	.	+	.	ID=1082;Variant_seq=G;Dbxref=dbSNP_129:rs21598902;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399278.1	dbSNP	SNV	2102	2102	.	+	.	ID=1083;Variant_seq=T;Dbxref=dbSNP_129:rs21460319;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048661.1	dbSNP	SNV	1701	1701	.	+	.	ID=1084;Variant_seq=G;Dbxref=dbSNP_129:rs53425218;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048661.1	dbSNP	SNV	1716	1716	.	+	.	ID=1085;Variant_seq=G;Dbxref=dbSNP_129:rs21655783;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048661.1	dbSNP	SNV	1741	1741	.	+	.	ID=1086;Variant_seq=C;Dbxref=dbSNP_129:rs53053713;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048661.1	dbSNP	SNV	1746	1746	.	+	.	ID=1087;Variant_seq=G;Dbxref=dbSNP_129:rs53145199;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048661.1	dbSNP	SNV	1754	1754	.	+	.	ID=1088;Variant_seq=T;Dbxref=dbSNP_129:rs53272440;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048661.1	dbSNP	SNV	1761	1761	.	+	.	ID=1089;Variant_seq=C;Dbxref=dbSNP_129:rs54160837;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039302.1	dbSNP	SNV	157	157	.	+	.	ID=1090;Variant_seq=G;Dbxref=dbSNP_129:rs53401747;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039302.1	dbSNP	SNV	227	227	.	+	.	ID=1091;Variant_seq=C;Dbxref=dbSNP_129:rs53901350;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039302.1	dbSNP	SNV	238	238	.	+	.	ID=1092;Variant_seq=A;Dbxref=dbSNP_129:rs53435964;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039302.1	dbSNP	SNV	243	243	.	+	.	ID=1093;Variant_seq=T;Dbxref=dbSNP_129:rs53994255;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039302.1	dbSNP	SNV	247	247	.	+	.	ID=1094;Variant_seq=T;Dbxref=dbSNP_129:rs54247312;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039302.1	dbSNP	SNV	255	255	.	+	.	ID=1095;Variant_seq=A,T;Dbxref=dbSNP_129:rs53933232;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039302.1	dbSNP	SNV	4445	4445	.	+	.	ID=1096;Variant_seq=A;Dbxref=dbSNP_129:rs21560528;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039302.1	dbSNP	SNV	5337	5337	.	+	.	ID=1097;Variant_seq=T;Dbxref=dbSNP_129:rs21691328;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039302.1	dbSNP	SNV	5345	5345	.	+	.	ID=1098;Variant_seq=A;Dbxref=dbSNP_129:rs21691346;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038900.1	dbSNP	SNV	5572	5572	.	+	.	ID=1099;Variant_seq=A;Dbxref=dbSNP_129:rs19088716;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041520.1	dbSNP	SNV	156	156	.	+	.	ID=1100;Variant_seq=A;Dbxref=dbSNP_129:rs20095177;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041520.1	dbSNP	SNV	215	215	.	+	.	ID=1101;Variant_seq=G;Dbxref=dbSNP_129:rs20095197;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041520.1	dbSNP	SNV	219	219	.	+	.	ID=1102;Variant_seq=T;Dbxref=dbSNP_129:rs20095207;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041520.1	dbSNP	SNV	267	267	.	+	.	ID=1103;Variant_seq=T;Dbxref=dbSNP_129:rs20095217;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041520.1	dbSNP	SNV	346	346	.	+	.	ID=1104;Variant_seq=T;Dbxref=dbSNP_129:rs20095237;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041520.1	dbSNP	SNV	707	707	.	+	.	ID=1105;Variant_seq=C;Dbxref=dbSNP_129:rs20095267;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041520.1	dbSNP	SNV	724	724	.	+	.	ID=1106;Variant_seq=G;Dbxref=dbSNP_129:rs20095277;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041520.1	dbSNP	SNV	758	758	.	+	.	ID=1107;Variant_seq=T;Dbxref=dbSNP_129:rs20095297;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041520.1	dbSNP	SNV	1016	1016	.	+	.	ID=1108;Variant_seq=C;Dbxref=dbSNP_129:rs20095307;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041520.1	dbSNP	SNV	1032	1032	.	+	.	ID=1109;Variant_seq=C;Dbxref=dbSNP_129:rs20095317;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041520.1	dbSNP	SNV	1033	1033	.	+	.	ID=1110;Variant_seq=G;Dbxref=dbSNP_129:rs20095327;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041520.1	dbSNP	SNV	1070	1070	.	+	.	ID=1111;Variant_seq=G;Dbxref=dbSNP_129:rs20095337;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041520.1	dbSNP	SNV	1181	1181	.	+	.	ID=1112;Variant_seq=C;Dbxref=dbSNP_129:rs20095347;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041520.1	dbSNP	SNV	1249	1249	.	+	.	ID=1113;Variant_seq=C;Dbxref=dbSNP_129:rs20095367;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041520.1	dbSNP	SNV	1252	1252	.	+	.	ID=1114;Variant_seq=C;Dbxref=dbSNP_129:rs20095377;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041520.1	dbSNP	SNV	1430	1430	.	+	.	ID=1115;Variant_seq=G;Dbxref=dbSNP_129:rs20095407;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041520.1	dbSNP	SNV	1568	1568	.	+	.	ID=1116;Variant_seq=A;Dbxref=dbSNP_129:rs20095417;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041520.1	dbSNP	SNV	1573	1573	.	+	.	ID=1117;Variant_seq=A;Dbxref=dbSNP_129:rs20095427;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041520.1	dbSNP	SNV	2852	2852	.	+	.	ID=1118;Variant_seq=A;Dbxref=dbSNP_129:rs20095617;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041520.1	dbSNP	SNV	2859	2859	.	+	.	ID=1119;Variant_seq=T;Dbxref=dbSNP_129:rs20095637;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041520.1	dbSNP	SNV	2923	2923	.	+	.	ID=1120;Variant_seq=A;Dbxref=dbSNP_129:rs20095677;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041520.1	dbSNP	SNV	2987	2987	.	+	.	ID=1121;Variant_seq=G;Dbxref=dbSNP_129:rs20095767;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041520.1	dbSNP	SNV	2996	2996	.	+	.	ID=1122;Variant_seq=T;Dbxref=dbSNP_129:rs20095787;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041520.1	dbSNP	SNV	3009	3009	.	+	.	ID=1123;Variant_seq=G;Dbxref=dbSNP_129:rs20095797;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041520.1	dbSNP	SNV	3032	3032	.	+	.	ID=1124;Variant_seq=A;Dbxref=dbSNP_129:rs20095857;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041520.1	dbSNP	SNV	3033	3033	.	+	.	ID=1125;Variant_seq=C;Dbxref=dbSNP_129:rs20095867;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040298.1	dbSNP	SNV	3239	3239	.	+	.	ID=1126;Variant_seq=A;Dbxref=dbSNP_129:rs53513178;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040298.1	dbSNP	SNV	3240	3240	.	+	.	ID=1127;Variant_seq=G;Dbxref=dbSNP_129:rs54187175;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040298.1	dbSNP	SNV	3378	3378	.	+	.	ID=1128;Variant_seq=A;Dbxref=dbSNP_129:rs53072732;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040298.1	dbSNP	SNV	4809	4809	.	+	.	ID=1129;Variant_seq=C;Dbxref=dbSNP_129:rs19491485;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398990.1	dbSNP	SNV	301	301	.	+	.	ID=1130;Variant_seq=A;Dbxref=dbSNP_129:rs21363966;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398990.1	dbSNP	SNV	845	845	.	+	.	ID=1131;Variant_seq=G;Dbxref=dbSNP_129:rs21363936;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398990.1	dbSNP	SNV	1679	1679	.	+	.	ID=1132;Variant_seq=A;Dbxref=dbSNP_129:rs21362997;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398990.1	dbSNP	SNV	1924	1924	.	+	.	ID=1133;Variant_seq=T;Dbxref=dbSNP_129:rs21362957;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398990.1	dbSNP	SNV	2234	2234	.	+	.	ID=1134;Variant_seq=T;Dbxref=dbSNP_129:rs21362907;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398990.1	dbSNP	SNV	2350	2350	.	+	.	ID=1135;Variant_seq=G;Dbxref=dbSNP_129:rs21362867;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398990.1	dbSNP	SNV	2974	2974	.	+	.	ID=1136;Variant_seq=G;Dbxref=dbSNP_129:rs53100304;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398990.1	dbSNP	SNV	2994	2994	.	+	.	ID=1137;Variant_seq=T;Dbxref=dbSNP_129:rs53047805;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398990.1	dbSNP	insertion	2997	2997	.	+	.	ID=1138;Variant_seq=CTG;Dbxref=dbSNP_129:rs53497230;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398990.1	dbSNP	SNV	2998	2998	.	+	.	ID=1139;Variant_seq=G;Dbxref=dbSNP_129:rs53484607;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398990.1	dbSNP	SNV	3001	3001	.	+	.	ID=1140;Variant_seq=A;Dbxref=dbSNP_129:rs53946948;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398990.1	dbSNP	SNV	3007	3007	.	+	.	ID=1141;Variant_seq=T;Dbxref=dbSNP_129:rs53436534;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398990.1	dbSNP	SNV	3040	3040	.	+	.	ID=1142;Variant_seq=G;Dbxref=dbSNP_129:rs53219393;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398990.1	dbSNP	SNV	3075	3075	.	+	.	ID=1143;Variant_seq=G;Dbxref=dbSNP_129:rs54120405;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398990.1	dbSNP	deletion	3078	3078	.	+	.	ID=1144;Variant_seq=-;Dbxref=dbSNP_129:rs54368932;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398990.1	dbSNP	deletion	3085	3086	.	+	.	ID=1145;Variant_seq=-;Dbxref=dbSNP_129:rs52998385;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=GG
CH398990.1	dbSNP	SNV	3092	3092	.	+	.	ID=1146;Variant_seq=T;Dbxref=dbSNP_129:rs53837234;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398990.1	dbSNP	insertion	3099	3099	.	+	.	ID=1147;Variant_seq=G;Dbxref=dbSNP_129:rs54354454;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398990.1	dbSNP	insertion	3125	3125	.	+	.	ID=1148;Variant_seq=CAGGTG;Dbxref=dbSNP_129:rs54246614;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398990.1	dbSNP	insertion	3130	3130	.	+	.	ID=1149;Variant_seq=GGG;Dbxref=dbSNP_129:rs53231654;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398990.1	dbSNP	SNV	3136	3136	.	+	.	ID=1150;Variant_seq=A;Dbxref=dbSNP_129:rs53788027;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398990.1	dbSNP	SNV	3152	3152	.	+	.	ID=1151;Variant_seq=T;Dbxref=dbSNP_129:rs53407405;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398990.1	dbSNP	insertion	3155	3155	.	+	.	ID=1152;Variant_seq=A;Dbxref=dbSNP_129:rs54339959;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398990.1	dbSNP	SNV	3161	3161	.	+	.	ID=1153;Variant_seq=C;Dbxref=dbSNP_129:rs53489755;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398990.1	dbSNP	insertion	3163	3163	.	+	.	ID=1154;Variant_seq=AAGA;Dbxref=dbSNP_129:rs54052606;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398990.1	dbSNP	insertion	3165	3165	.	+	.	ID=1155;Variant_seq=A;Dbxref=dbSNP_129:rs53605023;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398990.1	dbSNP	SNV	3178	3178	.	+	.	ID=1156;Variant_seq=C;Dbxref=dbSNP_129:rs53854150;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398990.1	dbSNP	SNV	3187	3187	.	+	.	ID=1157;Variant_seq=A;Dbxref=dbSNP_129:rs53566347;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398990.1	dbSNP	SNV	3191	3191	.	+	.	ID=1158;Variant_seq=G;Dbxref=dbSNP_129:rs53925121;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398990.1	dbSNP	insertion	3193	3193	.	+	.	ID=1159;Variant_seq=A;Dbxref=dbSNP_129:rs52844655;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398990.1	dbSNP	SNV	3199	3199	.	+	.	ID=1160;Variant_seq=C;Dbxref=dbSNP_129:rs21362817;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398990.1	dbSNP	SNV	3294	3294	.	+	.	ID=1161;Variant_seq=C;Dbxref=dbSNP_129:rs54306866;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398990.1	dbSNP	insertion	3302	3302	.	+	.	ID=1162;Variant_seq=AGCAAT;Dbxref=dbSNP_129:rs53166440;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398990.1	dbSNP	SNV	3336	3336	.	+	.	ID=1163;Variant_seq=G;Dbxref=dbSNP_129:rs52897979;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398990.1	dbSNP	SNV	3337	3337	.	+	.	ID=1164;Variant_seq=A;Dbxref=dbSNP_129:rs53675719;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398990.1	dbSNP	SNV	3338	3338	.	+	.	ID=1165;Variant_seq=A;Dbxref=dbSNP_129:rs53176659;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398990.1	dbSNP	insertion	3338	3338	.	+	.	ID=1166;Variant_seq=A;Dbxref=dbSNP_129:rs53474335;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398990.1	dbSNP	SNV	3375	3375	.	+	.	ID=1167;Variant_seq=C;Dbxref=dbSNP_129:rs54348037;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398990.1	dbSNP	SNV	3377	3377	.	+	.	ID=1168;Variant_seq=A;Dbxref=dbSNP_129:rs52917343;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398990.1	dbSNP	SNV	3393	3393	.	+	.	ID=1169;Variant_seq=G;Dbxref=dbSNP_129:rs54314508;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398990.1	dbSNP	SNV	3396	3396	.	+	.	ID=1170;Variant_seq=T;Dbxref=dbSNP_129:rs53028367;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398990.1	dbSNP	SNV	3415	3415	.	+	.	ID=1171;Variant_seq=C;Dbxref=dbSNP_129:rs53791467;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398990.1	dbSNP	SNV	3419	3419	.	+	.	ID=1172;Variant_seq=T;Dbxref=dbSNP_129:rs54273475;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398990.1	dbSNP	SNV	3443	3443	.	+	.	ID=1173;Variant_seq=C;Dbxref=dbSNP_129:rs53823268;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398990.1	dbSNP	deletion	3450	3450	.	+	.	ID=1174;Variant_seq=-;Dbxref=dbSNP_129:rs52970152;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398990.1	dbSNP	SNV	3458	3458	.	+	.	ID=1175;Variant_seq=C;Dbxref=dbSNP_129:rs53958658;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398990.1	dbSNP	SNV	3496	3496	.	+	.	ID=1176;Variant_seq=A;Dbxref=dbSNP_129:rs54255353;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398990.1	dbSNP	deletion	3497	3497	.	+	.	ID=1177;Variant_seq=-;Dbxref=dbSNP_129:rs54357419;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398990.1	dbSNP	SNV	3501	3501	.	+	.	ID=1178;Variant_seq=G;Dbxref=dbSNP_129:rs54122428;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398990.1	dbSNP	SNV	3746	3746	.	+	.	ID=1179;Variant_seq=T;Dbxref=dbSNP_129:rs52977369;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398990.1	dbSNP	SNV	3760	3760	.	+	.	ID=1180;Variant_seq=C;Dbxref=dbSNP_129:rs53709670;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398990.1	dbSNP	SNV	3820	3820	.	+	.	ID=1181;Variant_seq=T;Dbxref=dbSNP_129:rs21362767;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398990.1	dbSNP	SNV	3825	3825	.	+	.	ID=1182;Variant_seq=C;Dbxref=dbSNP_129:rs53167773;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398990.1	dbSNP	SNV	3863	3863	.	+	.	ID=1183;Variant_seq=C;Dbxref=dbSNP_129:rs54348100;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398990.1	dbSNP	SNV	3913	3913	.	+	.	ID=1184;Variant_seq=T;Dbxref=dbSNP_129:rs21362757;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398990.1	dbSNP	SNV	4394	4394	.	+	.	ID=1185;Variant_seq=T;Dbxref=dbSNP_129:rs53563690;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049939.1	dbSNP	SNV	256	256	.	+	.	ID=1186;Variant_seq=T;Dbxref=dbSNP_129:rs21385117;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049939.1	dbSNP	SNV	320	320	.	+	.	ID=1187;Variant_seq=G;Dbxref=dbSNP_129:rs21385107;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049939.1	dbSNP	SNV	411	411	.	+	.	ID=1188;Variant_seq=C;Dbxref=dbSNP_129:rs21385097;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049939.1	dbSNP	SNV	530	530	.	+	.	ID=1189;Variant_seq=T;Dbxref=dbSNP_129:rs21385077;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049939.1	dbSNP	SNV	557	557	.	+	.	ID=1190;Variant_seq=T;Dbxref=dbSNP_129:rs21385057;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049939.1	dbSNP	SNV	567	567	.	+	.	ID=1191;Variant_seq=G;Dbxref=dbSNP_129:rs21385047;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049939.1	dbSNP	SNV	620	620	.	+	.	ID=1192;Variant_seq=G;Dbxref=dbSNP_129:rs21385037;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049939.1	dbSNP	SNV	673	673	.	+	.	ID=1193;Variant_seq=C;Dbxref=dbSNP_129:rs21385027;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049939.1	dbSNP	SNV	1048	1048	.	+	.	ID=1194;Variant_seq=T;Dbxref=dbSNP_129:rs21384997;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049939.1	dbSNP	SNV	1099	1099	.	+	.	ID=1195;Variant_seq=A;Dbxref=dbSNP_129:rs21384987;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049939.1	dbSNP	SNV	1156	1156	.	+	.	ID=1196;Variant_seq=G;Dbxref=dbSNP_129:rs21384977;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049939.1	dbSNP	SNV	1270	1270	.	+	.	ID=1197;Variant_seq=A;Dbxref=dbSNP_129:rs21384957;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049939.1	dbSNP	SNV	1433	1433	.	+	.	ID=1198;Variant_seq=C;Dbxref=dbSNP_129:rs21384947;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049939.1	dbSNP	SNV	1539	1539	.	+	.	ID=1199;Variant_seq=G;Dbxref=dbSNP_129:rs21384937;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049939.1	dbSNP	SNV	1622	1622	.	+	.	ID=1200;Variant_seq=A;Dbxref=dbSNP_129:rs21384927;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049939.1	dbSNP	SNV	1766	1766	.	+	.	ID=1201;Variant_seq=C;Dbxref=dbSNP_129:rs21384907;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049939.1	dbSNP	SNV	1772	1772	.	+	.	ID=1202;Variant_seq=G;Dbxref=dbSNP_129:rs21384897;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049939.1	dbSNP	SNV	1801	1801	.	+	.	ID=1203;Variant_seq=G;Dbxref=dbSNP_129:rs21384887;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049939.1	dbSNP	SNV	1949	1949	.	+	.	ID=1204;Variant_seq=A;Dbxref=dbSNP_129:rs21384867;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399427.1	dbSNP	SNV	5485	5485	.	+	.	ID=1205;Variant_seq=T;Dbxref=dbSNP_129:rs53930184;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039378.1	dbSNP	SNV	5473	5473	.	+	.	ID=1206;Variant_seq=C;Dbxref=dbSNP_129:rs18294023;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039378.1	dbSNP	SNV	5485	5485	.	+	.	ID=1207;Variant_seq=G;Dbxref=dbSNP_129:rs18293978;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039378.1	dbSNP	SNV	5537	5537	.	+	.	ID=1208;Variant_seq=A;Dbxref=dbSNP_129:rs18293852;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043122.1	dbSNP	SNV	2411	2411	.	+	.	ID=1209;Variant_seq=C;Dbxref=dbSNP_129:rs54172544;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043122.1	dbSNP	SNV	2417	2417	.	+	.	ID=1210;Variant_seq=A;Dbxref=dbSNP_129:rs54395301;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043122.1	dbSNP	SNV	2452	2452	.	+	.	ID=1211;Variant_seq=C;Dbxref=dbSNP_129:rs53597612;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043122.1	dbSNP	SNV	2800	2800	.	+	.	ID=1212;Variant_seq=C;Dbxref=dbSNP_129:rs52937177;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400198.1	dbSNP	SNV	251	251	.	+	.	ID=1213;Variant_seq=A;Dbxref=dbSNP_129:rs21089535;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400198.1	dbSNP	SNV	253	253	.	+	.	ID=1214;Variant_seq=A;Dbxref=dbSNP_129:rs21089545;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399099.1	dbSNP	SNV	761	761	.	+	.	ID=1215;Variant_seq=G;Dbxref=dbSNP_129:rs52841214;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399099.1	dbSNP	SNV	764	764	.	+	.	ID=1216;Variant_seq=C;Dbxref=dbSNP_129:rs20155828;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399099.1	dbSNP	SNV	765	765	.	+	.	ID=1217;Variant_seq=C;Dbxref=dbSNP_129:rs20155838;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399099.1	dbSNP	SNV	770	770	.	+	.	ID=1218;Variant_seq=C;Dbxref=dbSNP_129:rs20155868;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399099.1	dbSNP	SNV	803	803	.	+	.	ID=1219;Variant_seq=A;Dbxref=dbSNP_129:rs54381953;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399099.1	dbSNP	SNV	2336	2336	.	+	.	ID=1220;Variant_seq=A;Dbxref=dbSNP_129:rs53786918;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399099.1	dbSNP	SNV	2352	2352	.	+	.	ID=1221;Variant_seq=A;Dbxref=dbSNP_129:rs52955242;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399099.1	dbSNP	SNV	2428	2428	.	+	.	ID=1222;Variant_seq=G;Dbxref=dbSNP_129:rs54090051;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040818.1	dbSNP	SNV	3730	3730	.	+	.	ID=1223;Variant_seq=T;Dbxref=dbSNP_129:rs52952103;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043377.1	dbSNP	insertion	1679	1679	.	+	.	ID=1224;Variant_seq=AGCCGCCCTC;Dbxref=dbSNP_129:rs54055965;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02043377.1	dbSNP	SNV	1701	1701	.	+	.	ID=1225;Variant_seq=A;Dbxref=dbSNP_129:rs53441342;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043377.1	dbSNP	SNV	1707	1707	.	+	.	ID=1226;Variant_seq=A;Dbxref=dbSNP_129:rs52858220;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043377.1	dbSNP	SNV	1724	1724	.	+	.	ID=1227;Variant_seq=T;Dbxref=dbSNP_129:rs53466500;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043377.1	dbSNP	SNV	1735	1735	.	+	.	ID=1228;Variant_seq=T;Dbxref=dbSNP_129:rs53193762;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043377.1	dbSNP	SNV	1741	1741	.	+	.	ID=1229;Variant_seq=A;Dbxref=dbSNP_129:rs53996702;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043377.1	dbSNP	SNV	1789	1789	.	+	.	ID=1230;Variant_seq=C;Dbxref=dbSNP_129:rs53256716;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043377.1	dbSNP	SNV	1805	1805	.	+	.	ID=1231;Variant_seq=T;Dbxref=dbSNP_129:rs52861814;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043377.1	dbSNP	deletion	1809	1809	.	+	.	ID=1232;Variant_seq=-;Dbxref=dbSNP_129:rs54412213;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043377.1	dbSNP	deletion	1814	1824	.	+	.	ID=1233;Variant_seq=-;Dbxref=dbSNP_129:rs54041237;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=ACCGCCGCCTC
AAAA02043377.1	dbSNP	SNV	1840	1840	.	+	.	ID=1234;Variant_seq=T;Dbxref=dbSNP_129:rs53847718;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043377.1	dbSNP	SNV	1856	1856	.	+	.	ID=1235;Variant_seq=T;Dbxref=dbSNP_129:rs53043987;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043377.1	dbSNP	SNV	2849	2849	.	+	.	ID=1236;Variant_seq=T;Dbxref=dbSNP_129:rs20422748;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043377.1	dbSNP	SNV	3447	3447	.	+	.	ID=1237;Variant_seq=A;Dbxref=dbSNP_129:rs20422678;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	850	850	.	+	.	ID=1238;Variant_seq=T;Dbxref=dbSNP_129:rs21566874;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	874	874	.	+	.	ID=1239;Variant_seq=G;Dbxref=dbSNP_129:rs21566894;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	877	877	.	+	.	ID=1240;Variant_seq=G;Dbxref=dbSNP_129:rs21566904;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	886	886	.	+	.	ID=1241;Variant_seq=C;Dbxref=dbSNP_129:rs21566924;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	888	888	.	+	.	ID=1242;Variant_seq=T;Dbxref=dbSNP_129:rs21566934;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	890	890	.	+	.	ID=1243;Variant_seq=A;Dbxref=dbSNP_129:rs21566944;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	896	896	.	+	.	ID=1244;Variant_seq=T;Dbxref=dbSNP_129:rs21566954;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	916	916	.	+	.	ID=1245;Variant_seq=C;Dbxref=dbSNP_129:rs21566964;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	922	922	.	+	.	ID=1246;Variant_seq=G;Dbxref=dbSNP_129:rs21566984;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	945	945	.	+	.	ID=1247;Variant_seq=A;Dbxref=dbSNP_129:rs21567004;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	946	946	.	+	.	ID=1248;Variant_seq=C;Dbxref=dbSNP_129:rs21567014;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	949	949	.	+	.	ID=1249;Variant_seq=T;Dbxref=dbSNP_129:rs21567024;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	964	964	.	+	.	ID=1250;Variant_seq=T;Dbxref=dbSNP_129:rs21567044;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	976	976	.	+	.	ID=1251;Variant_seq=T;Dbxref=dbSNP_129:rs21567064;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	997	997	.	+	.	ID=1252;Variant_seq=A;Dbxref=dbSNP_129:rs21567084;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1010	1010	.	+	.	ID=1253;Variant_seq=C;Dbxref=dbSNP_129:rs21567094;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1112	1112	.	+	.	ID=1254;Variant_seq=A;Dbxref=dbSNP_129:rs21567194;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1127	1127	.	+	.	ID=1255;Variant_seq=T;Dbxref=dbSNP_129:rs21567204;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1136	1136	.	+	.	ID=1256;Variant_seq=A;Dbxref=dbSNP_129:rs21567224;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1137	1137	.	+	.	ID=1257;Variant_seq=A;Dbxref=dbSNP_129:rs53992252;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1139	1139	.	+	.	ID=1258;Variant_seq=A;Dbxref=dbSNP_129:rs54172254;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1139	1139	.	+	.	ID=1259;Variant_seq=T;Dbxref=dbSNP_129:rs21567234;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1140	1140	.	+	.	ID=1260;Variant_seq=G;Dbxref=dbSNP_129:rs21567244;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	1140	1140	.	+	.	ID=1261;Variant_seq=G;Dbxref=dbSNP_129:rs52909628;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	1148	1148	.	+	.	ID=1262;Variant_seq=C;Dbxref=dbSNP_129:rs21567254;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1158	1158	.	+	.	ID=1263;Variant_seq=A;Dbxref=dbSNP_129:rs53383306;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1161	1161	.	+	.	ID=1264;Variant_seq=T;Dbxref=dbSNP_129:rs53290346;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1175	1175	.	+	.	ID=1265;Variant_seq=A;Dbxref=dbSNP_129:rs21567274;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1178	1178	.	+	.	ID=1266;Variant_seq=T;Dbxref=dbSNP_129:rs21567284;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	1217	1217	.	+	.	ID=1267;Variant_seq=A;Dbxref=dbSNP_129:rs21567314;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1222	1222	.	+	.	ID=1268;Variant_seq=G;Dbxref=dbSNP_129:rs21567324;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1238	1238	.	+	.	ID=1269;Variant_seq=C;Dbxref=dbSNP_129:rs21567344;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1259	1259	.	+	.	ID=1270;Variant_seq=C;Dbxref=dbSNP_129:rs21567354;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1262	1262	.	+	.	ID=1271;Variant_seq=C;Dbxref=dbSNP_129:rs21567364;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1284	1284	.	+	.	ID=1272;Variant_seq=A;Dbxref=dbSNP_129:rs21567394;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1294	1294	.	+	.	ID=1273;Variant_seq=T;Dbxref=dbSNP_129:rs21567414;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1307	1307	.	+	.	ID=1274;Variant_seq=C;Dbxref=dbSNP_129:rs21567424;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1308	1308	.	+	.	ID=1275;Variant_seq=A;Dbxref=dbSNP_129:rs21567434;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1310	1310	.	+	.	ID=1276;Variant_seq=A;Dbxref=dbSNP_129:rs21567444;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1319	1319	.	+	.	ID=1277;Variant_seq=A;Dbxref=dbSNP_129:rs21567454;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1348	1348	.	+	.	ID=1278;Variant_seq=A;Dbxref=dbSNP_129:rs21567464;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1357	1357	.	+	.	ID=1279;Variant_seq=T;Dbxref=dbSNP_129:rs21567484;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1364	1364	.	+	.	ID=1280;Variant_seq=C;Dbxref=dbSNP_129:rs21567494;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1367	1367	.	+	.	ID=1281;Variant_seq=G;Dbxref=dbSNP_129:rs21567504;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	1370	1370	.	+	.	ID=1282;Variant_seq=T;Dbxref=dbSNP_129:rs21567514;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	1379	1379	.	+	.	ID=1283;Variant_seq=C;Dbxref=dbSNP_129:rs21567524;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1381	1381	.	+	.	ID=1284;Variant_seq=A;Dbxref=dbSNP_129:rs21567534;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1382	1382	.	+	.	ID=1285;Variant_seq=C;Dbxref=dbSNP_129:rs21567544;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	1388	1388	.	+	.	ID=1286;Variant_seq=G;Dbxref=dbSNP_129:rs21567554;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	1407	1407	.	+	.	ID=1287;Variant_seq=T;Dbxref=dbSNP_129:rs21567564;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	1412	1412	.	+	.	ID=1288;Variant_seq=G;Dbxref=dbSNP_129:rs21567574;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	1418	1418	.	+	.	ID=1289;Variant_seq=T;Dbxref=dbSNP_129:rs21567584;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1517	1517	.	+	.	ID=1290;Variant_seq=T;Dbxref=dbSNP_129:rs21567664;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1521	1521	.	+	.	ID=1291;Variant_seq=A;Dbxref=dbSNP_129:rs21567674;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1525	1525	.	+	.	ID=1292;Variant_seq=C;Dbxref=dbSNP_129:rs21567684;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1526	1526	.	+	.	ID=1293;Variant_seq=A;Dbxref=dbSNP_129:rs21567694;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1564	1564	.	+	.	ID=1294;Variant_seq=A;Dbxref=dbSNP_129:rs21567714;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1568	1568	.	+	.	ID=1295;Variant_seq=C;Dbxref=dbSNP_129:rs21567724;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1610	1610	.	+	.	ID=1296;Variant_seq=T;Dbxref=dbSNP_129:rs21567744;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	1631	1631	.	+	.	ID=1297;Variant_seq=A;Dbxref=dbSNP_129:rs21567764;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1640	1640	.	+	.	ID=1298;Variant_seq=G;Dbxref=dbSNP_129:rs21567784;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1649	1649	.	+	.	ID=1299;Variant_seq=T;Dbxref=dbSNP_129:rs21567794;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1687	1687	.	+	.	ID=1300;Variant_seq=T;Dbxref=dbSNP_129:rs21567834;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1690	1690	.	+	.	ID=1301;Variant_seq=G;Dbxref=dbSNP_129:rs21567844;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	1705	1705	.	+	.	ID=1302;Variant_seq=C;Dbxref=dbSNP_129:rs21567854;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1716	1716	.	+	.	ID=1303;Variant_seq=C;Dbxref=dbSNP_129:rs21567864;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	1717	1717	.	+	.	ID=1304;Variant_seq=C;Dbxref=dbSNP_129:rs21567874;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	1718	1718	.	+	.	ID=1305;Variant_seq=T;Dbxref=dbSNP_129:rs21567884;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1720	1720	.	+	.	ID=1306;Variant_seq=G;Dbxref=dbSNP_129:rs21567894;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	1723	1723	.	+	.	ID=1307;Variant_seq=T;Dbxref=dbSNP_129:rs21567904;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1732	1732	.	+	.	ID=1308;Variant_seq=A;Dbxref=dbSNP_129:rs21567914;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1742	1742	.	+	.	ID=1309;Variant_seq=C;Dbxref=dbSNP_129:rs21567934;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1750	1750	.	+	.	ID=1310;Variant_seq=T;Dbxref=dbSNP_129:rs21567944;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1776	1776	.	+	.	ID=1311;Variant_seq=A;Dbxref=dbSNP_129:rs21567954;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1795	1795	.	+	.	ID=1312;Variant_seq=T;Dbxref=dbSNP_129:rs21567974;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1804	1804	.	+	.	ID=1313;Variant_seq=C;Dbxref=dbSNP_129:rs21567984;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1813	1813	.	+	.	ID=1314;Variant_seq=T;Dbxref=dbSNP_129:rs21567994;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1858	1858	.	+	.	ID=1315;Variant_seq=T;Dbxref=dbSNP_129:rs21568046;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1872	1872	.	+	.	ID=1316;Variant_seq=A;Dbxref=dbSNP_129:rs21568056;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1882	1882	.	+	.	ID=1317;Variant_seq=G;Dbxref=dbSNP_129:rs21568066;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	1895	1895	.	+	.	ID=1318;Variant_seq=A;Dbxref=dbSNP_129:rs21568086;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1904	1904	.	+	.	ID=1319;Variant_seq=G;Dbxref=dbSNP_129:rs21568096;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	1906	1906	.	+	.	ID=1320;Variant_seq=T;Dbxref=dbSNP_129:rs21568106;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1911	1911	.	+	.	ID=1321;Variant_seq=C;Dbxref=dbSNP_129:rs21568116;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1920	1920	.	+	.	ID=1322;Variant_seq=C;Dbxref=dbSNP_129:rs21568136;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1930	1930	.	+	.	ID=1323;Variant_seq=G;Dbxref=dbSNP_129:rs21568146;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	1954	1954	.	+	.	ID=1324;Variant_seq=C;Dbxref=dbSNP_129:rs21568166;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	1963	1963	.	+	.	ID=1325;Variant_seq=G;Dbxref=dbSNP_129:rs21568176;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	1984	1984	.	+	.	ID=1326;Variant_seq=A;Dbxref=dbSNP_129:rs21568206;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	1986	1986	.	+	.	ID=1327;Variant_seq=T;Dbxref=dbSNP_129:rs21568216;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	2002	2002	.	+	.	ID=1328;Variant_seq=G;Dbxref=dbSNP_129:rs21568236;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	2026	2026	.	+	.	ID=1329;Variant_seq=T;Dbxref=dbSNP_129:rs21568246;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	2029	2029	.	+	.	ID=1330;Variant_seq=C;Dbxref=dbSNP_129:rs21568256;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	2036	2036	.	+	.	ID=1331;Variant_seq=A;Dbxref=dbSNP_129:rs21568266;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	2055	2055	.	+	.	ID=1332;Variant_seq=A;Dbxref=dbSNP_129:rs21568286;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	2089	2089	.	+	.	ID=1333;Variant_seq=G;Dbxref=dbSNP_129:rs21568306;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	2097	2097	.	+	.	ID=1334;Variant_seq=A;Dbxref=dbSNP_129:rs21568316;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	2104	2104	.	+	.	ID=1335;Variant_seq=T;Dbxref=dbSNP_129:rs21568326;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	2116	2116	.	+	.	ID=1336;Variant_seq=A;Dbxref=dbSNP_129:rs21568336;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	2122	2122	.	+	.	ID=1337;Variant_seq=C;Dbxref=dbSNP_129:rs21568356;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	2170	2170	.	+	.	ID=1338;Variant_seq=T;Dbxref=dbSNP_129:rs21568376;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	2174	2174	.	+	.	ID=1339;Variant_seq=C;Dbxref=dbSNP_129:rs21568386;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	2182	2182	.	+	.	ID=1340;Variant_seq=G;Dbxref=dbSNP_129:rs21568396;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	2207	2207	.	+	.	ID=1341;Variant_seq=C;Dbxref=dbSNP_129:rs21568416;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	2208	2208	.	+	.	ID=1342;Variant_seq=A;Dbxref=dbSNP_129:rs21568426;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	2212	2212	.	+	.	ID=1343;Variant_seq=C;Dbxref=dbSNP_129:rs21568436;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	2218	2218	.	+	.	ID=1344;Variant_seq=G;Dbxref=dbSNP_129:rs21568446;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	2221	2221	.	+	.	ID=1345;Variant_seq=T;Dbxref=dbSNP_129:rs21568456;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	2222	2222	.	+	.	ID=1346;Variant_seq=T;Dbxref=dbSNP_129:rs21568466;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	2233	2233	.	+	.	ID=1347;Variant_seq=G;Dbxref=dbSNP_129:rs21568476;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	2252	2252	.	+	.	ID=1348;Variant_seq=G;Dbxref=dbSNP_129:rs21568486;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	2260	2260	.	+	.	ID=1349;Variant_seq=G;Dbxref=dbSNP_129:rs21568496;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	2270	2270	.	+	.	ID=1350;Variant_seq=T;Dbxref=dbSNP_129:rs21568506;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	2271	2271	.	+	.	ID=1351;Variant_seq=G;Dbxref=dbSNP_129:rs21568516;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	2284	2284	.	+	.	ID=1352;Variant_seq=T;Dbxref=dbSNP_129:rs21568536;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	2295	2295	.	+	.	ID=1353;Variant_seq=C;Dbxref=dbSNP_129:rs21568546;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	2296	2296	.	+	.	ID=1354;Variant_seq=C;Dbxref=dbSNP_129:rs21568556;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	2302	2302	.	+	.	ID=1355;Variant_seq=C;Dbxref=dbSNP_129:rs21568566;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047696.1	dbSNP	SNV	2303	2303	.	+	.	ID=1356;Variant_seq=G;Dbxref=dbSNP_129:rs21568576;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	2308	2308	.	+	.	ID=1357;Variant_seq=T;Dbxref=dbSNP_129:rs21568586;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	2326	2326	.	+	.	ID=1358;Variant_seq=T;Dbxref=dbSNP_129:rs21568606;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047696.1	dbSNP	SNV	2335	2335	.	+	.	ID=1359;Variant_seq=T;Dbxref=dbSNP_129:rs21568616;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	2341	2341	.	+	.	ID=1360;Variant_seq=G;Dbxref=dbSNP_129:rs21568626;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047696.1	dbSNP	SNV	2356	2356	.	+	.	ID=1361;Variant_seq=T;Dbxref=dbSNP_129:rs21568636;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047696.1	dbSNP	SNV	2365	2365	.	+	.	ID=1362;Variant_seq=T;Dbxref=dbSNP_129:rs21568646;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045564.1	dbSNP	SNV	120	120	.	+	.	ID=1363;Variant_seq=G;Dbxref=dbSNP_129:rs53906640;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045564.1	dbSNP	SNV	124	124	.	+	.	ID=1364;Variant_seq=C;Dbxref=dbSNP_129:rs53418061;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045564.1	dbSNP	SNV	141	141	.	+	.	ID=1365;Variant_seq=T;Dbxref=dbSNP_129:rs53214379;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045564.1	dbSNP	SNV	142	142	.	+	.	ID=1366;Variant_seq=G;Dbxref=dbSNP_129:rs54043884;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045564.1	dbSNP	SNV	144	144	.	+	.	ID=1367;Variant_seq=T;Dbxref=dbSNP_129:rs53789735;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045564.1	dbSNP	SNV	158	158	.	+	.	ID=1368;Variant_seq=G;Dbxref=dbSNP_129:rs53456327;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045564.1	dbSNP	deletion	1067	1069	.	+	.	ID=1369;Variant_seq=-;Dbxref=dbSNP_129:rs54123280;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=GTC
AAAA02045564.1	dbSNP	SNV	2777	2777	.	+	.	ID=1370;Variant_seq=T;Dbxref=dbSNP_129:rs53011208;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045564.1	dbSNP	SNV	2786	2786	.	+	.	ID=1371;Variant_seq=G;Dbxref=dbSNP_129:rs52901187;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045564.1	dbSNP	SNV	2787	2787	.	+	.	ID=1372;Variant_seq=A;Dbxref=dbSNP_129:rs53328363;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045564.1	dbSNP	SNV	2790	2790	.	+	.	ID=1373;Variant_seq=C;Dbxref=dbSNP_129:rs53152229;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045564.1	dbSNP	SNV	2797	2797	.	+	.	ID=1374;Variant_seq=C;Dbxref=dbSNP_129:rs53730665;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045564.1	dbSNP	SNV	2810	2810	.	+	.	ID=1375;Variant_seq=C;Dbxref=dbSNP_129:rs53177627;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048357.1	dbSNP	SNV	729	729	.	+	.	ID=1376;Variant_seq=A;Dbxref=dbSNP_129:rs19984993;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048357.1	dbSNP	SNV	1168	1168	.	+	.	ID=1377;Variant_seq=A;Dbxref=dbSNP_129:rs19984943;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048357.1	dbSNP	SNV	1244	1244	.	+	.	ID=1378;Variant_seq=A;Dbxref=dbSNP_129:rs19984933;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048357.1	dbSNP	SNV	1293	1293	.	+	.	ID=1379;Variant_seq=A;Dbxref=dbSNP_129:rs19984923;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048357.1	dbSNP	SNV	1654	1654	.	+	.	ID=1380;Variant_seq=T;Dbxref=dbSNP_129:rs19984860;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048357.1	dbSNP	SNV	1743	1743	.	+	.	ID=1381;Variant_seq=G;Dbxref=dbSNP_129:rs19984850;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048357.1	dbSNP	SNV	1775	1775	.	+	.	ID=1382;Variant_seq=C;Dbxref=dbSNP_129:rs19984840;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048357.1	dbSNP	SNV	1781	1781	.	+	.	ID=1383;Variant_seq=T;Dbxref=dbSNP_129:rs19984830;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048357.1	dbSNP	SNV	1852	1852	.	+	.	ID=1384;Variant_seq=T;Dbxref=dbSNP_129:rs19984810;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047543.1	dbSNP	SNV	1156	1156	.	+	.	ID=1385;Variant_seq=T;Dbxref=dbSNP_129:rs53552536;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047543.1	dbSNP	SNV	1820	1820	.	+	.	ID=1386;Variant_seq=A;Dbxref=dbSNP_129:rs54052943;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047543.1	dbSNP	SNV	1836	1836	.	+	.	ID=1387;Variant_seq=T;Dbxref=dbSNP_129:rs54382669;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047543.1	dbSNP	SNV	1920	1920	.	+	.	ID=1388;Variant_seq=A;Dbxref=dbSNP_129:rs54350424;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047543.1	dbSNP	SNV	1936	1936	.	+	.	ID=1389;Variant_seq=G;Dbxref=dbSNP_129:rs52999539;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047543.1	dbSNP	SNV	1954	1954	.	+	.	ID=1390;Variant_seq=A;Dbxref=dbSNP_129:rs53661755;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047543.1	dbSNP	SNV	1956	1956	.	+	.	ID=1391;Variant_seq=C;Dbxref=dbSNP_129:rs53696618;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398784.1	dbSNP	SNV	61	61	.	+	.	ID=1392;Variant_seq=C;Dbxref=dbSNP_129:rs20766873;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398784.1	dbSNP	SNV	75	75	.	+	.	ID=1393;Variant_seq=A;Dbxref=dbSNP_129:rs20766883;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398784.1	dbSNP	SNV	119	119	.	+	.	ID=1394;Variant_seq=A;Dbxref=dbSNP_129:rs20766913;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398784.1	dbSNP	SNV	145	145	.	+	.	ID=1395;Variant_seq=A;Dbxref=dbSNP_129:rs20766923;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398784.1	dbSNP	SNV	957	957	.	+	.	ID=1396;Variant_seq=A;Dbxref=dbSNP_129:rs20766963;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398784.1	dbSNP	SNV	958	958	.	+	.	ID=1397;Variant_seq=G;Dbxref=dbSNP_129:rs20766973;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398784.1	dbSNP	SNV	959	959	.	+	.	ID=1398;Variant_seq=G;Dbxref=dbSNP_129:rs20766983;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398784.1	dbSNP	SNV	960	960	.	+	.	ID=1399;Variant_seq=A;Dbxref=dbSNP_129:rs20766993;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398784.1	dbSNP	SNV	962	962	.	+	.	ID=1400;Variant_seq=T;Dbxref=dbSNP_129:rs20767003;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398784.1	dbSNP	SNV	969	969	.	+	.	ID=1401;Variant_seq=T;Dbxref=dbSNP_129:rs20767023;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398784.1	dbSNP	SNV	971	971	.	+	.	ID=1402;Variant_seq=A;Dbxref=dbSNP_129:rs20767033;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398784.1	dbSNP	SNV	975	975	.	+	.	ID=1403;Variant_seq=T;Dbxref=dbSNP_129:rs20767043;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398784.1	dbSNP	SNV	1919	1919	.	+	.	ID=1404;Variant_seq=C;Dbxref=dbSNP_129:rs20767283;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398784.1	dbSNP	SNV	2988	2988	.	+	.	ID=1405;Variant_seq=A;Dbxref=dbSNP_129:rs18751587;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398784.1	dbSNP	SNV	5332	5332	.	+	.	ID=1406;Variant_seq=T;Dbxref=dbSNP_129:rs20429571;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049211.1	dbSNP	SNV	288	288	.	+	.	ID=1407;Variant_seq=C;Dbxref=dbSNP_129:rs19432273;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049211.1	dbSNP	SNV	300	300	.	+	.	ID=1408;Variant_seq=A;Dbxref=dbSNP_129:rs19432293;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046309.1	dbSNP	SNV	1457	1457	.	+	.	ID=1409;Variant_seq=T;Dbxref=dbSNP_129:rs53327976;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046309.1	dbSNP	SNV	1592	1592	.	+	.	ID=1410;Variant_seq=A;Dbxref=dbSNP_129:rs53005027;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046309.1	dbSNP	SNV	2127	2127	.	+	.	ID=1411;Variant_seq=A;Dbxref=dbSNP_129:rs54206778;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	84	84	.	+	.	ID=1412;Variant_seq=A;Dbxref=dbSNP_129:rs18186449;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	614	614	.	+	.	ID=1413;Variant_seq=G;Dbxref=dbSNP_129:rs18186377;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	622	622	.	+	.	ID=1414;Variant_seq=G;Dbxref=dbSNP_129:rs18186359;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	625	625	.	+	.	ID=1415;Variant_seq=G;Dbxref=dbSNP_129:rs18186350;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	627	627	.	+	.	ID=1416;Variant_seq=T;Dbxref=dbSNP_129:rs18186341;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	628	628	.	+	.	ID=1417;Variant_seq=A;Dbxref=dbSNP_129:rs18186332;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	634	634	.	+	.	ID=1418;Variant_seq=C;Dbxref=dbSNP_129:rs18186323;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	639	639	.	+	.	ID=1419;Variant_seq=C;Dbxref=dbSNP_129:rs18186314;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	640	640	.	+	.	ID=1420;Variant_seq=T;Dbxref=dbSNP_129:rs18186305;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	644	644	.	+	.	ID=1421;Variant_seq=G;Dbxref=dbSNP_129:rs18186296;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	649	649	.	+	.	ID=1422;Variant_seq=A;Dbxref=dbSNP_129:rs18186269;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	655	655	.	+	.	ID=1423;Variant_seq=T;Dbxref=dbSNP_129:rs18186260;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	657	657	.	+	.	ID=1424;Variant_seq=G;Dbxref=dbSNP_129:rs18186251;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	660	660	.	+	.	ID=1425;Variant_seq=G;Dbxref=dbSNP_129:rs18186242;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	662	662	.	+	.	ID=1426;Variant_seq=C;Dbxref=dbSNP_129:rs18186233;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	663	663	.	+	.	ID=1427;Variant_seq=C;Dbxref=dbSNP_129:rs18186224;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	664	664	.	+	.	ID=1428;Variant_seq=G;Dbxref=dbSNP_129:rs18186215;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	666	666	.	+	.	ID=1429;Variant_seq=T;Dbxref=dbSNP_129:rs53505962;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	667	667	.	+	.	ID=1430;Variant_seq=T;Dbxref=dbSNP_129:rs53477664;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	669	669	.	+	.	ID=1431;Variant_seq=G;Dbxref=dbSNP_129:rs18186206;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	687	687	.	+	.	ID=1432;Variant_seq=C;Dbxref=dbSNP_129:rs18186188;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	688	688	.	+	.	ID=1433;Variant_seq=C;Dbxref=dbSNP_129:rs18186179;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	693	693	.	+	.	ID=1434;Variant_seq=C;Dbxref=dbSNP_129:rs18186161;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	696	696	.	+	.	ID=1435;Variant_seq=A;Dbxref=dbSNP_129:rs18186152;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	706	706	.	+	.	ID=1436;Variant_seq=T;Dbxref=dbSNP_129:rs18186125;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	863	863	.	+	.	ID=1437;Variant_seq=C;Dbxref=dbSNP_129:rs18185394;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	920	920	.	+	.	ID=1438;Variant_seq=A;Dbxref=dbSNP_129:rs18185250;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	922	922	.	+	.	ID=1439;Variant_seq=G;Dbxref=dbSNP_129:rs18185241;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	925	925	.	+	.	ID=1440;Variant_seq=T;Dbxref=dbSNP_129:rs18185214;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	932	932	.	+	.	ID=1441;Variant_seq=C;Dbxref=dbSNP_129:rs18185205;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	940	940	.	+	.	ID=1442;Variant_seq=G;Dbxref=dbSNP_129:rs18185196;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	944	944	.	+	.	ID=1443;Variant_seq=A;Dbxref=dbSNP_129:rs18185178;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	945	945	.	+	.	ID=1444;Variant_seq=C;Dbxref=dbSNP_129:rs18185169;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	951	951	.	+	.	ID=1445;Variant_seq=G;Dbxref=dbSNP_129:rs18185142;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	952	952	.	+	.	ID=1446;Variant_seq=T;Dbxref=dbSNP_129:rs18185133;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	957	957	.	+	.	ID=1447;Variant_seq=A;Dbxref=dbSNP_129:rs18185115;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	962	962	.	+	.	ID=1448;Variant_seq=G;Dbxref=dbSNP_129:rs18185106;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	974	974	.	+	.	ID=1449;Variant_seq=C;Dbxref=dbSNP_129:rs18185070;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	975	975	.	+	.	ID=1450;Variant_seq=C;Dbxref=dbSNP_129:rs18185061;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	976	976	.	+	.	ID=1451;Variant_seq=C;Dbxref=dbSNP_129:rs18185052;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	980	980	.	+	.	ID=1452;Variant_seq=A;Dbxref=dbSNP_129:rs18185025;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	985	985	.	+	.	ID=1453;Variant_seq=G;Dbxref=dbSNP_129:rs18185016;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	986	986	.	+	.	ID=1454;Variant_seq=T;Dbxref=dbSNP_129:rs18185007;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	992	992	.	+	.	ID=1455;Variant_seq=A;Dbxref=dbSNP_129:rs18184989;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	994	994	.	+	.	ID=1456;Variant_seq=T;Dbxref=dbSNP_129:rs18184980;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	998	998	.	+	.	ID=1457;Variant_seq=T;Dbxref=dbSNP_129:rs18184971;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	999	999	.	+	.	ID=1458;Variant_seq=T;Dbxref=dbSNP_129:rs18184962;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1001	1001	.	+	.	ID=1459;Variant_seq=G;Dbxref=dbSNP_129:rs18184953;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1011	1011	.	+	.	ID=1460;Variant_seq=T;Dbxref=dbSNP_129:rs18184944;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1018	1018	.	+	.	ID=1461;Variant_seq=T;Dbxref=dbSNP_129:rs18184935;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1021	1021	.	+	.	ID=1462;Variant_seq=C;Dbxref=dbSNP_129:rs18184917;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1023	1023	.	+	.	ID=1463;Variant_seq=G;Dbxref=dbSNP_129:rs18184908;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1024	1024	.	+	.	ID=1464;Variant_seq=C;Dbxref=dbSNP_129:rs18184899;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1025	1025	.	+	.	ID=1465;Variant_seq=T;Dbxref=dbSNP_129:rs18184890;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1028	1028	.	+	.	ID=1466;Variant_seq=C;Dbxref=dbSNP_129:rs18184881;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1037	1037	.	+	.	ID=1467;Variant_seq=C;Dbxref=dbSNP_129:rs18184863;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1041	1041	.	+	.	ID=1468;Variant_seq=C;Dbxref=dbSNP_129:rs18184845;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1042	1042	.	+	.	ID=1469;Variant_seq=T;Dbxref=dbSNP_129:rs18184836;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1045	1045	.	+	.	ID=1470;Variant_seq=G;Dbxref=dbSNP_129:rs18184827;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1049	1049	.	+	.	ID=1471;Variant_seq=G;Dbxref=dbSNP_129:rs18184818;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1052	1052	.	+	.	ID=1472;Variant_seq=C;Dbxref=dbSNP_129:rs18184809;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1058	1058	.	+	.	ID=1473;Variant_seq=C;Dbxref=dbSNP_129:rs18184791;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1059	1059	.	+	.	ID=1474;Variant_seq=G;Dbxref=dbSNP_129:rs18184782;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1060	1060	.	+	.	ID=1475;Variant_seq=G;Dbxref=dbSNP_129:rs18184773;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1061	1061	.	+	.	ID=1476;Variant_seq=G;Dbxref=dbSNP_129:rs18184764;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1066	1066	.	+	.	ID=1477;Variant_seq=A;Dbxref=dbSNP_129:rs18184755;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1070	1070	.	+	.	ID=1478;Variant_seq=A;Dbxref=dbSNP_129:rs18184746;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1076	1076	.	+	.	ID=1479;Variant_seq=T;Dbxref=dbSNP_129:rs18184737;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1077	1077	.	+	.	ID=1480;Variant_seq=C;Dbxref=dbSNP_129:rs18184728;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1081	1081	.	+	.	ID=1481;Variant_seq=C;Dbxref=dbSNP_129:rs18184719;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1083	1083	.	+	.	ID=1482;Variant_seq=A;Dbxref=dbSNP_129:rs18184710;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1087	1087	.	+	.	ID=1483;Variant_seq=G;Dbxref=dbSNP_129:rs18184701;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1088	1088	.	+	.	ID=1484;Variant_seq=A;Dbxref=dbSNP_129:rs18184692;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1093	1093	.	+	.	ID=1485;Variant_seq=T;Dbxref=dbSNP_129:rs18184674;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1094	1094	.	+	.	ID=1486;Variant_seq=T;Dbxref=dbSNP_129:rs18184665;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1095	1095	.	+	.	ID=1487;Variant_seq=T;Dbxref=dbSNP_129:rs18184656;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1096	1096	.	+	.	ID=1488;Variant_seq=A;Dbxref=dbSNP_129:rs18184647;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1102	1102	.	+	.	ID=1489;Variant_seq=C;Dbxref=dbSNP_129:rs18184629;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1105	1105	.	+	.	ID=1490;Variant_seq=G;Dbxref=dbSNP_129:rs18184611;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1113	1113	.	+	.	ID=1491;Variant_seq=A;Dbxref=dbSNP_129:rs18184593;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1118	1118	.	+	.	ID=1492;Variant_seq=T;Dbxref=dbSNP_129:rs18184584;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1119	1119	.	+	.	ID=1493;Variant_seq=A;Dbxref=dbSNP_129:rs18184575;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1121	1121	.	+	.	ID=1494;Variant_seq=A;Dbxref=dbSNP_129:rs18184566;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1126	1126	.	+	.	ID=1495;Variant_seq=C;Dbxref=dbSNP_129:rs18184557;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1127	1127	.	+	.	ID=1496;Variant_seq=G;Dbxref=dbSNP_129:rs18184548;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1131	1131	.	+	.	ID=1497;Variant_seq=G;Dbxref=dbSNP_129:rs18184539;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1132	1132	.	+	.	ID=1498;Variant_seq=T;Dbxref=dbSNP_129:rs18184530;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1136	1136	.	+	.	ID=1499;Variant_seq=A;Dbxref=dbSNP_129:rs18184521;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1144	1144	.	+	.	ID=1500;Variant_seq=C;Dbxref=dbSNP_129:rs18184512;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1148	1148	.	+	.	ID=1501;Variant_seq=G;Dbxref=dbSNP_129:rs18184485;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1149	1149	.	+	.	ID=1502;Variant_seq=G;Dbxref=dbSNP_129:rs18184476;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1150	1150	.	+	.	ID=1503;Variant_seq=G;Dbxref=dbSNP_129:rs18184467;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1154	1154	.	+	.	ID=1504;Variant_seq=G;Dbxref=dbSNP_129:rs18184458;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1165	1165	.	+	.	ID=1505;Variant_seq=G;Dbxref=dbSNP_129:rs18184449;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1167	1167	.	+	.	ID=1506;Variant_seq=T;Dbxref=dbSNP_129:rs18184440;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1168	1168	.	+	.	ID=1507;Variant_seq=T;Dbxref=dbSNP_129:rs18184431;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1197	1197	.	+	.	ID=1508;Variant_seq=G;Dbxref=dbSNP_129:rs18184395;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1198	1198	.	+	.	ID=1509;Variant_seq=T;Dbxref=dbSNP_129:rs18184386;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1211	1211	.	+	.	ID=1510;Variant_seq=G;Dbxref=dbSNP_129:rs18184332;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1233	1233	.	+	.	ID=1511;Variant_seq=C;Dbxref=dbSNP_129:rs18184260;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1234	1234	.	+	.	ID=1512;Variant_seq=G;Dbxref=dbSNP_129:rs18184251;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1249	1249	.	+	.	ID=1513;Variant_seq=G;Dbxref=dbSNP_129:rs18184206;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1251	1251	.	+	.	ID=1514;Variant_seq=C;Dbxref=dbSNP_129:rs18184197;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1258	1258	.	+	.	ID=1515;Variant_seq=G;Dbxref=dbSNP_129:rs18184177;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1264	1264	.	+	.	ID=1516;Variant_seq=C;Dbxref=dbSNP_129:rs18184168;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1265	1265	.	+	.	ID=1517;Variant_seq=C;Dbxref=dbSNP_129:rs18184159;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1268	1268	.	+	.	ID=1518;Variant_seq=C;Dbxref=dbSNP_129:rs18184141;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1270	1270	.	+	.	ID=1519;Variant_seq=A;Dbxref=dbSNP_129:rs18184132;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1273	1273	.	+	.	ID=1520;Variant_seq=A;Dbxref=dbSNP_129:rs18184123;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1275	1275	.	+	.	ID=1521;Variant_seq=T;Dbxref=dbSNP_129:rs18184114;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1280	1280	.	+	.	ID=1522;Variant_seq=C;Dbxref=dbSNP_129:rs18184096;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1281	1281	.	+	.	ID=1523;Variant_seq=G;Dbxref=dbSNP_129:rs18184087;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1282	1282	.	+	.	ID=1524;Variant_seq=T;Dbxref=dbSNP_129:rs18184078;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1284	1284	.	+	.	ID=1525;Variant_seq=G;Dbxref=dbSNP_129:rs18184069;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1285	1285	.	+	.	ID=1526;Variant_seq=G;Dbxref=dbSNP_129:rs18184060;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1286	1286	.	+	.	ID=1527;Variant_seq=T;Dbxref=dbSNP_129:rs18184051;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1288	1288	.	+	.	ID=1528;Variant_seq=T;Dbxref=dbSNP_129:rs18184042;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1301	1301	.	+	.	ID=1529;Variant_seq=C;Dbxref=dbSNP_129:rs18184024;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1311	1311	.	+	.	ID=1530;Variant_seq=C;Dbxref=dbSNP_129:rs18184006;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1316	1316	.	+	.	ID=1531;Variant_seq=T;Dbxref=dbSNP_129:rs18183997;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1317	1317	.	+	.	ID=1532;Variant_seq=T;Dbxref=dbSNP_129:rs18183988;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1325	1325	.	+	.	ID=1533;Variant_seq=C;Dbxref=dbSNP_129:rs18183979;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1330	1330	.	+	.	ID=1534;Variant_seq=G;Dbxref=dbSNP_129:rs18183961;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1334	1334	.	+	.	ID=1535;Variant_seq=C;Dbxref=dbSNP_129:rs18183952;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1337	1337	.	+	.	ID=1536;Variant_seq=A;Dbxref=dbSNP_129:rs18183943;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1340	1340	.	+	.	ID=1537;Variant_seq=C;Dbxref=dbSNP_129:rs18183925;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1341	1341	.	+	.	ID=1538;Variant_seq=C;Dbxref=dbSNP_129:rs18183916;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1343	1343	.	+	.	ID=1539;Variant_seq=A;Dbxref=dbSNP_129:rs18183907;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1347	1347	.	+	.	ID=1540;Variant_seq=A;Dbxref=dbSNP_129:rs18183898;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1353	1353	.	+	.	ID=1541;Variant_seq=T;Dbxref=dbSNP_129:rs18183889;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1356	1356	.	+	.	ID=1542;Variant_seq=A;Dbxref=dbSNP_129:rs18183880;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1357	1357	.	+	.	ID=1543;Variant_seq=G;Dbxref=dbSNP_129:rs18183871;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1360	1360	.	+	.	ID=1544;Variant_seq=C;Dbxref=dbSNP_129:rs18183862;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1364	1364	.	+	.	ID=1545;Variant_seq=G;Dbxref=dbSNP_129:rs18183835;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1369	1369	.	+	.	ID=1546;Variant_seq=T;Dbxref=dbSNP_129:rs18183826;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1371	1371	.	+	.	ID=1547;Variant_seq=C;Dbxref=dbSNP_129:rs18183817;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1373	1373	.	+	.	ID=1548;Variant_seq=G;Dbxref=dbSNP_129:rs18183808;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1376	1376	.	+	.	ID=1549;Variant_seq=A;Dbxref=dbSNP_129:rs18183799;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1378	1378	.	+	.	ID=1550;Variant_seq=T;Dbxref=dbSNP_129:rs18183790;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1382	1382	.	+	.	ID=1551;Variant_seq=T;Dbxref=dbSNP_129:rs18183781;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1383	1383	.	+	.	ID=1552;Variant_seq=A;Dbxref=dbSNP_129:rs18183772;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1384	1384	.	+	.	ID=1553;Variant_seq=T;Dbxref=dbSNP_129:rs18183763;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1389	1389	.	+	.	ID=1554;Variant_seq=T;Dbxref=dbSNP_129:rs18183754;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1392	1392	.	+	.	ID=1555;Variant_seq=A;Dbxref=dbSNP_129:rs18183745;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1395	1395	.	+	.	ID=1556;Variant_seq=A;Dbxref=dbSNP_129:rs18183736;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1396	1396	.	+	.	ID=1557;Variant_seq=A;Dbxref=dbSNP_129:rs18183727;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1402	1402	.	+	.	ID=1558;Variant_seq=A;Dbxref=dbSNP_129:rs18183718;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1405	1405	.	+	.	ID=1559;Variant_seq=A;Dbxref=dbSNP_129:rs18183700;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1406	1406	.	+	.	ID=1560;Variant_seq=A;Dbxref=dbSNP_129:rs18183691;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1408	1408	.	+	.	ID=1561;Variant_seq=T;Dbxref=dbSNP_129:rs18183682;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1409	1409	.	+	.	ID=1562;Variant_seq=T;Dbxref=dbSNP_129:rs18183673;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1424	1424	.	+	.	ID=1563;Variant_seq=T;Dbxref=dbSNP_129:rs18183646;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1427	1427	.	+	.	ID=1564;Variant_seq=G;Dbxref=dbSNP_129:rs18183637;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1431	1431	.	+	.	ID=1565;Variant_seq=G;Dbxref=dbSNP_129:rs18183628;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1432	1432	.	+	.	ID=1566;Variant_seq=T;Dbxref=dbSNP_129:rs18183619;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1433	1433	.	+	.	ID=1567;Variant_seq=T;Dbxref=dbSNP_129:rs18183610;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1437	1437	.	+	.	ID=1568;Variant_seq=A;Dbxref=dbSNP_129:rs18183592;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1438	1438	.	+	.	ID=1569;Variant_seq=A;Dbxref=dbSNP_129:rs18183583;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1443	1443	.	+	.	ID=1570;Variant_seq=A;Dbxref=dbSNP_129:rs18183574;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1444	1444	.	+	.	ID=1571;Variant_seq=C;Dbxref=dbSNP_129:rs18183565;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1449	1449	.	+	.	ID=1572;Variant_seq=T;Dbxref=dbSNP_129:rs18183556;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1456	1456	.	+	.	ID=1573;Variant_seq=T;Dbxref=dbSNP_129:rs18183538;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1457	1457	.	+	.	ID=1574;Variant_seq=T;Dbxref=dbSNP_129:rs18183529;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1460	1460	.	+	.	ID=1575;Variant_seq=G;Dbxref=dbSNP_129:rs18183520;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1461	1461	.	+	.	ID=1576;Variant_seq=T;Dbxref=dbSNP_129:rs18183511;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1467	1467	.	+	.	ID=1577;Variant_seq=T;Dbxref=dbSNP_129:rs18183493;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1469	1469	.	+	.	ID=1578;Variant_seq=C;Dbxref=dbSNP_129:rs18183484;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1472	1472	.	+	.	ID=1579;Variant_seq=A;Dbxref=dbSNP_129:rs18183475;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1481	1481	.	+	.	ID=1580;Variant_seq=A;Dbxref=dbSNP_129:rs18183457;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1483	1483	.	+	.	ID=1581;Variant_seq=A;Dbxref=dbSNP_129:rs18183439;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1485	1485	.	+	.	ID=1582;Variant_seq=A;Dbxref=dbSNP_129:rs18183430;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1495	1495	.	+	.	ID=1583;Variant_seq=A;Dbxref=dbSNP_129:rs18183412;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1496	1496	.	+	.	ID=1584;Variant_seq=A;Dbxref=dbSNP_129:rs18183403;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1502	1502	.	+	.	ID=1585;Variant_seq=A;Dbxref=dbSNP_129:rs18183394;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1508	1508	.	+	.	ID=1586;Variant_seq=G;Dbxref=dbSNP_129:rs18183376;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1510	1510	.	+	.	ID=1587;Variant_seq=A;Dbxref=dbSNP_129:rs18183367;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1513	1513	.	+	.	ID=1588;Variant_seq=T;Dbxref=dbSNP_129:rs18183349;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1514	1514	.	+	.	ID=1589;Variant_seq=T;Dbxref=dbSNP_129:rs18183340;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1516	1516	.	+	.	ID=1590;Variant_seq=T;Dbxref=dbSNP_129:rs18183331;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1517	1517	.	+	.	ID=1591;Variant_seq=A;Dbxref=dbSNP_129:rs18183322;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1524	1524	.	+	.	ID=1592;Variant_seq=A;Dbxref=dbSNP_129:rs18183304;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1534	1534	.	+	.	ID=1593;Variant_seq=A;Dbxref=dbSNP_129:rs18183295;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1538	1538	.	+	.	ID=1594;Variant_seq=C;Dbxref=dbSNP_129:rs18183277;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1545	1545	.	+	.	ID=1595;Variant_seq=A;Dbxref=dbSNP_129:rs18183268;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1556	1556	.	+	.	ID=1596;Variant_seq=T;Dbxref=dbSNP_129:rs18183259;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1557	1557	.	+	.	ID=1597;Variant_seq=T;Dbxref=dbSNP_129:rs18183250;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1558	1558	.	+	.	ID=1598;Variant_seq=A;Dbxref=dbSNP_129:rs18183241;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1561	1561	.	+	.	ID=1599;Variant_seq=A;Dbxref=dbSNP_129:rs18183223;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1563	1563	.	+	.	ID=1600;Variant_seq=T;Dbxref=dbSNP_129:rs18183214;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1573	1573	.	+	.	ID=1601;Variant_seq=T;Dbxref=dbSNP_129:rs18183187;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1574	1574	.	+	.	ID=1602;Variant_seq=T;Dbxref=dbSNP_129:rs18183178;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1580	1580	.	+	.	ID=1603;Variant_seq=T;Dbxref=dbSNP_129:rs18183169;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1581	1581	.	+	.	ID=1604;Variant_seq=T;Dbxref=dbSNP_129:rs18183160;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1584	1584	.	+	.	ID=1605;Variant_seq=T;Dbxref=dbSNP_129:rs18183151;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1586	1586	.	+	.	ID=1606;Variant_seq=C;Dbxref=dbSNP_129:rs18183142;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1587	1587	.	+	.	ID=1607;Variant_seq=A;Dbxref=dbSNP_129:rs18183133;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1588	1588	.	+	.	ID=1608;Variant_seq=A;Dbxref=dbSNP_129:rs18183124;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1593	1593	.	+	.	ID=1609;Variant_seq=T;Dbxref=dbSNP_129:rs18183106;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1600	1600	.	+	.	ID=1610;Variant_seq=A;Dbxref=dbSNP_129:rs18183097;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1603	1603	.	+	.	ID=1611;Variant_seq=A;Dbxref=dbSNP_129:rs18183088;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1604	1604	.	+	.	ID=1612;Variant_seq=T;Dbxref=dbSNP_129:rs18183079;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1606	1606	.	+	.	ID=1613;Variant_seq=T;Dbxref=dbSNP_129:rs18183070;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1612	1612	.	+	.	ID=1614;Variant_seq=T;Dbxref=dbSNP_129:rs18183052;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1625	1625	.	+	.	ID=1615;Variant_seq=G;Dbxref=dbSNP_129:rs18183034;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1626	1626	.	+	.	ID=1616;Variant_seq=G;Dbxref=dbSNP_129:rs18183025;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1627	1627	.	+	.	ID=1617;Variant_seq=G;Dbxref=dbSNP_129:rs18183016;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1629	1629	.	+	.	ID=1618;Variant_seq=G;Dbxref=dbSNP_129:rs18183007;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1630	1630	.	+	.	ID=1619;Variant_seq=G;Dbxref=dbSNP_129:rs18182998;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1633	1633	.	+	.	ID=1620;Variant_seq=G;Dbxref=dbSNP_129:rs18182989;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1634	1634	.	+	.	ID=1621;Variant_seq=G;Dbxref=dbSNP_129:rs18182980;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1635	1635	.	+	.	ID=1622;Variant_seq=G;Dbxref=dbSNP_129:rs18182971;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1636	1636	.	+	.	ID=1623;Variant_seq=A;Dbxref=dbSNP_129:rs18182962;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1637	1637	.	+	.	ID=1624;Variant_seq=G;Dbxref=dbSNP_129:rs18182953;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1641	1641	.	+	.	ID=1625;Variant_seq=A;Dbxref=dbSNP_129:rs18182944;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1648	1648	.	+	.	ID=1626;Variant_seq=C;Dbxref=dbSNP_129:rs18182935;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1657	1657	.	+	.	ID=1627;Variant_seq=G;Dbxref=dbSNP_129:rs18182890;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1660	1660	.	+	.	ID=1628;Variant_seq=G;Dbxref=dbSNP_129:rs18182881;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1661	1661	.	+	.	ID=1629;Variant_seq=A;Dbxref=dbSNP_129:rs18182872;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1665	1665	.	+	.	ID=1630;Variant_seq=G;Dbxref=dbSNP_129:rs18182863;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1666	1666	.	+	.	ID=1631;Variant_seq=G;Dbxref=dbSNP_129:rs18182854;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1669	1669	.	+	.	ID=1632;Variant_seq=G;Dbxref=dbSNP_129:rs18182836;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1670	1670	.	+	.	ID=1633;Variant_seq=G;Dbxref=dbSNP_129:rs18182827;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1671	1671	.	+	.	ID=1634;Variant_seq=G;Dbxref=dbSNP_129:rs18182818;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1672	1672	.	+	.	ID=1635;Variant_seq=G;Dbxref=dbSNP_129:rs18182809;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1676	1676	.	+	.	ID=1636;Variant_seq=A;Dbxref=dbSNP_129:rs18182791;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1677	1677	.	+	.	ID=1637;Variant_seq=G;Dbxref=dbSNP_129:rs18182782;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1678	1678	.	+	.	ID=1638;Variant_seq=A;Dbxref=dbSNP_129:rs18182773;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1681	1681	.	+	.	ID=1639;Variant_seq=A;Dbxref=dbSNP_129:rs18182755;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1683	1683	.	+	.	ID=1640;Variant_seq=A;Dbxref=dbSNP_129:rs18182746;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1684	1684	.	+	.	ID=1641;Variant_seq=A;Dbxref=dbSNP_129:rs18182737;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1685	1685	.	+	.	ID=1642;Variant_seq=G;Dbxref=dbSNP_129:rs18182728;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1687	1687	.	+	.	ID=1643;Variant_seq=G;Dbxref=dbSNP_129:rs18182719;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1688	1688	.	+	.	ID=1644;Variant_seq=G;Dbxref=dbSNP_129:rs18182710;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1690	1690	.	+	.	ID=1645;Variant_seq=C;Dbxref=dbSNP_129:rs18182701;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1695	1695	.	+	.	ID=1646;Variant_seq=G;Dbxref=dbSNP_129:rs18182683;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1696	1696	.	+	.	ID=1647;Variant_seq=G;Dbxref=dbSNP_129:rs18182674;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1701	1701	.	+	.	ID=1648;Variant_seq=G;Dbxref=dbSNP_129:rs18182665;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1702	1702	.	+	.	ID=1649;Variant_seq=C;Dbxref=dbSNP_129:rs18182656;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1705	1705	.	+	.	ID=1650;Variant_seq=G;Dbxref=dbSNP_129:rs18182638;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1706	1706	.	+	.	ID=1651;Variant_seq=G;Dbxref=dbSNP_129:rs18182629;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1708	1708	.	+	.	ID=1652;Variant_seq=G;Dbxref=dbSNP_129:rs18182620;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1709	1709	.	+	.	ID=1653;Variant_seq=G;Dbxref=dbSNP_129:rs18182611;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1711	1711	.	+	.	ID=1654;Variant_seq=G;Dbxref=dbSNP_129:rs18182593;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1713	1713	.	+	.	ID=1655;Variant_seq=G;Dbxref=dbSNP_129:rs18182584;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1717	1717	.	+	.	ID=1656;Variant_seq=G;Dbxref=dbSNP_129:rs18182566;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1718	1718	.	+	.	ID=1657;Variant_seq=C;Dbxref=dbSNP_129:rs18182557;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1729	1729	.	+	.	ID=1658;Variant_seq=T;Dbxref=dbSNP_129:rs18182530;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1731	1731	.	+	.	ID=1659;Variant_seq=C;Dbxref=dbSNP_129:rs18182521;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1733	1733	.	+	.	ID=1660;Variant_seq=C;Dbxref=dbSNP_129:rs18182512;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1736	1736	.	+	.	ID=1661;Variant_seq=C;Dbxref=dbSNP_129:rs18182485;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1737	1737	.	+	.	ID=1662;Variant_seq=C;Dbxref=dbSNP_129:rs18182476;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1742	1742	.	+	.	ID=1663;Variant_seq=G;Dbxref=dbSNP_129:rs18182449;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1743	1743	.	+	.	ID=1664;Variant_seq=G;Dbxref=dbSNP_129:rs18182440;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1744	1744	.	+	.	ID=1665;Variant_seq=G;Dbxref=dbSNP_129:rs18182431;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1745	1745	.	+	.	ID=1666;Variant_seq=C;Dbxref=dbSNP_129:rs18182422;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1749	1749	.	+	.	ID=1667;Variant_seq=G;Dbxref=dbSNP_129:rs18182404;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1750	1750	.	+	.	ID=1668;Variant_seq=G;Dbxref=dbSNP_129:rs18182395;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1755	1755	.	+	.	ID=1669;Variant_seq=G;Dbxref=dbSNP_129:rs18182386;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1756	1756	.	+	.	ID=1670;Variant_seq=A;Dbxref=dbSNP_129:rs18182377;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1782	1782	.	+	.	ID=1671;Variant_seq=G;Dbxref=dbSNP_129:rs18182368;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1783	1783	.	+	.	ID=1672;Variant_seq=G;Dbxref=dbSNP_129:rs18182359;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1785	1785	.	+	.	ID=1673;Variant_seq=A;Dbxref=dbSNP_129:rs18182350;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1789	1789	.	+	.	ID=1674;Variant_seq=G;Dbxref=dbSNP_129:rs18182332;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1790	1790	.	+	.	ID=1675;Variant_seq=G;Dbxref=dbSNP_129:rs18182323;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1791	1791	.	+	.	ID=1676;Variant_seq=G;Dbxref=dbSNP_129:rs18182314;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1794	1794	.	+	.	ID=1677;Variant_seq=G;Dbxref=dbSNP_129:rs18182305;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1799	1799	.	+	.	ID=1678;Variant_seq=G;Dbxref=dbSNP_129:rs18182296;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1801	1801	.	+	.	ID=1679;Variant_seq=G;Dbxref=dbSNP_129:rs18182287;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1802	1802	.	+	.	ID=1680;Variant_seq=G;Dbxref=dbSNP_129:rs18182278;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1803	1803	.	+	.	ID=1681;Variant_seq=G;Dbxref=dbSNP_129:rs18182269;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1805	1805	.	+	.	ID=1682;Variant_seq=G;Dbxref=dbSNP_129:rs18182260;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1826	1826	.	+	.	ID=1683;Variant_seq=G;Dbxref=dbSNP_129:rs18182242;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1827	1827	.	+	.	ID=1684;Variant_seq=G;Dbxref=dbSNP_129:rs18182233;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1832	1832	.	+	.	ID=1685;Variant_seq=C;Dbxref=dbSNP_129:rs18182215;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1833	1833	.	+	.	ID=1686;Variant_seq=G;Dbxref=dbSNP_129:rs18182206;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1834	1834	.	+	.	ID=1687;Variant_seq=G;Dbxref=dbSNP_129:rs18182197;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1838	1838	.	+	.	ID=1688;Variant_seq=G;Dbxref=dbSNP_129:rs18182170;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1844	1844	.	+	.	ID=1689;Variant_seq=G;Dbxref=dbSNP_129:rs18182152;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1845	1845	.	+	.	ID=1690;Variant_seq=G;Dbxref=dbSNP_129:rs18182143;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1849	1849	.	+	.	ID=1691;Variant_seq=G;Dbxref=dbSNP_129:rs18182134;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1852	1852	.	+	.	ID=1692;Variant_seq=G;Dbxref=dbSNP_129:rs18182125;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1856	1856	.	+	.	ID=1693;Variant_seq=G;Dbxref=dbSNP_129:rs18182107;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1857	1857	.	+	.	ID=1694;Variant_seq=G;Dbxref=dbSNP_129:rs18182098;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1861	1861	.	+	.	ID=1695;Variant_seq=C;Dbxref=dbSNP_129:rs18182071;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1863	1863	.	+	.	ID=1696;Variant_seq=G;Dbxref=dbSNP_129:rs18182062;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1864	1864	.	+	.	ID=1697;Variant_seq=G;Dbxref=dbSNP_129:rs18182053;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1865	1865	.	+	.	ID=1698;Variant_seq=G;Dbxref=dbSNP_129:rs18182044;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1870	1870	.	+	.	ID=1699;Variant_seq=C;Dbxref=dbSNP_129:rs18182026;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1873	1873	.	+	.	ID=1700;Variant_seq=T;Dbxref=dbSNP_129:rs18181999;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1876	1876	.	+	.	ID=1701;Variant_seq=T;Dbxref=dbSNP_129:rs18181990;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1882	1882	.	+	.	ID=1702;Variant_seq=C;Dbxref=dbSNP_129:rs18181981;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1886	1886	.	+	.	ID=1703;Variant_seq=C;Dbxref=dbSNP_129:rs18181972;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1887	1887	.	+	.	ID=1704;Variant_seq=C;Dbxref=dbSNP_129:rs18181963;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1888	1888	.	+	.	ID=1705;Variant_seq=T;Dbxref=dbSNP_129:rs18181954;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1892	1892	.	+	.	ID=1706;Variant_seq=A;Dbxref=dbSNP_129:rs18181945;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1894	1894	.	+	.	ID=1707;Variant_seq=G;Dbxref=dbSNP_129:rs18181936;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1904	1904	.	+	.	ID=1708;Variant_seq=G;Dbxref=dbSNP_129:rs18181918;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1905	1905	.	+	.	ID=1709;Variant_seq=G;Dbxref=dbSNP_129:rs18181909;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1906	1906	.	+	.	ID=1710;Variant_seq=A;Dbxref=dbSNP_129:rs18181900;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1909	1909	.	+	.	ID=1711;Variant_seq=G;Dbxref=dbSNP_129:rs18181891;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1910	1910	.	+	.	ID=1712;Variant_seq=G;Dbxref=dbSNP_129:rs18181882;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1911	1911	.	+	.	ID=1713;Variant_seq=A;Dbxref=dbSNP_129:rs18181873;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1912	1912	.	+	.	ID=1714;Variant_seq=A;Dbxref=dbSNP_129:rs18181864;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1916	1916	.	+	.	ID=1715;Variant_seq=G;Dbxref=dbSNP_129:rs18181846;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1917	1917	.	+	.	ID=1716;Variant_seq=G;Dbxref=dbSNP_129:rs18181837;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1933	1933	.	+	.	ID=1717;Variant_seq=G;Dbxref=dbSNP_129:rs18181801;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	1936	1936	.	+	.	ID=1718;Variant_seq=A;Dbxref=dbSNP_129:rs18181792;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1937	1937	.	+	.	ID=1719;Variant_seq=G;Dbxref=dbSNP_129:rs18181783;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	1940	1940	.	+	.	ID=1720;Variant_seq=C;Dbxref=dbSNP_129:rs18181765;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	1942	1942	.	+	.	ID=1721;Variant_seq=T;Dbxref=dbSNP_129:rs18181756;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	1982	1982	.	+	.	ID=1722;Variant_seq=T;Dbxref=dbSNP_129:rs18181738;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	2017	2017	.	+	.	ID=1723;Variant_seq=G;Dbxref=dbSNP_129:rs18181702;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	2018	2018	.	+	.	ID=1724;Variant_seq=G;Dbxref=dbSNP_129:rs18181693;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	2019	2019	.	+	.	ID=1725;Variant_seq=G;Dbxref=dbSNP_129:rs18181684;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	2027	2027	.	+	.	ID=1726;Variant_seq=G;Dbxref=dbSNP_129:rs18181666;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	2032	2032	.	+	.	ID=1727;Variant_seq=G;Dbxref=dbSNP_129:rs18181648;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	2033	2033	.	+	.	ID=1728;Variant_seq=G;Dbxref=dbSNP_129:rs18181639;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049651.1	dbSNP	SNV	2037	2037	.	+	.	ID=1729;Variant_seq=T;Dbxref=dbSNP_129:rs18181630;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049651.1	dbSNP	SNV	2040	2040	.	+	.	ID=1730;Variant_seq=G;Dbxref=dbSNP_129:rs18181612;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049651.1	dbSNP	SNV	2042	2042	.	+	.	ID=1731;Variant_seq=T;Dbxref=dbSNP_129:rs18181603;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049651.1	dbSNP	SNV	2046	2046	.	+	.	ID=1732;Variant_seq=T;Dbxref=dbSNP_129:rs18181594;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045723.1	dbSNP	SNV	1389	1389	.	+	.	ID=1733;Variant_seq=A;Dbxref=dbSNP_129:rs18691434;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045591.1	dbSNP	SNV	381	381	.	+	.	ID=1734;Variant_seq=C;Dbxref=dbSNP_129:rs18639103;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045591.1	dbSNP	SNV	382	382	.	+	.	ID=1735;Variant_seq=A;Dbxref=dbSNP_129:rs18639094;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045591.1	dbSNP	SNV	1550	1550	.	+	.	ID=1736;Variant_seq=A;Dbxref=dbSNP_129:rs18022230;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049409.1	dbSNP	SNV	140	140	.	+	.	ID=1737;Variant_seq=A;Dbxref=dbSNP_129:rs19273438;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049409.1	dbSNP	SNV	313	313	.	+	.	ID=1738;Variant_seq=C;Dbxref=dbSNP_129:rs19273468;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049409.1	dbSNP	SNV	383	383	.	+	.	ID=1739;Variant_seq=A;Dbxref=dbSNP_129:rs19273478;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049409.1	dbSNP	SNV	652	652	.	+	.	ID=1740;Variant_seq=A;Dbxref=dbSNP_129:rs19273498;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049409.1	dbSNP	SNV	986	986	.	+	.	ID=1741;Variant_seq=T;Dbxref=dbSNP_129:rs19273538;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049409.1	dbSNP	SNV	1077	1077	.	+	.	ID=1742;Variant_seq=G;Dbxref=dbSNP_129:rs19273558;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049409.1	dbSNP	SNV	1280	1280	.	+	.	ID=1743;Variant_seq=A;Dbxref=dbSNP_129:rs19273568;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049409.1	dbSNP	SNV	1311	1311	.	+	.	ID=1744;Variant_seq=T;Dbxref=dbSNP_129:rs19273578;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049409.1	dbSNP	SNV	1453	1453	.	+	.	ID=1745;Variant_seq=C;Dbxref=dbSNP_129:rs19273608;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049409.1	dbSNP	SNV	1628	1628	.	+	.	ID=1746;Variant_seq=G;Dbxref=dbSNP_129:rs19273618;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049409.1	dbSNP	SNV	1688	1688	.	+	.	ID=1747;Variant_seq=T;Dbxref=dbSNP_129:rs19273628;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049409.1	dbSNP	SNV	1706	1706	.	+	.	ID=1748;Variant_seq=G;Dbxref=dbSNP_129:rs19273638;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049409.1	dbSNP	SNV	1736	1736	.	+	.	ID=1749;Variant_seq=G;Dbxref=dbSNP_129:rs19273648;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049409.1	dbSNP	SNV	1997	1997	.	+	.	ID=1750;Variant_seq=T;Dbxref=dbSNP_129:rs19273678;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400247.1	dbSNP	SNV	2477	2477	.	+	.	ID=1751;Variant_seq=T;Dbxref=dbSNP_129:rs52927261;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048555.1	dbSNP	SNV	641	641	.	+	.	ID=1752;Variant_seq=C;Dbxref=dbSNP_129:rs53910154;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048555.1	dbSNP	SNV	682	682	.	+	.	ID=1753;Variant_seq=C;Dbxref=dbSNP_129:rs52994281;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048555.1	dbSNP	insertion	1956	1956	.	+	.	ID=1754;Variant_seq=C;Dbxref=dbSNP_129:rs53291878;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02048555.1	dbSNP	SNV	1957	1957	.	+	.	ID=1755;Variant_seq=A;Dbxref=dbSNP_129:rs52886382;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048555.1	dbSNP	SNV	1959	1959	.	+	.	ID=1756;Variant_seq=A;Dbxref=dbSNP_129:rs53803858;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048555.1	dbSNP	SNV	1988	1988	.	+	.	ID=1757;Variant_seq=T;Dbxref=dbSNP_129:rs52951158;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048555.1	dbSNP	SNV	2010	2010	.	+	.	ID=1758;Variant_seq=C;Dbxref=dbSNP_129:rs52875612;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399295.1	dbSNP	SNV	2257	2257	.	+	.	ID=1759;Variant_seq=A;Dbxref=dbSNP_129:rs19409467;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400282.1	dbSNP	SNV	130	130	.	+	.	ID=1760;Variant_seq=G;Dbxref=dbSNP_129:rs20709817;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400282.1	dbSNP	SNV	146	146	.	+	.	ID=1761;Variant_seq=G;Dbxref=dbSNP_129:rs20709827;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400282.1	dbSNP	SNV	149	149	.	+	.	ID=1762;Variant_seq=T;Dbxref=dbSNP_129:rs20709837;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400282.1	dbSNP	SNV	992	992	.	+	.	ID=1763;Variant_seq=A;Dbxref=dbSNP_129:rs19947218;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400282.1	dbSNP	SNV	1470	1470	.	+	.	ID=1764;Variant_seq=T;Dbxref=dbSNP_129:rs54065414;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400282.1	dbSNP	deletion	1472	1472	.	+	.	ID=1765;Variant_seq=-;Dbxref=dbSNP_129:rs54407480;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400282.1	dbSNP	SNV	1556	1556	.	+	.	ID=1766;Variant_seq=T;Dbxref=dbSNP_129:rs53177737;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400282.1	dbSNP	SNV	1995	1995	.	+	.	ID=1767;Variant_seq=A;Dbxref=dbSNP_129:rs20615585;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400282.1	dbSNP	SNV	1996	1996	.	+	.	ID=1768;Variant_seq=G;Dbxref=dbSNP_129:rs20615575;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400282.1	dbSNP	SNV	2000	2000	.	+	.	ID=1769;Variant_seq=A;Dbxref=dbSNP_129:rs20615565;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400282.1	dbSNP	SNV	2043	2043	.	+	.	ID=1770;Variant_seq=T;Dbxref=dbSNP_129:rs20615535;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400282.1	dbSNP	SNV	2114	2114	.	+	.	ID=1771;Variant_seq=C;Dbxref=dbSNP_129:rs20615415;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400282.1	dbSNP	SNV	2171	2171	.	+	.	ID=1772;Variant_seq=G;Dbxref=dbSNP_129:rs20615365;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400282.1	dbSNP	SNV	2172	2172	.	+	.	ID=1773;Variant_seq=T;Dbxref=dbSNP_129:rs20615355;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400282.1	dbSNP	SNV	2184	2184	.	+	.	ID=1774;Variant_seq=C;Dbxref=dbSNP_129:rs20615345;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400282.1	dbSNP	SNV	2186	2186	.	+	.	ID=1775;Variant_seq=T;Dbxref=dbSNP_129:rs20615335;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400282.1	dbSNP	SNV	2194	2194	.	+	.	ID=1776;Variant_seq=C;Dbxref=dbSNP_129:rs20615325;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400282.1	dbSNP	SNV	2195	2195	.	+	.	ID=1777;Variant_seq=C;Dbxref=dbSNP_129:rs20615315;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400282.1	dbSNP	SNV	2198	2198	.	+	.	ID=1778;Variant_seq=T;Dbxref=dbSNP_129:rs20615305;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400282.1	dbSNP	SNV	2260	2260	.	+	.	ID=1779;Variant_seq=G;Dbxref=dbSNP_129:rs20615225;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400282.1	dbSNP	SNV	2269	2269	.	+	.	ID=1780;Variant_seq=T;Dbxref=dbSNP_129:rs20615205;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400282.1	dbSNP	SNV	2280	2280	.	+	.	ID=1781;Variant_seq=A;Dbxref=dbSNP_129:rs20615195;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400282.1	dbSNP	SNV	2289	2289	.	+	.	ID=1782;Variant_seq=T;Dbxref=dbSNP_129:rs20615175;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400282.1	dbSNP	SNV	2290	2290	.	+	.	ID=1783;Variant_seq=G;Dbxref=dbSNP_129:rs20615165;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400282.1	dbSNP	SNV	2291	2291	.	+	.	ID=1784;Variant_seq=A;Dbxref=dbSNP_129:rs20615155;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400282.1	dbSNP	SNV	2295	2295	.	+	.	ID=1785;Variant_seq=T;Dbxref=dbSNP_129:rs20615145;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400282.1	dbSNP	SNV	2297	2297	.	+	.	ID=1786;Variant_seq=T;Dbxref=dbSNP_129:rs20615135;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400282.1	dbSNP	SNV	2303	2303	.	+	.	ID=1787;Variant_seq=T;Dbxref=dbSNP_129:rs20615115;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400282.1	dbSNP	SNV	2313	2313	.	+	.	ID=1788;Variant_seq=G;Dbxref=dbSNP_129:rs20615105;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400282.1	dbSNP	SNV	2325	2325	.	+	.	ID=1789;Variant_seq=T;Dbxref=dbSNP_129:rs20615095;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400282.1	dbSNP	SNV	2541	2541	.	+	.	ID=1790;Variant_seq=A;Dbxref=dbSNP_129:rs20615075;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400282.1	dbSNP	SNV	2544	2544	.	+	.	ID=1791;Variant_seq=T;Dbxref=dbSNP_129:rs20615065;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400282.1	dbSNP	SNV	2546	2546	.	+	.	ID=1792;Variant_seq=G;Dbxref=dbSNP_129:rs20615055;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400282.1	dbSNP	SNV	2547	2547	.	+	.	ID=1793;Variant_seq=T;Dbxref=dbSNP_129:rs20615045;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400282.1	dbSNP	SNV	2724	2724	.	+	.	ID=1794;Variant_seq=G;Dbxref=dbSNP_129:rs20614904;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400282.1	dbSNP	SNV	2727	2727	.	+	.	ID=1795;Variant_seq=C;Dbxref=dbSNP_129:rs20614894;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400282.1	dbSNP	SNV	2733	2733	.	+	.	ID=1796;Variant_seq=T;Dbxref=dbSNP_129:rs20614884;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400282.1	dbSNP	SNV	2736	2736	.	+	.	ID=1797;Variant_seq=G;Dbxref=dbSNP_129:rs20614874;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400282.1	dbSNP	SNV	2745	2745	.	+	.	ID=1798;Variant_seq=T;Dbxref=dbSNP_129:rs20614854;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400282.1	dbSNP	SNV	2747	2747	.	+	.	ID=1799;Variant_seq=G;Dbxref=dbSNP_129:rs20614844;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400282.1	dbSNP	SNV	2757	2757	.	+	.	ID=1800;Variant_seq=C;Dbxref=dbSNP_129:rs20614834;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400282.1	dbSNP	SNV	2759	2759	.	+	.	ID=1801;Variant_seq=G;Dbxref=dbSNP_129:rs20614824;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400282.1	dbSNP	SNV	2763	2763	.	+	.	ID=1802;Variant_seq=C;Dbxref=dbSNP_129:rs20614814;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400282.1	dbSNP	SNV	2787	2787	.	+	.	ID=1803;Variant_seq=T;Dbxref=dbSNP_129:rs20614774;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400282.1	dbSNP	SNV	2793	2793	.	+	.	ID=1804;Variant_seq=A;Dbxref=dbSNP_129:rs20614764;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400282.1	dbSNP	SNV	2799	2799	.	+	.	ID=1805;Variant_seq=C;Dbxref=dbSNP_129:rs20614754;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400282.1	dbSNP	SNV	2832	2832	.	+	.	ID=1806;Variant_seq=G;Dbxref=dbSNP_129:rs19971518;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047866.1	dbSNP	SNV	968	968	.	+	.	ID=1807;Variant_seq=G;Dbxref=dbSNP_129:rs19046358;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047866.1	dbSNP	SNV	972	972	.	+	.	ID=1808;Variant_seq=G;Dbxref=dbSNP_129:rs19046368;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047866.1	dbSNP	SNV	976	976	.	+	.	ID=1809;Variant_seq=C;Dbxref=dbSNP_129:rs19046378;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047866.1	dbSNP	SNV	987	987	.	+	.	ID=1810;Variant_seq=A;Dbxref=dbSNP_129:rs19046388;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047866.1	dbSNP	SNV	1212	1212	.	+	.	ID=1811;Variant_seq=A;Dbxref=dbSNP_129:rs19046408;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047866.1	dbSNP	SNV	1599	1599	.	+	.	ID=1812;Variant_seq=G;Dbxref=dbSNP_129:rs20214878;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047866.1	dbSNP	SNV	1604	1604	.	+	.	ID=1813;Variant_seq=C;Dbxref=dbSNP_129:rs20214868;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047866.1	dbSNP	SNV	1608	1608	.	+	.	ID=1814;Variant_seq=G;Dbxref=dbSNP_129:rs20214858;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	1827	1827	.	+	.	ID=1815;Variant_seq=A;Dbxref=dbSNP_129:rs53471432;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	1830	1830	.	+	.	ID=1816;Variant_seq=T;Dbxref=dbSNP_129:rs53341756;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	2819	2819	.	+	.	ID=1817;Variant_seq=G;Dbxref=dbSNP_129:rs19724842;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	7187	7187	.	+	.	ID=1818;Variant_seq=G;Dbxref=dbSNP_129:rs19088073;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	8301	8301	.	+	.	ID=1819;Variant_seq=T;Dbxref=dbSNP_129:rs53880116;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	8664	8664	.	+	.	ID=1820;Variant_seq=G;Dbxref=dbSNP_129:rs53842433;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	8677	8677	.	+	.	ID=1821;Variant_seq=A;Dbxref=dbSNP_129:rs54234468;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	9049	9049	.	+	.	ID=1822;Variant_seq=A;Dbxref=dbSNP_129:rs53140388;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	9057	9057	.	+	.	ID=1823;Variant_seq=T;Dbxref=dbSNP_129:rs53101404;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	9062	9062	.	+	.	ID=1824;Variant_seq=T;Dbxref=dbSNP_129:rs52845775;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	9072	9072	.	+	.	ID=1825;Variant_seq=G;Dbxref=dbSNP_129:rs53351833;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	9073	9073	.	+	.	ID=1826;Variant_seq=T;Dbxref=dbSNP_129:rs53001736;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	9081	9081	.	+	.	ID=1827;Variant_seq=A;Dbxref=dbSNP_129:rs54118145;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	9084	9084	.	+	.	ID=1828;Variant_seq=C;Dbxref=dbSNP_129:rs54096148;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	9089	9089	.	+	.	ID=1829;Variant_seq=A;Dbxref=dbSNP_129:rs53429632;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	9093	9093	.	+	.	ID=1830;Variant_seq=G;Dbxref=dbSNP_129:rs53410989;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	9096	9096	.	+	.	ID=1831;Variant_seq=A;Dbxref=dbSNP_129:rs53298620;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	9099	9099	.	+	.	ID=1832;Variant_seq=C;Dbxref=dbSNP_129:rs53205006;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	9111	9111	.	+	.	ID=1833;Variant_seq=T;Dbxref=dbSNP_129:rs53175894;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	9123	9123	.	+	.	ID=1834;Variant_seq=G;Dbxref=dbSNP_129:rs53044419;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	9154	9154	.	+	.	ID=1835;Variant_seq=A;Dbxref=dbSNP_129:rs54096421;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	9156	9156	.	+	.	ID=1836;Variant_seq=C;Dbxref=dbSNP_129:rs52983378;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	9165	9165	.	+	.	ID=1837;Variant_seq=T;Dbxref=dbSNP_129:rs52981412;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	9447	9447	.	+	.	ID=1838;Variant_seq=A;Dbxref=dbSNP_129:rs54392207;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	9459	9459	.	+	.	ID=1839;Variant_seq=C;Dbxref=dbSNP_129:rs53926814;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	9465	9465	.	+	.	ID=1840;Variant_seq=G;Dbxref=dbSNP_129:rs53091654;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	9474	9474	.	+	.	ID=1841;Variant_seq=C;Dbxref=dbSNP_129:rs53278377;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	9486	9486	.	+	.	ID=1842;Variant_seq=C;Dbxref=dbSNP_129:rs54033794;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	9494	9494	.	+	.	ID=1843;Variant_seq=G;Dbxref=dbSNP_129:rs52886051;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	9552	9552	.	+	.	ID=1844;Variant_seq=A;Dbxref=dbSNP_129:rs53740687;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	9577	9577	.	+	.	ID=1845;Variant_seq=C;Dbxref=dbSNP_129:rs53962825;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	9839	9839	.	+	.	ID=1846;Variant_seq=G;Dbxref=dbSNP_129:rs53045309;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	9880	9880	.	+	.	ID=1847;Variant_seq=A;Dbxref=dbSNP_129:rs53024805;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	9886	9886	.	+	.	ID=1848;Variant_seq=A;Dbxref=dbSNP_129:rs54012738;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	9887	9887	.	+	.	ID=1849;Variant_seq=A;Dbxref=dbSNP_129:rs53192219;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	9901	9901	.	+	.	ID=1850;Variant_seq=C;Dbxref=dbSNP_129:rs54033527;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	9985	9985	.	+	.	ID=1851;Variant_seq=C;Dbxref=dbSNP_129:rs52870414;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	10274	10274	.	+	.	ID=1852;Variant_seq=A;Dbxref=dbSNP_129:rs53995255;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	10277	10277	.	+	.	ID=1853;Variant_seq=T;Dbxref=dbSNP_129:rs53208269;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	10438	10438	.	+	.	ID=1854;Variant_seq=A;Dbxref=dbSNP_129:rs52853169;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	10444	10444	.	+	.	ID=1855;Variant_seq=A;Dbxref=dbSNP_129:rs53692651;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	10449	10449	.	+	.	ID=1856;Variant_seq=T;Dbxref=dbSNP_129:rs54294103;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	10770	10770	.	+	.	ID=1857;Variant_seq=A;Dbxref=dbSNP_129:rs53722667;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	10776	10776	.	+	.	ID=1858;Variant_seq=T;Dbxref=dbSNP_129:rs54203807;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	11019	11019	.	+	.	ID=1859;Variant_seq=A;Dbxref=dbSNP_129:rs53872688;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	11023	11023	.	+	.	ID=1860;Variant_seq=G;Dbxref=dbSNP_129:rs53074157;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	11027	11027	.	+	.	ID=1861;Variant_seq=T;Dbxref=dbSNP_129:rs53049162;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	11214	11214	.	+	.	ID=1862;Variant_seq=T;Dbxref=dbSNP_129:rs52924476;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	11219	11219	.	+	.	ID=1863;Variant_seq=T;Dbxref=dbSNP_129:rs53242832;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	11224	11224	.	+	.	ID=1864;Variant_seq=G;Dbxref=dbSNP_129:rs53928864;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	11235	11235	.	+	.	ID=1865;Variant_seq=G;Dbxref=dbSNP_129:rs53381676;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	11238	11238	.	+	.	ID=1866;Variant_seq=A;Dbxref=dbSNP_129:rs53290220;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	11256	11256	.	+	.	ID=1867;Variant_seq=T;Dbxref=dbSNP_129:rs53174640;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	11297	11297	.	+	.	ID=1868;Variant_seq=A;Dbxref=dbSNP_129:rs53264555;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	11507	11507	.	+	.	ID=1869;Variant_seq=A;Dbxref=dbSNP_129:rs53690218;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	11512	11512	.	+	.	ID=1870;Variant_seq=T;Dbxref=dbSNP_129:rs53451528;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	11514	11514	.	+	.	ID=1871;Variant_seq=T,C;Dbxref=dbSNP_129:rs54154373;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	11521	11521	.	+	.	ID=1872;Variant_seq=A;Dbxref=dbSNP_129:rs53805994;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	11540	11540	.	+	.	ID=1873;Variant_seq=T;Dbxref=dbSNP_129:rs52897863;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	11657	11657	.	+	.	ID=1874;Variant_seq=A,T;Dbxref=dbSNP_129:rs53909783;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	11665	11665	.	+	.	ID=1875;Variant_seq=C;Dbxref=dbSNP_129:rs54265159;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	11674	11674	.	+	.	ID=1876;Variant_seq=T;Dbxref=dbSNP_129:rs53589338;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	11678	11678	.	+	.	ID=1877;Variant_seq=G;Dbxref=dbSNP_129:rs52912718;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	13359	13359	.	+	.	ID=1878;Variant_seq=C;Dbxref=dbSNP_129:rs53583745;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	15155	15155	.	+	.	ID=1879;Variant_seq=C;Dbxref=dbSNP_129:rs53286007;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	15157	15157	.	+	.	ID=1880;Variant_seq=T;Dbxref=dbSNP_129:rs53924672;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	15177	15177	.	+	.	ID=1881;Variant_seq=A;Dbxref=dbSNP_129:rs54279416;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	15179	15179	.	+	.	ID=1882;Variant_seq=A;Dbxref=dbSNP_129:rs53124994;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	15185	15185	.	+	.	ID=1883;Variant_seq=C;Dbxref=dbSNP_129:rs54331174;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	15203	15203	.	+	.	ID=1884;Variant_seq=A;Dbxref=dbSNP_129:rs53531465;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	15205	15205	.	+	.	ID=1885;Variant_seq=A;Dbxref=dbSNP_129:rs54287322;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	15206	15206	.	+	.	ID=1886;Variant_seq=C;Dbxref=dbSNP_129:rs52890336;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	15217	15217	.	+	.	ID=1887;Variant_seq=A;Dbxref=dbSNP_129:rs54134781;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	15220	15220	.	+	.	ID=1888;Variant_seq=C;Dbxref=dbSNP_129:rs53878518;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	15221	15221	.	+	.	ID=1889;Variant_seq=G;Dbxref=dbSNP_129:rs53812507;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	15227	15227	.	+	.	ID=1890;Variant_seq=C;Dbxref=dbSNP_129:rs53666481;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	15228	15228	.	+	.	ID=1891;Variant_seq=T;Dbxref=dbSNP_129:rs53388339;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	15230	15230	.	+	.	ID=1892;Variant_seq=A;Dbxref=dbSNP_129:rs54305627;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	15233	15233	.	+	.	ID=1893;Variant_seq=G;Dbxref=dbSNP_129:rs53518241;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	15235	15235	.	+	.	ID=1894;Variant_seq=T;Dbxref=dbSNP_129:rs53865167;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	15251	15251	.	+	.	ID=1895;Variant_seq=T;Dbxref=dbSNP_129:rs53298716;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	15261	15261	.	+	.	ID=1896;Variant_seq=C;Dbxref=dbSNP_129:rs54232240;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	15512	15512	.	+	.	ID=1897;Variant_seq=C;Dbxref=dbSNP_129:rs21050663;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	15520	15520	.	+	.	ID=1898;Variant_seq=G;Dbxref=dbSNP_129:rs53288505;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	15521	15521	.	+	.	ID=1899;Variant_seq=G;Dbxref=dbSNP_129:rs54181427;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036631.1	dbSNP	SNV	15524	15524	.	+	.	ID=1900;Variant_seq=C;Dbxref=dbSNP_129:rs53880617;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	15527	15527	.	+	.	ID=1901;Variant_seq=G;Dbxref=dbSNP_129:rs53625359;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	15542	15542	.	+	.	ID=1902;Variant_seq=G;Dbxref=dbSNP_129:rs54058987;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036631.1	dbSNP	SNV	15554	15554	.	+	.	ID=1903;Variant_seq=C;Dbxref=dbSNP_129:rs52878488;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	15556	15556	.	+	.	ID=1904;Variant_seq=A;Dbxref=dbSNP_129:rs53075335;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	15558	15558	.	+	.	ID=1905;Variant_seq=C;Dbxref=dbSNP_129:rs53841078;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036631.1	dbSNP	SNV	15637	15637	.	+	.	ID=1906;Variant_seq=A;Dbxref=dbSNP_129:rs52877345;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036631.1	dbSNP	SNV	15638	15638	.	+	.	ID=1907;Variant_seq=A;Dbxref=dbSNP_129:rs53587129;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399030.1	dbSNP	SNV	1180	1180	.	+	.	ID=1908;Variant_seq=T;Dbxref=dbSNP_129:rs20282608;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399030.1	dbSNP	SNV	1185	1185	.	+	.	ID=1909;Variant_seq=T;Dbxref=dbSNP_129:rs20282628;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399030.1	dbSNP	SNV	1191	1191	.	+	.	ID=1910;Variant_seq=C;Dbxref=dbSNP_129:rs20282638;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399030.1	dbSNP	SNV	1199	1199	.	+	.	ID=1911;Variant_seq=G;Dbxref=dbSNP_129:rs20282648;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399030.1	dbSNP	SNV	1203	1203	.	+	.	ID=1912;Variant_seq=G;Dbxref=dbSNP_129:rs20282658;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399030.1	dbSNP	SNV	1207	1207	.	+	.	ID=1913;Variant_seq=T;Dbxref=dbSNP_129:rs20282668;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399030.1	dbSNP	SNV	1225	1225	.	+	.	ID=1914;Variant_seq=T;Dbxref=dbSNP_129:rs20282688;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399030.1	dbSNP	SNV	2512	2512	.	+	.	ID=1915;Variant_seq=A;Dbxref=dbSNP_129:rs20282758;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399030.1	dbSNP	SNV	2565	2565	.	+	.	ID=1916;Variant_seq=A;Dbxref=dbSNP_129:rs20282768;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399030.1	dbSNP	SNV	2572	2572	.	+	.	ID=1917;Variant_seq=A;Dbxref=dbSNP_129:rs20282778;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399030.1	dbSNP	SNV	3246	3246	.	+	.	ID=1918;Variant_seq=T;Dbxref=dbSNP_129:rs52986087;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399030.1	dbSNP	SNV	4725	4725	.	+	.	ID=1919;Variant_seq=A;Dbxref=dbSNP_129:rs19401255;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02035660.1	dbSNP	SNV	4589	4589	.	+	.	ID=1920;Variant_seq=A;Dbxref=dbSNP_129:rs54227831;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02035660.1	dbSNP	SNV	25998	25998	.	+	.	ID=1921;Variant_seq=G;Dbxref=dbSNP_129:rs20679159;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035660.1	dbSNP	SNV	30002	30002	.	+	.	ID=1922;Variant_seq=A;Dbxref=dbSNP_129:rs19769514;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02035660.1	dbSNP	SNV	30845	30845	.	+	.	ID=1923;Variant_seq=T;Dbxref=dbSNP_129:rs53536304;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035660.1	dbSNP	SNV	31788	31788	.	+	.	ID=1924;Variant_seq=C;Dbxref=dbSNP_129:rs53756829;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02035660.1	dbSNP	SNV	37104	37104	.	+	.	ID=1925;Variant_seq=A;Dbxref=dbSNP_129:rs54346277;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037697.1	dbSNP	SNV	743	743	.	+	.	ID=1926;Variant_seq=C;Dbxref=dbSNP_129:rs53419543;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037697.1	dbSNP	SNV	746	746	.	+	.	ID=1927;Variant_seq=C;Dbxref=dbSNP_129:rs54153333;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02037697.1	dbSNP	SNV	761	761	.	+	.	ID=1928;Variant_seq=C;Dbxref=dbSNP_129:rs53483103;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037697.1	dbSNP	SNV	777	777	.	+	.	ID=1929;Variant_seq=T;Dbxref=dbSNP_129:rs52850045;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037697.1	dbSNP	SNV	895	895	.	+	.	ID=1930;Variant_seq=C;Dbxref=dbSNP_129:rs53901028;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037697.1	dbSNP	SNV	962	962	.	+	.	ID=1931;Variant_seq=A;Dbxref=dbSNP_129:rs53765719;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037697.1	dbSNP	SNV	1879	1879	.	+	.	ID=1932;Variant_seq=C;Dbxref=dbSNP_129:rs53753313;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037697.1	dbSNP	SNV	1903	1903	.	+	.	ID=1933;Variant_seq=A;Dbxref=dbSNP_129:rs54289121;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037697.1	dbSNP	SNV	1916	1916	.	+	.	ID=1934;Variant_seq=A;Dbxref=dbSNP_129:rs54244654;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037697.1	dbSNP	SNV	1922	1922	.	+	.	ID=1935;Variant_seq=T;Dbxref=dbSNP_129:rs53570715;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037697.1	dbSNP	SNV	1926	1926	.	+	.	ID=1936;Variant_seq=T;Dbxref=dbSNP_129:rs53619646;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037697.1	dbSNP	SNV	1927	1927	.	+	.	ID=1937;Variant_seq=A;Dbxref=dbSNP_129:rs52981802;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037697.1	dbSNP	SNV	6345	6345	.	+	.	ID=1938;Variant_seq=A;Dbxref=dbSNP_129:rs20272159;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400614.1	dbSNP	SNV	1868	1868	.	+	.	ID=1939;Variant_seq=T;Dbxref=dbSNP_129:rs54351691;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400614.1	dbSNP	SNV	1874	1874	.	+	.	ID=1940;Variant_seq=T;Dbxref=dbSNP_129:rs53990137;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400614.1	dbSNP	SNV	1976	1976	.	+	.	ID=1941;Variant_seq=G;Dbxref=dbSNP_129:rs18213565;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400614.1	dbSNP	SNV	2117	2117	.	+	.	ID=1942;Variant_seq=A;Dbxref=dbSNP_129:rs54135219;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400614.1	dbSNP	SNV	2133	2133	.	+	.	ID=1943;Variant_seq=G;Dbxref=dbSNP_129:rs53739746;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400614.1	dbSNP	SNV	2138	2138	.	+	.	ID=1944;Variant_seq=G;Dbxref=dbSNP_129:rs52913016;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400614.1	dbSNP	SNV	2139	2139	.	+	.	ID=1945;Variant_seq=G;Dbxref=dbSNP_129:rs53205800;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400614.1	dbSNP	insertion	2141	2141	.	+	.	ID=1946;Variant_seq=C;Dbxref=dbSNP_129:rs53575601;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH400614.1	dbSNP	SNV	2160	2160	.	+	.	ID=1947;Variant_seq=T;Dbxref=dbSNP_129:rs53488794;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400614.1	dbSNP	SNV	2161	2161	.	+	.	ID=1948;Variant_seq=G;Dbxref=dbSNP_129:rs53838885;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400614.1	dbSNP	SNV	2164	2164	.	+	.	ID=1949;Variant_seq=A;Dbxref=dbSNP_129:rs52893037;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400614.1	dbSNP	SNV	2167	2167	.	+	.	ID=1950;Variant_seq=A;Dbxref=dbSNP_129:rs53848713;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400614.1	dbSNP	insertion	2173	2173	.	+	.	ID=1951;Variant_seq=A;Dbxref=dbSNP_129:rs53334854;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH400614.1	dbSNP	SNV	2174	2174	.	+	.	ID=1952;Variant_seq=C;Dbxref=dbSNP_129:rs53046071;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400614.1	dbSNP	SNV	2176	2176	.	+	.	ID=1953;Variant_seq=A;Dbxref=dbSNP_129:rs53384310;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400614.1	dbSNP	SNV	2183	2183	.	+	.	ID=1954;Variant_seq=C;Dbxref=dbSNP_129:rs53539186;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400614.1	dbSNP	SNV	2191	2191	.	+	.	ID=1955;Variant_seq=G;Dbxref=dbSNP_129:rs53729899;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400614.1	dbSNP	SNV	2196	2196	.	+	.	ID=1956;Variant_seq=C;Dbxref=dbSNP_129:rs20956359;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400614.1	dbSNP	SNV	2200	2200	.	+	.	ID=1957;Variant_seq=C;Dbxref=dbSNP_129:rs53676989;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400614.1	dbSNP	SNV	2211	2211	.	+	.	ID=1958;Variant_seq=T;Dbxref=dbSNP_129:rs53683247;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400614.1	dbSNP	SNV	2233	2233	.	+	.	ID=1959;Variant_seq=A;Dbxref=dbSNP_129:rs53878802;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400614.1	dbSNP	SNV	2238	2238	.	+	.	ID=1960;Variant_seq=C;Dbxref=dbSNP_129:rs52888132;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400614.1	dbSNP	SNV	2249	2249	.	+	.	ID=1961;Variant_seq=C;Dbxref=dbSNP_129:rs54051060;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400614.1	dbSNP	SNV	2250	2250	.	+	.	ID=1962;Variant_seq=A;Dbxref=dbSNP_129:rs53696421;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400614.1	dbSNP	SNV	2255	2255	.	+	.	ID=1963;Variant_seq=C;Dbxref=dbSNP_129:rs20956369;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400614.1	dbSNP	SNV	2256	2256	.	+	.	ID=1964;Variant_seq=A;Dbxref=dbSNP_129:rs20956379;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400614.1	dbSNP	SNV	2260	2260	.	+	.	ID=1965;Variant_seq=T;Dbxref=dbSNP_129:rs53915113;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400614.1	dbSNP	SNV	2261	2261	.	+	.	ID=1966;Variant_seq=G;Dbxref=dbSNP_129:rs53110783;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400614.1	dbSNP	SNV	2262	2262	.	+	.	ID=1967;Variant_seq=G;Dbxref=dbSNP_129:rs54356261;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400614.1	dbSNP	SNV	2271	2271	.	+	.	ID=1968;Variant_seq=C;Dbxref=dbSNP_129:rs53781834;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400614.1	dbSNP	SNV	2279	2279	.	+	.	ID=1969;Variant_seq=G;Dbxref=dbSNP_129:rs53106873;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400614.1	dbSNP	SNV	2286	2286	.	+	.	ID=1970;Variant_seq=C;Dbxref=dbSNP_129:rs54366457;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400614.1	dbSNP	SNV	2302	2302	.	+	.	ID=1971;Variant_seq=A;Dbxref=dbSNP_129:rs53094527;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400614.1	dbSNP	SNV	2306	2306	.	+	.	ID=1972;Variant_seq=G;Dbxref=dbSNP_129:rs53617151;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400614.1	dbSNP	SNV	2318	2318	.	+	.	ID=1973;Variant_seq=T;Dbxref=dbSNP_129:rs54384445;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400614.1	dbSNP	SNV	2329	2329	.	+	.	ID=1974;Variant_seq=T;Dbxref=dbSNP_129:rs20956399;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400614.1	dbSNP	SNV	2332	2332	.	+	.	ID=1975;Variant_seq=C;Dbxref=dbSNP_129:rs53220357;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400614.1	dbSNP	SNV	2337	2337	.	+	.	ID=1976;Variant_seq=G;Dbxref=dbSNP_129:rs53979506;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400614.1	dbSNP	SNV	2357	2357	.	+	.	ID=1977;Variant_seq=T;Dbxref=dbSNP_129:rs53190279;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400614.1	dbSNP	SNV	2364	2364	.	+	.	ID=1978;Variant_seq=C;Dbxref=dbSNP_129:rs53501207;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400614.1	dbSNP	SNV	2365	2365	.	+	.	ID=1979;Variant_seq=T;Dbxref=dbSNP_129:rs53108072;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400614.1	dbSNP	SNV	2372	2372	.	+	.	ID=1980;Variant_seq=C;Dbxref=dbSNP_129:rs53568441;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400614.1	dbSNP	SNV	2374	2374	.	+	.	ID=1981;Variant_seq=T;Dbxref=dbSNP_129:rs53445988;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400614.1	dbSNP	SNV	2377	2377	.	+	.	ID=1982;Variant_seq=A;Dbxref=dbSNP_129:rs53068530;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400614.1	dbSNP	SNV	2381	2381	.	+	.	ID=1983;Variant_seq=G;Dbxref=dbSNP_129:rs53851253;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400614.1	dbSNP	SNV	2391	2391	.	+	.	ID=1984;Variant_seq=T;Dbxref=dbSNP_129:rs20956409;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400614.1	dbSNP	SNV	2396	2396	.	+	.	ID=1985;Variant_seq=T;Dbxref=dbSNP_129:rs53235166;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400614.1	dbSNP	SNV	2402	2402	.	+	.	ID=1986;Variant_seq=T;Dbxref=dbSNP_129:rs53545720;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400614.1	dbSNP	SNV	2404	2404	.	+	.	ID=1987;Variant_seq=A;Dbxref=dbSNP_129:rs20956419;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400614.1	dbSNP	SNV	2407	2407	.	+	.	ID=1988;Variant_seq=T;Dbxref=dbSNP_129:rs53454762;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400614.1	dbSNP	SNV	2408	2408	.	+	.	ID=1989;Variant_seq=T;Dbxref=dbSNP_129:rs54029911;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400614.1	dbSNP	SNV	2416	2416	.	+	.	ID=1990;Variant_seq=C;Dbxref=dbSNP_129:rs53962026;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400614.1	dbSNP	SNV	2418	2418	.	+	.	ID=1991;Variant_seq=C;Dbxref=dbSNP_129:rs54322643;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400614.1	dbSNP	SNV	2419	2419	.	+	.	ID=1992;Variant_seq=A;Dbxref=dbSNP_129:rs53239900;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049730.1	dbSNP	SNV	220	220	.	+	.	ID=1993;Variant_seq=T;Dbxref=dbSNP_129:rs53537809;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049730.1	dbSNP	SNV	226	226	.	+	.	ID=1994;Variant_seq=G;Dbxref=dbSNP_129:rs53804861;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049730.1	dbSNP	SNV	229	229	.	+	.	ID=1995;Variant_seq=T;Dbxref=dbSNP_129:rs53036953;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049730.1	dbSNP	SNV	235	235	.	+	.	ID=1996;Variant_seq=A;Dbxref=dbSNP_129:rs53902131;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049730.1	dbSNP	SNV	445	445	.	+	.	ID=1997;Variant_seq=C;Dbxref=dbSNP_129:rs53546534;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049730.1	dbSNP	SNV	451	451	.	+	.	ID=1998;Variant_seq=A;Dbxref=dbSNP_129:rs53210804;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049730.1	dbSNP	SNV	457	457	.	+	.	ID=1999;Variant_seq=G;Dbxref=dbSNP_129:rs54085344;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049730.1	dbSNP	SNV	464	464	.	+	.	ID=2000;Variant_seq=G;Dbxref=dbSNP_129:rs54012439;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049730.1	dbSNP	SNV	466	466	.	+	.	ID=2001;Variant_seq=G;Dbxref=dbSNP_129:rs52871169;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049730.1	dbSNP	SNV	472	472	.	+	.	ID=2002;Variant_seq=T;Dbxref=dbSNP_129:rs53470940;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049730.1	dbSNP	SNV	475	475	.	+	.	ID=2003;Variant_seq=T;Dbxref=dbSNP_129:rs53542009;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049730.1	dbSNP	SNV	481	481	.	+	.	ID=2004;Variant_seq=G;Dbxref=dbSNP_129:rs54102486;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049730.1	dbSNP	SNV	484	484	.	+	.	ID=2005;Variant_seq=C,G;Dbxref=dbSNP_129:rs53983745;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049730.1	dbSNP	SNV	495	495	.	+	.	ID=2006;Variant_seq=A;Dbxref=dbSNP_129:rs53044930;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049730.1	dbSNP	SNV	496	496	.	+	.	ID=2007;Variant_seq=T;Dbxref=dbSNP_129:rs54105278;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049730.1	dbSNP	SNV	499	499	.	+	.	ID=2008;Variant_seq=G;Dbxref=dbSNP_129:rs54284845;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049730.1	dbSNP	SNV	502	502	.	+	.	ID=2009;Variant_seq=G;Dbxref=dbSNP_129:rs54031126;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049730.1	dbSNP	SNV	1098	1098	.	+	.	ID=2010;Variant_seq=T;Dbxref=dbSNP_129:rs54275044;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049730.1	dbSNP	SNV	1100	1100	.	+	.	ID=2011;Variant_seq=A,T;Dbxref=dbSNP_129:rs53886978;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049730.1	dbSNP	SNV	1102	1102	.	+	.	ID=2012;Variant_seq=A;Dbxref=dbSNP_129:rs54125285;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049730.1	dbSNP	SNV	1104	1104	.	+	.	ID=2013;Variant_seq=G;Dbxref=dbSNP_129:rs53127701;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049730.1	dbSNP	SNV	1130	1130	.	+	.	ID=2014;Variant_seq=T;Dbxref=dbSNP_129:rs53506667;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049730.1	dbSNP	SNV	1133	1133	.	+	.	ID=2015;Variant_seq=A;Dbxref=dbSNP_129:rs54245431;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049730.1	dbSNP	SNV	1134	1134	.	+	.	ID=2016;Variant_seq=T;Dbxref=dbSNP_129:rs54131909;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049730.1	dbSNP	SNV	1146	1146	.	+	.	ID=2017;Variant_seq=G;Dbxref=dbSNP_129:rs53194886;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049730.1	dbSNP	SNV	1147	1147	.	+	.	ID=2018;Variant_seq=T;Dbxref=dbSNP_129:rs53731546;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049730.1	dbSNP	SNV	1151	1151	.	+	.	ID=2019;Variant_seq=C;Dbxref=dbSNP_129:rs54033416;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049730.1	dbSNP	SNV	1154	1154	.	+	.	ID=2020;Variant_seq=T;Dbxref=dbSNP_129:rs53565310;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049730.1	dbSNP	SNV	1163	1163	.	+	.	ID=2021;Variant_seq=T;Dbxref=dbSNP_129:rs53238917;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049730.1	dbSNP	SNV	1166	1166	.	+	.	ID=2022;Variant_seq=T;Dbxref=dbSNP_129:rs54341134;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049730.1	dbSNP	SNV	1169	1169	.	+	.	ID=2023;Variant_seq=C;Dbxref=dbSNP_129:rs54160110;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049730.1	dbSNP	SNV	1172	1172	.	+	.	ID=2024;Variant_seq=T;Dbxref=dbSNP_129:rs53800297;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049730.1	dbSNP	SNV	1181	1181	.	+	.	ID=2025;Variant_seq=G;Dbxref=dbSNP_129:rs53132809;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049730.1	dbSNP	SNV	1187	1187	.	+	.	ID=2026;Variant_seq=T;Dbxref=dbSNP_129:rs52932183;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049730.1	dbSNP	SNV	1189	1189	.	+	.	ID=2027;Variant_seq=A;Dbxref=dbSNP_129:rs53815641;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049730.1	dbSNP	SNV	1514	1514	.	+	.	ID=2028;Variant_seq=T;Dbxref=dbSNP_129:rs54241843;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049730.1	dbSNP	SNV	1523	1523	.	+	.	ID=2029;Variant_seq=A;Dbxref=dbSNP_129:rs53938197;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049730.1	dbSNP	SNV	1717	1717	.	+	.	ID=2030;Variant_seq=G;Dbxref=dbSNP_129:rs53066659;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045490.1	dbSNP	SNV	339	339	.	+	.	ID=2031;Variant_seq=G;Dbxref=dbSNP_129:rs53732691;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045490.1	dbSNP	SNV	363	363	.	+	.	ID=2032;Variant_seq=G;Dbxref=dbSNP_129:rs53132864;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045490.1	dbSNP	SNV	366	366	.	+	.	ID=2033;Variant_seq=C;Dbxref=dbSNP_129:rs53077872;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045490.1	dbSNP	SNV	1424	1424	.	+	.	ID=2034;Variant_seq=G;Dbxref=dbSNP_129:rs53237754;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045490.1	dbSNP	SNV	1426	1426	.	+	.	ID=2035;Variant_seq=A;Dbxref=dbSNP_129:rs53288113;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045490.1	dbSNP	SNV	1432	1432	.	+	.	ID=2036;Variant_seq=G;Dbxref=dbSNP_129:rs52973060;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045490.1	dbSNP	SNV	1459	1459	.	+	.	ID=2037;Variant_seq=G;Dbxref=dbSNP_129:rs54172493;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045490.1	dbSNP	SNV	1462	1462	.	+	.	ID=2038;Variant_seq=G;Dbxref=dbSNP_129:rs53434813;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045490.1	dbSNP	SNV	1463	1463	.	+	.	ID=2039;Variant_seq=A;Dbxref=dbSNP_129:rs53451291;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045490.1	dbSNP	SNV	1464	1464	.	+	.	ID=2040;Variant_seq=A;Dbxref=dbSNP_129:rs52843394;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045490.1	dbSNP	SNV	1465	1465	.	+	.	ID=2041;Variant_seq=A;Dbxref=dbSNP_129:rs54361045;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045490.1	dbSNP	SNV	1466	1466	.	+	.	ID=2042;Variant_seq=A;Dbxref=dbSNP_129:rs53932816;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045490.1	dbSNP	SNV	1467	1467	.	+	.	ID=2043;Variant_seq=G;Dbxref=dbSNP_129:rs54141672;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045490.1	dbSNP	SNV	1468	1468	.	+	.	ID=2044;Variant_seq=T;Dbxref=dbSNP_129:rs53863701;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045490.1	dbSNP	SNV	1482	1482	.	+	.	ID=2045;Variant_seq=C;Dbxref=dbSNP_129:rs53500448;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045490.1	dbSNP	SNV	1483	1483	.	+	.	ID=2046;Variant_seq=T;Dbxref=dbSNP_129:rs53742079;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045490.1	dbSNP	SNV	1485	1485	.	+	.	ID=2047;Variant_seq=A;Dbxref=dbSNP_129:rs53965579;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045490.1	dbSNP	SNV	1485	1485	.	+	.	ID=2048;Variant_seq=T;Dbxref=dbSNP_129:rs54251620;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045490.1	dbSNP	SNV	1488	1488	.	+	.	ID=2049;Variant_seq=T;Dbxref=dbSNP_129:rs53303102;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045490.1	dbSNP	SNV	1492	1492	.	+	.	ID=2050;Variant_seq=C;Dbxref=dbSNP_129:rs53564882;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045490.1	dbSNP	insertion	1497	1497	.	+	.	ID=2051;Variant_seq=T;Dbxref=dbSNP_129:rs53720046;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02045490.1	dbSNP	SNV	1510	1510	.	+	.	ID=2052;Variant_seq=G;Dbxref=dbSNP_129:rs52888856;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045490.1	dbSNP	SNV	1519	1519	.	+	.	ID=2053;Variant_seq=T;Dbxref=dbSNP_129:rs52881944;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045490.1	dbSNP	SNV	1531	1531	.	+	.	ID=2054;Variant_seq=T;Dbxref=dbSNP_129:rs53589011;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045490.1	dbSNP	SNV	1549	1549	.	+	.	ID=2055;Variant_seq=T;Dbxref=dbSNP_129:rs52912560;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045490.1	dbSNP	SNV	1551	1551	.	+	.	ID=2056;Variant_seq=A;Dbxref=dbSNP_129:rs54219442;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045490.1	dbSNP	SNV	1552	1552	.	+	.	ID=2057;Variant_seq=A;Dbxref=dbSNP_129:rs54060305;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045490.1	dbSNP	SNV	1553	1553	.	+	.	ID=2058;Variant_seq=A;Dbxref=dbSNP_129:rs53584954;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045490.1	dbSNP	SNV	1572	1572	.	+	.	ID=2059;Variant_seq=A;Dbxref=dbSNP_129:rs54129733;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045490.1	dbSNP	SNV	1574	1574	.	+	.	ID=2060;Variant_seq=C;Dbxref=dbSNP_129:rs54244963;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045490.1	dbSNP	SNV	2622	2622	.	+	.	ID=2061;Variant_seq=A;Dbxref=dbSNP_129:rs53318695;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045490.1	dbSNP	SNV	2837	2837	.	+	.	ID=2062;Variant_seq=T;Dbxref=dbSNP_129:rs21261685;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398706.1	dbSNP	SNV	8127	8127	.	+	.	ID=2063;Variant_seq=A;Dbxref=dbSNP_129:rs19749227;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398706.1	dbSNP	SNV	8132	8132	.	+	.	ID=2064;Variant_seq=G;Dbxref=dbSNP_129:rs19749207;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398706.1	dbSNP	SNV	8136	8136	.	+	.	ID=2065;Variant_seq=C;Dbxref=dbSNP_129:rs19749197;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398706.1	dbSNP	SNV	8162	8162	.	+	.	ID=2066;Variant_seq=C;Dbxref=dbSNP_129:rs19749177;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398706.1	dbSNP	SNV	8172	8172	.	+	.	ID=2067;Variant_seq=A;Dbxref=dbSNP_129:rs19749167;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398706.1	dbSNP	SNV	8185	8185	.	+	.	ID=2068;Variant_seq=A;Dbxref=dbSNP_129:rs19749157;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398706.1	dbSNP	SNV	8197	8197	.	+	.	ID=2069;Variant_seq=T;Dbxref=dbSNP_129:rs19749127;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398706.1	dbSNP	SNV	8200	8200	.	+	.	ID=2070;Variant_seq=G;Dbxref=dbSNP_129:rs19749117;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398706.1	dbSNP	SNV	8207	8207	.	+	.	ID=2071;Variant_seq=A;Dbxref=dbSNP_129:rs19749107;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398706.1	dbSNP	SNV	8209	8209	.	+	.	ID=2072;Variant_seq=A;Dbxref=dbSNP_129:rs19749097;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398706.1	dbSNP	SNV	8212	8212	.	+	.	ID=2073;Variant_seq=G;Dbxref=dbSNP_129:rs19749087;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398706.1	dbSNP	SNV	8213	8213	.	+	.	ID=2074;Variant_seq=T;Dbxref=dbSNP_129:rs19749077;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398706.1	dbSNP	SNV	8220	8220	.	+	.	ID=2075;Variant_seq=G;Dbxref=dbSNP_129:rs19749067;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398706.1	dbSNP	SNV	8221	8221	.	+	.	ID=2076;Variant_seq=A;Dbxref=dbSNP_129:rs19749057;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398706.1	dbSNP	SNV	8223	8223	.	+	.	ID=2077;Variant_seq=G;Dbxref=dbSNP_129:rs19749047;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398706.1	dbSNP	SNV	8228	8228	.	+	.	ID=2078;Variant_seq=C;Dbxref=dbSNP_129:rs19749027;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398706.1	dbSNP	SNV	8232	8232	.	+	.	ID=2079;Variant_seq=A;Dbxref=dbSNP_129:rs19749007;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398706.1	dbSNP	SNV	8236	8236	.	+	.	ID=2080;Variant_seq=A;Dbxref=dbSNP_129:rs19748997;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398706.1	dbSNP	SNV	8246	8246	.	+	.	ID=2081;Variant_seq=C;Dbxref=dbSNP_129:rs19748957;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398706.1	dbSNP	SNV	8248	8248	.	+	.	ID=2082;Variant_seq=G;Dbxref=dbSNP_129:rs19748947;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398706.1	dbSNP	SNV	8252	8252	.	+	.	ID=2083;Variant_seq=T;Dbxref=dbSNP_129:rs19748927;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398706.1	dbSNP	SNV	8257	8257	.	+	.	ID=2084;Variant_seq=G;Dbxref=dbSNP_129:rs19748917;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398706.1	dbSNP	SNV	8267	8267	.	+	.	ID=2085;Variant_seq=G;Dbxref=dbSNP_129:rs19748877;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398706.1	dbSNP	SNV	8269	8269	.	+	.	ID=2086;Variant_seq=A;Dbxref=dbSNP_129:rs19748867;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398706.1	dbSNP	SNV	8512	8512	.	+	.	ID=2087;Variant_seq=C;Dbxref=dbSNP_129:rs18509442;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398706.1	dbSNP	SNV	10597	10597	.	+	.	ID=2088;Variant_seq=T;Dbxref=dbSNP_129:rs54354294;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040999.1	dbSNP	SNV	1540	1540	.	+	.	ID=2089;Variant_seq=T;Dbxref=dbSNP_129:rs21043451;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040999.1	dbSNP	SNV	1541	1541	.	+	.	ID=2090;Variant_seq=A;Dbxref=dbSNP_129:rs21043441;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040999.1	dbSNP	SNV	4616	4616	.	+	.	ID=2091;Variant_seq=G;Dbxref=dbSNP_129:rs53655953;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044774.1	dbSNP	SNV	541	541	.	+	.	ID=2092;Variant_seq=A;Dbxref=dbSNP_129:rs52960323;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044774.1	dbSNP	SNV	546	546	.	+	.	ID=2093;Variant_seq=A;Dbxref=dbSNP_129:rs53821808;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044774.1	dbSNP	SNV	555	555	.	+	.	ID=2094;Variant_seq=C;Dbxref=dbSNP_129:rs53184537;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044774.1	dbSNP	SNV	560	560	.	+	.	ID=2095;Variant_seq=T;Dbxref=dbSNP_129:rs54187554;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044774.1	dbSNP	SNV	562	562	.	+	.	ID=2096;Variant_seq=A;Dbxref=dbSNP_129:rs53165824;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044774.1	dbSNP	SNV	605	605	.	+	.	ID=2097;Variant_seq=T;Dbxref=dbSNP_129:rs21384560;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044774.1	dbSNP	SNV	903	903	.	+	.	ID=2098;Variant_seq=C;Dbxref=dbSNP_129:rs19748405;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044774.1	dbSNP	SNV	940	940	.	+	.	ID=2099;Variant_seq=T;Dbxref=dbSNP_129:rs19748395;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044774.1	dbSNP	SNV	1778	1778	.	+	.	ID=2100;Variant_seq=A;Dbxref=dbSNP_129:rs18354542;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044774.1	dbSNP	SNV	2105	2105	.	+	.	ID=2101;Variant_seq=T;Dbxref=dbSNP_129:rs19748225;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044774.1	dbSNP	SNV	2218	2218	.	+	.	ID=2102;Variant_seq=C;Dbxref=dbSNP_129:rs19748205;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044774.1	dbSNP	SNV	2483	2483	.	+	.	ID=2103;Variant_seq=G;Dbxref=dbSNP_129:rs19748185;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044774.1	dbSNP	SNV	2710	2710	.	+	.	ID=2104;Variant_seq=A;Dbxref=dbSNP_129:rs19748155;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044774.1	dbSNP	SNV	2717	2717	.	+	.	ID=2105;Variant_seq=G;Dbxref=dbSNP_129:rs19748145;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044774.1	dbSNP	SNV	2745	2745	.	+	.	ID=2106;Variant_seq=A;Dbxref=dbSNP_129:rs19748135;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044774.1	dbSNP	SNV	3061	3061	.	+	.	ID=2107;Variant_seq=A;Dbxref=dbSNP_129:rs19748095;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399074.1	dbSNP	SNV	1194	1194	.	+	.	ID=2108;Variant_seq=T;Dbxref=dbSNP_129:rs19904498;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399074.1	dbSNP	SNV	5957	5957	.	+	.	ID=2109;Variant_seq=T;Dbxref=dbSNP_129:rs21502113;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398750.1	dbSNP	SNV	5000	5000	.	+	.	ID=2110;Variant_seq=T;Dbxref=dbSNP_129:rs21429398;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398750.1	dbSNP	SNV	7888	7888	.	+	.	ID=2111;Variant_seq=G;Dbxref=dbSNP_129:rs53601638;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398750.1	dbSNP	SNV	7911	7911	.	+	.	ID=2112;Variant_seq=A;Dbxref=dbSNP_129:rs53325872;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398750.1	dbSNP	SNV	7941	7941	.	+	.	ID=2113;Variant_seq=T;Dbxref=dbSNP_129:rs54010575;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398750.1	dbSNP	SNV	7951	7951	.	+	.	ID=2114;Variant_seq=T;Dbxref=dbSNP_129:rs53722012;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398750.1	dbSNP	SNV	7977	7977	.	+	.	ID=2115;Variant_seq=G;Dbxref=dbSNP_129:rs53648356;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398750.1	dbSNP	SNV	9118	9118	.	+	.	ID=2116;Variant_seq=C;Dbxref=dbSNP_129:rs21029826;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398750.1	dbSNP	SNV	9173	9173	.	+	.	ID=2117;Variant_seq=T;Dbxref=dbSNP_129:rs54257227;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398750.1	dbSNP	SNV	9174	9174	.	+	.	ID=2118;Variant_seq=A;Dbxref=dbSNP_129:rs53155070;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045033.1	dbSNP	SNV	529	529	.	+	.	ID=2119;Variant_seq=C;Dbxref=dbSNP_129:rs54226353;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045033.1	dbSNP	SNV	568	568	.	+	.	ID=2120;Variant_seq=C;Dbxref=dbSNP_129:rs53814018;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045033.1	dbSNP	SNV	575	575	.	+	.	ID=2121;Variant_seq=G;Dbxref=dbSNP_129:rs53458220;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045033.1	dbSNP	SNV	586	586	.	+	.	ID=2122;Variant_seq=A;Dbxref=dbSNP_129:rs52859025;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045033.1	dbSNP	SNV	595	595	.	+	.	ID=2123;Variant_seq=A;Dbxref=dbSNP_129:rs53251521;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045033.1	dbSNP	SNV	634	634	.	+	.	ID=2124;Variant_seq=G;Dbxref=dbSNP_129:rs54050376;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045033.1	dbSNP	SNV	638	638	.	+	.	ID=2125;Variant_seq=G;Dbxref=dbSNP_129:rs53439932;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045033.1	dbSNP	SNV	640	640	.	+	.	ID=2126;Variant_seq=A;Dbxref=dbSNP_129:rs53301205;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045033.1	dbSNP	SNV	646	646	.	+	.	ID=2127;Variant_seq=A;Dbxref=dbSNP_129:rs54339669;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045033.1	dbSNP	SNV	649	649	.	+	.	ID=2128;Variant_seq=G;Dbxref=dbSNP_129:rs53749366;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045033.1	dbSNP	SNV	658	658	.	+	.	ID=2129;Variant_seq=G;Dbxref=dbSNP_129:rs53740973;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045033.1	dbSNP	SNV	676	676	.	+	.	ID=2130;Variant_seq=T;Dbxref=dbSNP_129:rs53151022;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045033.1	dbSNP	SNV	679	679	.	+	.	ID=2131;Variant_seq=T;Dbxref=dbSNP_129:rs53663716;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045033.1	dbSNP	SNV	685	685	.	+	.	ID=2132;Variant_seq=T;Dbxref=dbSNP_129:rs53725314;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045033.1	dbSNP	SNV	687	687	.	+	.	ID=2133;Variant_seq=A;Dbxref=dbSNP_129:rs53997129;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045033.1	dbSNP	SNV	688	688	.	+	.	ID=2134;Variant_seq=G;Dbxref=dbSNP_129:rs53190337;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045033.1	dbSNP	SNV	726	726	.	+	.	ID=2135;Variant_seq=A;Dbxref=dbSNP_129:rs53812322;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045033.1	dbSNP	SNV	730	730	.	+	.	ID=2136;Variant_seq=C;Dbxref=dbSNP_129:rs53257985;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045033.1	dbSNP	SNV	733	733	.	+	.	ID=2137;Variant_seq=C;Dbxref=dbSNP_129:rs54173203;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039885.1	dbSNP	SNV	644	644	.	+	.	ID=2138;Variant_seq=T;Dbxref=dbSNP_129:rs20828785;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039885.1	dbSNP	SNV	670	670	.	+	.	ID=2139;Variant_seq=T;Dbxref=dbSNP_129:rs20818850;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039885.1	dbSNP	SNV	1335	1335	.	+	.	ID=2140;Variant_seq=G;Dbxref=dbSNP_129:rs53963939;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039885.1	dbSNP	SNV	2994	2994	.	+	.	ID=2141;Variant_seq=C;Dbxref=dbSNP_129:rs53962007;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039885.1	dbSNP	SNV	3028	3028	.	+	.	ID=2142;Variant_seq=T;Dbxref=dbSNP_129:rs53596195;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398361.1	dbSNP	SNV	5371	5371	.	+	.	ID=2143;Variant_seq=T;Dbxref=dbSNP_129:rs53208240;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398361.1	dbSNP	SNV	5377	5377	.	+	.	ID=2144;Variant_seq=C;Dbxref=dbSNP_129:rs54200743;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	6868	6868	.	+	.	ID=2145;Variant_seq=G;Dbxref=dbSNP_129:rs19639612;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398361.1	dbSNP	SNV	6987	6987	.	+	.	ID=2146;Variant_seq=T;Dbxref=dbSNP_129:rs53694941;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398361.1	dbSNP	SNV	6993	6993	.	+	.	ID=2147;Variant_seq=A;Dbxref=dbSNP_129:rs53652551;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	8654	8654	.	+	.	ID=2148;Variant_seq=C;Dbxref=dbSNP_129:rs54400056;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398361.1	dbSNP	SNV	8655	8655	.	+	.	ID=2149;Variant_seq=A;Dbxref=dbSNP_129:rs53880216;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398361.1	dbSNP	SNV	8950	8950	.	+	.	ID=2150;Variant_seq=C;Dbxref=dbSNP_129:rs53974805;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398361.1	dbSNP	SNV	8951	8951	.	+	.	ID=2151;Variant_seq=T;Dbxref=dbSNP_129:rs53305424;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398361.1	dbSNP	SNV	8953	8953	.	+	.	ID=2152;Variant_seq=A;Dbxref=dbSNP_129:rs53985282;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	8954	8954	.	+	.	ID=2153;Variant_seq=T;Dbxref=dbSNP_129:rs53663782;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398361.1	dbSNP	SNV	8954	8954	.	+	.	ID=2154;Variant_seq=A;Dbxref=dbSNP_129:rs53412252;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	insertion	8954	8954	.	+	.	ID=2155;Variant_seq=A;Dbxref=dbSNP_129:rs52862891;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398361.1	dbSNP	SNV	8956	8956	.	+	.	ID=2156;Variant_seq=T;Dbxref=dbSNP_129:rs54205091;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398361.1	dbSNP	SNV	8956	8956	.	+	.	ID=2157;Variant_seq=A;Dbxref=dbSNP_129:rs54122146;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	8957	8957	.	+	.	ID=2158;Variant_seq=T;Dbxref=dbSNP_129:rs53565452;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398361.1	dbSNP	SNV	8960	8960	.	+	.	ID=2159;Variant_seq=T;Dbxref=dbSNP_129:rs53286094;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398361.1	dbSNP	SNV	8963	8963	.	+	.	ID=2160;Variant_seq=A;Dbxref=dbSNP_129:rs54235722;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	8966	8966	.	+	.	ID=2161;Variant_seq=A;Dbxref=dbSNP_129:rs54124536;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	8967	8967	.	+	.	ID=2162;Variant_seq=C,G;Dbxref=dbSNP_129:rs54233608;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398361.1	dbSNP	SNV	8969	8969	.	+	.	ID=2163;Variant_seq=A;Dbxref=dbSNP_129:rs53308070;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	8975	8975	.	+	.	ID=2164;Variant_seq=C,G;Dbxref=dbSNP_129:rs53726197;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398361.1	dbSNP	SNV	8978	8978	.	+	.	ID=2165;Variant_seq=T;Dbxref=dbSNP_129:rs54255492;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398361.1	dbSNP	SNV	8978	8978	.	+	.	ID=2166;Variant_seq=T;Dbxref=dbSNP_129:rs53985860;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	8979	8979	.	+	.	ID=2167;Variant_seq=T;Dbxref=dbSNP_129:rs54039692;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	8981	8981	.	+	.	ID=2168;Variant_seq=T;Dbxref=dbSNP_129:rs53826207;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398361.1	dbSNP	SNV	8983	8983	.	+	.	ID=2169;Variant_seq=A;Dbxref=dbSNP_129:rs53256724;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	8990	8990	.	+	.	ID=2170;Variant_seq=G;Dbxref=dbSNP_129:rs53696188;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398361.1	dbSNP	SNV	8990	8990	.	+	.	ID=2171;Variant_seq=C;Dbxref=dbSNP_129:rs54126556;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398361.1	dbSNP	SNV	8993	8993	.	+	.	ID=2172;Variant_seq=A,T;Dbxref=dbSNP_129:rs53301761;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	8995	8995	.	+	.	ID=2173;Variant_seq=C;Dbxref=dbSNP_129:rs54146860;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398361.1	dbSNP	SNV	8997	8997	.	+	.	ID=2174;Variant_seq=T;Dbxref=dbSNP_129:rs53908642;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398361.1	dbSNP	SNV	8998	8998	.	+	.	ID=2175;Variant_seq=A;Dbxref=dbSNP_129:rs53946379;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	9005	9005	.	+	.	ID=2176;Variant_seq=G;Dbxref=dbSNP_129:rs54273124;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398361.1	dbSNP	SNV	9006	9006	.	+	.	ID=2177;Variant_seq=A;Dbxref=dbSNP_129:rs53482631;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	9007	9007	.	+	.	ID=2178;Variant_seq=A;Dbxref=dbSNP_129:rs53166328;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	9008	9008	.	+	.	ID=2179;Variant_seq=A;Dbxref=dbSNP_129:rs54049405;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	9008	9008	.	+	.	ID=2180;Variant_seq=T;Dbxref=dbSNP_129:rs53688482;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398361.1	dbSNP	SNV	9014	9014	.	+	.	ID=2181;Variant_seq=T;Dbxref=dbSNP_129:rs53802311;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398361.1	dbSNP	SNV	9015	9015	.	+	.	ID=2182;Variant_seq=G;Dbxref=dbSNP_129:rs54178320;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398361.1	dbSNP	SNV	9124	9124	.	+	.	ID=2183;Variant_seq=A;Dbxref=dbSNP_129:rs54273498;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	9125	9125	.	+	.	ID=2184;Variant_seq=C;Dbxref=dbSNP_129:rs54069009;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398361.1	dbSNP	SNV	9128	9128	.	+	.	ID=2185;Variant_seq=C;Dbxref=dbSNP_129:rs54117667;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398361.1	dbSNP	deletion	9215	9215	.	+	.	ID=2186;Variant_seq=-;Dbxref=dbSNP_129:rs53285345;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	9512	9512	.	+	.	ID=2187;Variant_seq=C;Dbxref=dbSNP_129:rs18657387;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398361.1	dbSNP	SNV	9553	9553	.	+	.	ID=2188;Variant_seq=G;Dbxref=dbSNP_129:rs18657379;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398361.1	dbSNP	SNV	9555	9555	.	+	.	ID=2189;Variant_seq=A;Dbxref=dbSNP_129:rs18657371;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	9720	9720	.	+	.	ID=2190;Variant_seq=A;Dbxref=dbSNP_129:rs18657339;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398361.1	dbSNP	SNV	12152	12152	.	+	.	ID=2191;Variant_seq=C;Dbxref=dbSNP_129:rs19523204;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398361.1	dbSNP	SNV	20804	20804	.	+	.	ID=2192;Variant_seq=C;Dbxref=dbSNP_129:rs20397578;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039521.1	dbSNP	SNV	425	425	.	+	.	ID=2193;Variant_seq=C;Dbxref=dbSNP_129:rs19491485;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039521.1	dbSNP	SNV	1846	1846	.	+	.	ID=2194;Variant_seq=A;Dbxref=dbSNP_129:rs53072732;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039521.1	dbSNP	SNV	3037	3037	.	+	.	ID=2195;Variant_seq=T;Dbxref=dbSNP_129:rs54074982;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039521.1	dbSNP	SNV	3038	3038	.	+	.	ID=2196;Variant_seq=C;Dbxref=dbSNP_129:rs53950901;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039521.1	dbSNP	SNV	3121	3121	.	+	.	ID=2197;Variant_seq=C;Dbxref=dbSNP_129:rs19415726;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039521.1	dbSNP	SNV	3982	3982	.	+	.	ID=2198;Variant_seq=T;Dbxref=dbSNP_129:rs19113396;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039521.1	dbSNP	SNV	4252	4252	.	+	.	ID=2199;Variant_seq=A;Dbxref=dbSNP_129:rs21459797;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039521.1	dbSNP	SNV	5001	5001	.	+	.	ID=2200;Variant_seq=C;Dbxref=dbSNP_129:rs18373065;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398499.1	dbSNP	SNV	3854	3854	.	+	.	ID=2201;Variant_seq=T;Dbxref=dbSNP_129:rs18788104;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398499.1	dbSNP	SNV	5568	5568	.	+	.	ID=2202;Variant_seq=T;Dbxref=dbSNP_129:rs20640642;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398499.1	dbSNP	SNV	10243	10243	.	+	.	ID=2203;Variant_seq=T;Dbxref=dbSNP_129:rs19882744;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398499.1	dbSNP	SNV	11433	11433	.	+	.	ID=2204;Variant_seq=T;Dbxref=dbSNP_129:rs21543057;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045780.1	dbSNP	SNV	2423	2423	.	+	.	ID=2205;Variant_seq=T;Dbxref=dbSNP_129:rs53573154;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045780.1	dbSNP	SNV	2527	2527	.	+	.	ID=2206;Variant_seq=G;Dbxref=dbSNP_129:rs20140249;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045780.1	dbSNP	SNV	2537	2537	.	+	.	ID=2207;Variant_seq=T;Dbxref=dbSNP_129:rs20140259;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045780.1	dbSNP	SNV	2546	2546	.	+	.	ID=2208;Variant_seq=G;Dbxref=dbSNP_129:rs20140269;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400380.1	dbSNP	SNV	723	723	.	+	.	ID=2209;Variant_seq=A;Dbxref=dbSNP_129:rs53371379;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398447.1	dbSNP	SNV	3221	3221	.	+	.	ID=2210;Variant_seq=T;Dbxref=dbSNP_129:rs53177737;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398447.1	dbSNP	SNV	3693	3693	.	+	.	ID=2211;Variant_seq=C;Dbxref=dbSNP_129:rs19946778;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398447.1	dbSNP	SNV	4060	4060	.	+	.	ID=2212;Variant_seq=A;Dbxref=dbSNP_129:rs19946267;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398447.1	dbSNP	SNV	4460	4460	.	+	.	ID=2213;Variant_seq=A;Dbxref=dbSNP_129:rs20615185;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398447.1	dbSNP	SNV	12143	12143	.	+	.	ID=2214;Variant_seq=T;Dbxref=dbSNP_129:rs53018449;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398447.1	dbSNP	SNV	17192	17192	.	+	.	ID=2215;Variant_seq=A;Dbxref=dbSNP_129:rs19410011;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398447.1	dbSNP	SNV	17193	17193	.	+	.	ID=2216;Variant_seq=A;Dbxref=dbSNP_129:rs19410001;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047474.1	dbSNP	SNV	161	161	.	+	.	ID=2217;Variant_seq=C;Dbxref=dbSNP_129:rs19848983;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037698.1	dbSNP	SNV	1047	1047	.	+	.	ID=2218;Variant_seq=A;Dbxref=dbSNP_129:rs53638712;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037698.1	dbSNP	SNV	2441	2441	.	+	.	ID=2219;Variant_seq=T;Dbxref=dbSNP_129:rs19648376;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037698.1	dbSNP	SNV	2750	2750	.	+	.	ID=2220;Variant_seq=T;Dbxref=dbSNP_129:rs20427988;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037698.1	dbSNP	SNV	2750	2750	.	+	.	ID=2221;Variant_seq=T;Dbxref=dbSNP_129:rs21276775;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037698.1	dbSNP	SNV	3157	3157	.	+	.	ID=2222;Variant_seq=A;Dbxref=dbSNP_129:rs20847893;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037698.1	dbSNP	insertion	3576	3576	.	+	.	ID=2223;Variant_seq=TAT;Dbxref=dbSNP_129:rs53631890;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02037080.1	dbSNP	SNV	11410	11410	.	+	.	ID=2224;Variant_seq=A;Dbxref=dbSNP_129:rs18034833;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037080.1	dbSNP	SNV	11412	11412	.	+	.	ID=2225;Variant_seq=C;Dbxref=dbSNP_129:rs18034824;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037080.1	dbSNP	SNV	11999	11999	.	+	.	ID=2226;Variant_seq=T;Dbxref=dbSNP_129:rs53845146;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02037080.1	dbSNP	SNV	12004	12004	.	+	.	ID=2227;Variant_seq=A;Dbxref=dbSNP_129:rs54143862;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037080.1	dbSNP	SNV	12022	12022	.	+	.	ID=2228;Variant_seq=T;Dbxref=dbSNP_129:rs54346899;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037080.1	dbSNP	SNV	12032	12032	.	+	.	ID=2229;Variant_seq=T;Dbxref=dbSNP_129:rs53409181;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037080.1	dbSNP	insertion	12050	12050	.	+	.	ID=2230;Variant_seq=A;Dbxref=dbSNP_129:rs54006399;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02037080.1	dbSNP	insertion	12063	12063	.	+	.	ID=2231;Variant_seq=A;Dbxref=dbSNP_129:rs54122886;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02037080.1	dbSNP	SNV	12066	12066	.	+	.	ID=2232;Variant_seq=G;Dbxref=dbSNP_129:rs54197945;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02037080.1	dbSNP	SNV	12170	12170	.	+	.	ID=2233;Variant_seq=T;Dbxref=dbSNP_129:rs20160220;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400061.1	dbSNP	SNV	964	964	.	+	.	ID=2234;Variant_seq=G;Dbxref=dbSNP_129:rs20834483;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041598.1	dbSNP	SNV	325	325	.	+	.	ID=2235;Variant_seq=T;Dbxref=dbSNP_129:rs53202919;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041598.1	dbSNP	SNV	326	326	.	+	.	ID=2236;Variant_seq=A;Dbxref=dbSNP_129:rs53751121;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041598.1	dbSNP	SNV	335	335	.	+	.	ID=2237;Variant_seq=T;Dbxref=dbSNP_129:rs52844719;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041598.1	dbSNP	SNV	358	358	.	+	.	ID=2238;Variant_seq=A;Dbxref=dbSNP_129:rs52998361;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041598.1	dbSNP	SNV	370	370	.	+	.	ID=2239;Variant_seq=A;Dbxref=dbSNP_129:rs52850474;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041598.1	dbSNP	SNV	371	371	.	+	.	ID=2240;Variant_seq=T;Dbxref=dbSNP_129:rs53096707;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041598.1	dbSNP	SNV	372	372	.	+	.	ID=2241;Variant_seq=T;Dbxref=dbSNP_129:rs54254326;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041598.1	dbSNP	SNV	407	407	.	+	.	ID=2242;Variant_seq=A;Dbxref=dbSNP_129:rs52950329;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041598.1	dbSNP	SNV	422	422	.	+	.	ID=2243;Variant_seq=A;Dbxref=dbSNP_129:rs18033578;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041598.1	dbSNP	SNV	427	427	.	+	.	ID=2244;Variant_seq=A;Dbxref=dbSNP_129:rs54371609;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041598.1	dbSNP	SNV	430	430	.	+	.	ID=2245;Variant_seq=G;Dbxref=dbSNP_129:rs53731122;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041598.1	dbSNP	SNV	433	433	.	+	.	ID=2246;Variant_seq=T;Dbxref=dbSNP_129:rs52918520;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041598.1	dbSNP	SNV	807	807	.	+	.	ID=2247;Variant_seq=A,T;Dbxref=dbSNP_129:rs53012120;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041598.1	dbSNP	SNV	2567	2567	.	+	.	ID=2248;Variant_seq=T;Dbxref=dbSNP_129:rs18033794;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045565.1	dbSNP	SNV	209	209	.	+	.	ID=2249;Variant_seq=T;Dbxref=dbSNP_129:rs18295769;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045565.1	dbSNP	SNV	218	218	.	+	.	ID=2250;Variant_seq=C;Dbxref=dbSNP_129:rs18295796;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045565.1	dbSNP	SNV	224	224	.	+	.	ID=2251;Variant_seq=T;Dbxref=dbSNP_129:rs18295805;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045565.1	dbSNP	SNV	229	229	.	+	.	ID=2252;Variant_seq=T;Dbxref=dbSNP_129:rs18295814;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045565.1	dbSNP	SNV	231	231	.	+	.	ID=2253;Variant_seq=C;Dbxref=dbSNP_129:rs18295823;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045565.1	dbSNP	SNV	233	233	.	+	.	ID=2254;Variant_seq=A;Dbxref=dbSNP_129:rs18295832;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045565.1	dbSNP	SNV	241	241	.	+	.	ID=2255;Variant_seq=C;Dbxref=dbSNP_129:rs18295850;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045565.1	dbSNP	SNV	242	242	.	+	.	ID=2256;Variant_seq=G;Dbxref=dbSNP_129:rs18295859;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045565.1	dbSNP	SNV	244	244	.	+	.	ID=2257;Variant_seq=T;Dbxref=dbSNP_129:rs18295868;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045565.1	dbSNP	SNV	257	257	.	+	.	ID=2258;Variant_seq=C;Dbxref=dbSNP_129:rs18295877;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045565.1	dbSNP	SNV	287	287	.	+	.	ID=2259;Variant_seq=A;Dbxref=dbSNP_129:rs18295904;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045565.1	dbSNP	SNV	322	322	.	+	.	ID=2260;Variant_seq=G;Dbxref=dbSNP_129:rs18295967;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045565.1	dbSNP	SNV	325	325	.	+	.	ID=2261;Variant_seq=C;Dbxref=dbSNP_129:rs18295976;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045565.1	dbSNP	SNV	460	460	.	+	.	ID=2262;Variant_seq=C;Dbxref=dbSNP_129:rs18296111;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045565.1	dbSNP	SNV	461	461	.	+	.	ID=2263;Variant_seq=G;Dbxref=dbSNP_129:rs18296120;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045565.1	dbSNP	SNV	597	597	.	+	.	ID=2264;Variant_seq=T;Dbxref=dbSNP_129:rs53107996;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045565.1	dbSNP	SNV	598	598	.	+	.	ID=2265;Variant_seq=G;Dbxref=dbSNP_129:rs53610765;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045565.1	dbSNP	SNV	599	599	.	+	.	ID=2266;Variant_seq=G;Dbxref=dbSNP_129:rs53595961;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045565.1	dbSNP	SNV	599	599	.	+	.	ID=2267;Variant_seq=G;Dbxref=dbSNP_129:rs53024744;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045565.1	dbSNP	SNV	601	601	.	+	.	ID=2268;Variant_seq=C;Dbxref=dbSNP_129:rs52986596;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045565.1	dbSNP	SNV	601	601	.	+	.	ID=2269;Variant_seq=C;Dbxref=dbSNP_129:rs53561781;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047189.1	dbSNP	insertion	979	979	.	+	.	ID=2270;Variant_seq=CAAAAGAAA;Dbxref=dbSNP_129:rs53002238;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02042290.1	dbSNP	SNV	2343	2343	.	+	.	ID=2271;Variant_seq=G;Dbxref=dbSNP_129:rs19561977;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042290.1	dbSNP	SNV	2348	2348	.	+	.	ID=2272;Variant_seq=C;Dbxref=dbSNP_129:rs19561957;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041017.1	dbSNP	SNV	1514	1514	.	+	.	ID=2273;Variant_seq=A;Dbxref=dbSNP_129:rs54121196;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048650.1	dbSNP	SNV	360	360	.	+	.	ID=2274;Variant_seq=G;Dbxref=dbSNP_129:rs19048421;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048650.1	dbSNP	SNV	434	434	.	+	.	ID=2275;Variant_seq=G;Dbxref=dbSNP_129:rs18718210;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048650.1	dbSNP	SNV	1407	1407	.	+	.	ID=2276;Variant_seq=G;Dbxref=dbSNP_129:rs18718092;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048933.1	dbSNP	SNV	2076	2076	.	+	.	ID=2277;Variant_seq=G;Dbxref=dbSNP_129:rs20955115;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH401135.1	dbSNP	SNV	68	68	.	+	.	ID=2278;Variant_seq=C;Dbxref=dbSNP_129:rs19641836;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH401135.1	dbSNP	SNV	219	219	.	+	.	ID=2279;Variant_seq=A;Dbxref=dbSNP_129:rs19641596;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH401135.1	dbSNP	SNV	646	646	.	+	.	ID=2280;Variant_seq=T;Dbxref=dbSNP_129:rs19641156;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH401135.1	dbSNP	SNV	737	737	.	+	.	ID=2281;Variant_seq=G;Dbxref=dbSNP_129:rs19640966;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH401135.1	dbSNP	SNV	749	749	.	+	.	ID=2282;Variant_seq=G;Dbxref=dbSNP_129:rs19640926;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH401135.1	dbSNP	SNV	754	754	.	+	.	ID=2283;Variant_seq=C;Dbxref=dbSNP_129:rs19640916;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH401135.1	dbSNP	SNV	760	760	.	+	.	ID=2284;Variant_seq=C;Dbxref=dbSNP_129:rs19640876;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH401135.1	dbSNP	SNV	767	767	.	+	.	ID=2285;Variant_seq=T;Dbxref=dbSNP_129:rs19640836;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038249.1	dbSNP	SNV	207	207	.	+	.	ID=2286;Variant_seq=C;Dbxref=dbSNP_129:rs20326910;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038249.1	dbSNP	SNV	1860	1860	.	+	.	ID=2287;Variant_seq=A;Dbxref=dbSNP_129:rs20819052;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398658.1	dbSNP	SNV	1472	1472	.	+	.	ID=2288;Variant_seq=G;Dbxref=dbSNP_129:rs19567617;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398658.1	dbSNP	SNV	3689	3689	.	+	.	ID=2289;Variant_seq=T;Dbxref=dbSNP_129:rs20684204;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398658.1	dbSNP	SNV	10655	10655	.	+	.	ID=2290;Variant_seq=T;Dbxref=dbSNP_129:rs17997608;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398658.1	dbSNP	SNV	11319	11319	.	+	.	ID=2291;Variant_seq=T;Dbxref=dbSNP_129:rs17997581;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398658.1	dbSNP	SNV	11470	11470	.	+	.	ID=2292;Variant_seq=T;Dbxref=dbSNP_129:rs21615008;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048657.1	dbSNP	SNV	637	637	.	+	.	ID=2293;Variant_seq=C;Dbxref=dbSNP_129:rs19399586;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046398.1	dbSNP	SNV	1985	1985	.	+	.	ID=2294;Variant_seq=C;Dbxref=dbSNP_129:rs20345814;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047312.1	dbSNP	SNV	1174	1174	.	+	.	ID=2295;Variant_seq=A;Dbxref=dbSNP_129:rs53943163;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047312.1	dbSNP	SNV	1175	1175	.	+	.	ID=2296;Variant_seq=T;Dbxref=dbSNP_129:rs20686867;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047312.1	dbSNP	SNV	1412	1412	.	+	.	ID=2297;Variant_seq=A,G;Dbxref=dbSNP_129:rs54202378;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047312.1	dbSNP	insertion	1412	1412	.	+	.	ID=2298;Variant_seq=AA;Dbxref=dbSNP_129:rs54018269;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02047312.1	dbSNP	SNV	1415	1415	.	+	.	ID=2299;Variant_seq=T;Dbxref=dbSNP_129:rs54214642;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047312.1	dbSNP	SNV	1419	1419	.	+	.	ID=2300;Variant_seq=C;Dbxref=dbSNP_129:rs54221585;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047312.1	dbSNP	SNV	1420	1420	.	+	.	ID=2301;Variant_seq=T;Dbxref=dbSNP_129:rs53842509;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047312.1	dbSNP	SNV	1421	1421	.	+	.	ID=2302;Variant_seq=T;Dbxref=dbSNP_129:rs54074330;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047312.1	dbSNP	SNV	1422	1422	.	+	.	ID=2303;Variant_seq=T;Dbxref=dbSNP_129:rs53247127;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047312.1	dbSNP	SNV	1424	1424	.	+	.	ID=2304;Variant_seq=T;Dbxref=dbSNP_129:rs53176320;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039092.1	dbSNP	SNV	3171	3171	.	+	.	ID=2305;Variant_seq=G;Dbxref=dbSNP_129:rs21127094;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039092.1	dbSNP	SNV	3437	3437	.	+	.	ID=2306;Variant_seq=A;Dbxref=dbSNP_129:rs53262171;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400017.1	dbSNP	SNV	1067	1067	.	+	.	ID=2307;Variant_seq=G;Dbxref=dbSNP_129:rs54192635;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400017.1	dbSNP	SNV	1407	1407	.	+	.	ID=2308;Variant_seq=T;Dbxref=dbSNP_129:rs20199823;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400017.1	dbSNP	SNV	1411	1411	.	+	.	ID=2309;Variant_seq=C;Dbxref=dbSNP_129:rs53107215;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400017.1	dbSNP	SNV	1418	1418	.	+	.	ID=2310;Variant_seq=A;Dbxref=dbSNP_129:rs53668970;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400017.1	dbSNP	SNV	2707	2707	.	+	.	ID=2311;Variant_seq=T;Dbxref=dbSNP_129:rs20393677;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400017.1	dbSNP	SNV	2729	2729	.	+	.	ID=2312;Variant_seq=A;Dbxref=dbSNP_129:rs20393687;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047252.1	dbSNP	SNV	195	195	.	+	.	ID=2313;Variant_seq=T;Dbxref=dbSNP_129:rs18900245;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047252.1	dbSNP	SNV	410	410	.	+	.	ID=2314;Variant_seq=A;Dbxref=dbSNP_129:rs18900255;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047252.1	dbSNP	SNV	771	771	.	+	.	ID=2315;Variant_seq=G;Dbxref=dbSNP_129:rs18900265;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047252.1	dbSNP	SNV	780	780	.	+	.	ID=2316;Variant_seq=G;Dbxref=dbSNP_129:rs18900275;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047252.1	dbSNP	SNV	880	880	.	+	.	ID=2317;Variant_seq=T;Dbxref=dbSNP_129:rs18900285;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047252.1	dbSNP	SNV	1197	1197	.	+	.	ID=2318;Variant_seq=T;Dbxref=dbSNP_129:rs53345375;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047252.1	dbSNP	SNV	1200	1200	.	+	.	ID=2319;Variant_seq=C;Dbxref=dbSNP_129:rs53364985;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047252.1	dbSNP	SNV	1201	1201	.	+	.	ID=2320;Variant_seq=T;Dbxref=dbSNP_129:rs54196284;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047252.1	dbSNP	SNV	1219	1219	.	+	.	ID=2321;Variant_seq=C;Dbxref=dbSNP_129:rs53541392;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047252.1	dbSNP	SNV	1225	1225	.	+	.	ID=2322;Variant_seq=A;Dbxref=dbSNP_129:rs54371754;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047252.1	dbSNP	SNV	1235	1235	.	+	.	ID=2323;Variant_seq=G;Dbxref=dbSNP_129:rs53221273;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047252.1	dbSNP	SNV	1516	1516	.	+	.	ID=2324;Variant_seq=T;Dbxref=dbSNP_129:rs18900295;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047252.1	dbSNP	SNV	1574	1574	.	+	.	ID=2325;Variant_seq=A;Dbxref=dbSNP_129:rs18900315;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047252.1	dbSNP	SNV	2089	2089	.	+	.	ID=2326;Variant_seq=A;Dbxref=dbSNP_129:rs18900325;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047252.1	dbSNP	SNV	2217	2217	.	+	.	ID=2327;Variant_seq=A;Dbxref=dbSNP_129:rs18900335;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047252.1	dbSNP	SNV	2314	2314	.	+	.	ID=2328;Variant_seq=T;Dbxref=dbSNP_129:rs18900344;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047252.1	dbSNP	SNV	2379	2379	.	+	.	ID=2329;Variant_seq=C;Dbxref=dbSNP_129:rs18900354;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041074.1	dbSNP	SNV	4515	4515	.	+	.	ID=2330;Variant_seq=T;Dbxref=dbSNP_129:rs19308488;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398574.1	dbSNP	SNV	6985	6985	.	+	.	ID=2331;Variant_seq=C;Dbxref=dbSNP_129:rs53075677;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398574.1	dbSNP	SNV	10092	10092	.	+	.	ID=2332;Variant_seq=A;Dbxref=dbSNP_129:rs21296622;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398574.1	dbSNP	SNV	10661	10661	.	+	.	ID=2333;Variant_seq=A;Dbxref=dbSNP_129:rs21203854;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398574.1	dbSNP	SNV	11747	11747	.	+	.	ID=2334;Variant_seq=C;Dbxref=dbSNP_129:rs18213412;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400414.1	dbSNP	SNV	2109	2109	.	+	.	ID=2335;Variant_seq=C;Dbxref=dbSNP_129:rs21671143;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400414.1	dbSNP	SNV	2111	2111	.	+	.	ID=2336;Variant_seq=A;Dbxref=dbSNP_129:rs21671134;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400414.1	dbSNP	SNV	2113	2113	.	+	.	ID=2337;Variant_seq=C;Dbxref=dbSNP_129:rs21671125;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049533.1	dbSNP	SNV	672	672	.	+	.	ID=2338;Variant_seq=C;Dbxref=dbSNP_129:rs53305986;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049533.1	dbSNP	SNV	1032	1032	.	+	.	ID=2339;Variant_seq=C;Dbxref=dbSNP_129:rs52860698;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049533.1	dbSNP	SNV	1035	1035	.	+	.	ID=2340;Variant_seq=T;Dbxref=dbSNP_129:rs53891214;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049533.1	dbSNP	SNV	1039	1039	.	+	.	ID=2341;Variant_seq=A;Dbxref=dbSNP_129:rs53578032;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049533.1	dbSNP	SNV	1707	1707	.	+	.	ID=2342;Variant_seq=T;Dbxref=dbSNP_129:rs19360406;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049533.1	dbSNP	SNV	1714	1714	.	+	.	ID=2343;Variant_seq=T;Dbxref=dbSNP_129:rs19360446;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041866.1	dbSNP	SNV	305	305	.	+	.	ID=2344;Variant_seq=A;Dbxref=dbSNP_129:rs53031927;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041866.1	dbSNP	SNV	305	305	.	+	.	ID=2345;Variant_seq=A;Dbxref=dbSNP_129:rs53257034;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041866.1	dbSNP	SNV	2188	2188	.	+	.	ID=2346;Variant_seq=C;Dbxref=dbSNP_129:rs53950700;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041866.1	dbSNP	SNV	2278	2278	.	+	.	ID=2347;Variant_seq=T;Dbxref=dbSNP_129:rs53464404;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044573.1	dbSNP	SNV	1013	1013	.	+	.	ID=2348;Variant_seq=G;Dbxref=dbSNP_129:rs19936108;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044573.1	dbSNP	SNV	2057	2057	.	+	.	ID=2349;Variant_seq=C;Dbxref=dbSNP_129:rs21506211;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043154.1	dbSNP	SNV	2819	2819	.	+	.	ID=2350;Variant_seq=G;Dbxref=dbSNP_129:rs53042236;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043154.1	dbSNP	SNV	2867	2867	.	+	.	ID=2351;Variant_seq=C;Dbxref=dbSNP_129:rs54149029;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048124.1	dbSNP	SNV	1064	1064	.	+	.	ID=2352;Variant_seq=G;Dbxref=dbSNP_129:rs21185490;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048124.1	dbSNP	SNV	1072	1072	.	+	.	ID=2353;Variant_seq=A;Dbxref=dbSNP_129:rs21185460;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048124.1	dbSNP	SNV	1105	1105	.	+	.	ID=2354;Variant_seq=C;Dbxref=dbSNP_129:rs21185260;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048124.1	dbSNP	SNV	2196	2196	.	+	.	ID=2355;Variant_seq=A;Dbxref=dbSNP_129:rs19985277;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398661.1	dbSNP	SNV	1971	1971	.	+	.	ID=2356;Variant_seq=A;Dbxref=dbSNP_129:rs21262199;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398661.1	dbSNP	SNV	6286	6286	.	+	.	ID=2357;Variant_seq=G;Dbxref=dbSNP_129:rs20112623;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398661.1	dbSNP	SNV	6287	6287	.	+	.	ID=2358;Variant_seq=C;Dbxref=dbSNP_129:rs20112633;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043899.1	dbSNP	SNV	568	568	.	+	.	ID=2359;Variant_seq=G;Dbxref=dbSNP_129:rs18201225;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043899.1	dbSNP	SNV	581	581	.	+	.	ID=2360;Variant_seq=T;Dbxref=dbSNP_129:rs18201234;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043899.1	dbSNP	SNV	593	593	.	+	.	ID=2361;Variant_seq=G;Dbxref=dbSNP_129:rs18201243;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043899.1	dbSNP	SNV	755	755	.	+	.	ID=2362;Variant_seq=G;Dbxref=dbSNP_129:rs18201261;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043899.1	dbSNP	SNV	818	818	.	+	.	ID=2363;Variant_seq=T;Dbxref=dbSNP_129:rs18201270;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043899.1	dbSNP	SNV	845	845	.	+	.	ID=2364;Variant_seq=G;Dbxref=dbSNP_129:rs18201279;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043899.1	dbSNP	SNV	863	863	.	+	.	ID=2365;Variant_seq=C;Dbxref=dbSNP_129:rs18201297;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043899.1	dbSNP	SNV	914	914	.	+	.	ID=2366;Variant_seq=T;Dbxref=dbSNP_129:rs18201315;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043899.1	dbSNP	SNV	977	977	.	+	.	ID=2367;Variant_seq=G;Dbxref=dbSNP_129:rs18201324;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043899.1	dbSNP	SNV	1215	1215	.	+	.	ID=2368;Variant_seq=G;Dbxref=dbSNP_129:rs18201342;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043899.1	dbSNP	SNV	1707	1707	.	+	.	ID=2369;Variant_seq=A;Dbxref=dbSNP_129:rs53137879;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043899.1	dbSNP	deletion	1727	1730	.	+	.	ID=2370;Variant_seq=-;Dbxref=dbSNP_129:rs53835693;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=TGCA
AAAA02043899.1	dbSNP	SNV	1737	1737	.	+	.	ID=2371;Variant_seq=C;Dbxref=dbSNP_129:rs54025115;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043899.1	dbSNP	deletion	1738	1740	.	+	.	ID=2372;Variant_seq=-;Dbxref=dbSNP_129:rs52971987;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=GGG
AAAA02043899.1	dbSNP	SNV	1744	1744	.	+	.	ID=2373;Variant_seq=T;Dbxref=dbSNP_129:rs53765375;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043899.1	dbSNP	deletion	1747	1748	.	+	.	ID=2374;Variant_seq=-;Dbxref=dbSNP_129:rs54123062;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=GG
AAAA02043899.1	dbSNP	SNV	1752	1752	.	+	.	ID=2375;Variant_seq=A;Dbxref=dbSNP_129:rs54030312;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043899.1	dbSNP	SNV	1753	1753	.	+	.	ID=2376;Variant_seq=C;Dbxref=dbSNP_129:rs53943438;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043899.1	dbSNP	insertion	1786	1786	.	+	.	ID=2377;Variant_seq=C;Dbxref=dbSNP_129:rs53247933;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02043899.1	dbSNP	SNV	2011	2011	.	+	.	ID=2378;Variant_seq=T;Dbxref=dbSNP_129:rs18201387;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043899.1	dbSNP	deletion	2019	2019	.	+	.	ID=2379;Variant_seq=-;Dbxref=dbSNP_129:rs52990133;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043899.1	dbSNP	deletion	2023	2024	.	+	.	ID=2380;Variant_seq=-;Dbxref=dbSNP_129:rs53602973;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=CT
AAAA02043899.1	dbSNP	SNV	2032	2032	.	+	.	ID=2381;Variant_seq=A;Dbxref=dbSNP_129:rs54129575;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043899.1	dbSNP	SNV	2051	2051	.	+	.	ID=2382;Variant_seq=A;Dbxref=dbSNP_129:rs53635973;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043899.1	dbSNP	deletion	2064	2065	.	+	.	ID=2383;Variant_seq=-;Dbxref=dbSNP_129:rs53434973;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=GT
AAAA02043899.1	dbSNP	SNV	2174	2174	.	+	.	ID=2384;Variant_seq=G;Dbxref=dbSNP_129:rs53374753;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043899.1	dbSNP	SNV	2193	2193	.	+	.	ID=2385;Variant_seq=G;Dbxref=dbSNP_129:rs18201396;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043899.1	dbSNP	SNV	2197	2197	.	+	.	ID=2386;Variant_seq=T;Dbxref=dbSNP_129:rs53505154;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043899.1	dbSNP	SNV	2218	2218	.	+	.	ID=2387;Variant_seq=T;Dbxref=dbSNP_129:rs53189809;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043899.1	dbSNP	SNV	2219	2219	.	+	.	ID=2388;Variant_seq=G;Dbxref=dbSNP_129:rs53400904;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043899.1	dbSNP	SNV	2237	2237	.	+	.	ID=2389;Variant_seq=G;Dbxref=dbSNP_129:rs53716608;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043899.1	dbSNP	SNV	2240	2240	.	+	.	ID=2390;Variant_seq=G;Dbxref=dbSNP_129:rs53505780;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043899.1	dbSNP	SNV	2248	2248	.	+	.	ID=2391;Variant_seq=T;Dbxref=dbSNP_129:rs53751615;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043899.1	dbSNP	deletion	2264	2266	.	+	.	ID=2392;Variant_seq=-;Dbxref=dbSNP_129:rs54409698;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=GTA
AAAA02043899.1	dbSNP	SNV	2288	2288	.	+	.	ID=2393;Variant_seq=G;Dbxref=dbSNP_129:rs53082806;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043899.1	dbSNP	SNV	2292	2292	.	+	.	ID=2394;Variant_seq=T;Dbxref=dbSNP_129:rs53411130;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043899.1	dbSNP	SNV	2301	2301	.	+	.	ID=2395;Variant_seq=A;Dbxref=dbSNP_129:rs52966193;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043899.1	dbSNP	SNV	2336	2336	.	+	.	ID=2396;Variant_seq=C;Dbxref=dbSNP_129:rs54092410;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043899.1	dbSNP	deletion	2349	2354	.	+	.	ID=2397;Variant_seq=-;Dbxref=dbSNP_129:rs53594815;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=AAACAC
AAAA02043899.1	dbSNP	deletion	2357	2358	.	+	.	ID=2398;Variant_seq=-;Dbxref=dbSNP_129:rs54311232;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=CA
AAAA02043899.1	dbSNP	SNV	2362	2362	.	+	.	ID=2399;Variant_seq=G;Dbxref=dbSNP_129:rs53479784;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043899.1	dbSNP	deletion	2371	2372	.	+	.	ID=2400;Variant_seq=-;Dbxref=dbSNP_129:rs53067793;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=CA
AAAA02043899.1	dbSNP	deletion	2375	2375	.	+	.	ID=2401;Variant_seq=-;Dbxref=dbSNP_129:rs53729941;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043899.1	dbSNP	SNV	2380	2380	.	+	.	ID=2402;Variant_seq=G;Dbxref=dbSNP_129:rs53481270;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043899.1	dbSNP	SNV	2381	2381	.	+	.	ID=2403;Variant_seq=A;Dbxref=dbSNP_129:rs54038910;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043899.1	dbSNP	SNV	2384	2384	.	+	.	ID=2404;Variant_seq=A;Dbxref=dbSNP_129:rs53747235;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043899.1	dbSNP	SNV	2388	2388	.	+	.	ID=2405;Variant_seq=C;Dbxref=dbSNP_129:rs53820113;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043899.1	dbSNP	insertion	2421	2421	.	+	.	ID=2406;Variant_seq=CG;Dbxref=dbSNP_129:rs52934507;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02043899.1	dbSNP	deletion	2437	2438	.	+	.	ID=2407;Variant_seq=-;Dbxref=dbSNP_129:rs53142625;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=AT
AAAA02043899.1	dbSNP	deletion	2461	2463	.	+	.	ID=2408;Variant_seq=-;Dbxref=dbSNP_129:rs52846714;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=TCC
AAAA02043899.1	dbSNP	SNV	2465	2465	.	+	.	ID=2409;Variant_seq=T;Dbxref=dbSNP_129:rs54407095;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043899.1	dbSNP	SNV	2470	2470	.	+	.	ID=2410;Variant_seq=C;Dbxref=dbSNP_129:rs53376713;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043899.1	dbSNP	deletion	2478	2480	.	+	.	ID=2411;Variant_seq=-;Dbxref=dbSNP_129:rs52953384;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=TTC
AAAA02043899.1	dbSNP	insertion	2494	2494	.	+	.	ID=2412;Variant_seq=AATT;Dbxref=dbSNP_129:rs53121871;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02043899.1	dbSNP	SNV	2501	2501	.	+	.	ID=2413;Variant_seq=T;Dbxref=dbSNP_129:rs52899103;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043899.1	dbSNP	SNV	2533	2533	.	+	.	ID=2414;Variant_seq=T;Dbxref=dbSNP_129:rs18201405;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043899.1	dbSNP	SNV	2566	2566	.	+	.	ID=2415;Variant_seq=C;Dbxref=dbSNP_129:rs54121645;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043899.1	dbSNP	SNV	2567	2567	.	+	.	ID=2416;Variant_seq=G;Dbxref=dbSNP_129:rs53981025;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043899.1	dbSNP	SNV	2578	2578	.	+	.	ID=2417;Variant_seq=G;Dbxref=dbSNP_129:rs53235113;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043899.1	dbSNP	SNV	2765	2765	.	+	.	ID=2418;Variant_seq=T;Dbxref=dbSNP_129:rs18201414;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043899.1	dbSNP	SNV	3111	3111	.	+	.	ID=2419;Variant_seq=C;Dbxref=dbSNP_129:rs18201423;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	158	158	.	+	.	ID=2420;Variant_seq=G;Dbxref=dbSNP_129:rs20613255;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	164	164	.	+	.	ID=2421;Variant_seq=A;Dbxref=dbSNP_129:rs20613265;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	181	181	.	+	.	ID=2422;Variant_seq=C;Dbxref=dbSNP_129:rs20613275;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	279	279	.	+	.	ID=2423;Variant_seq=A;Dbxref=dbSNP_129:rs20613295;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	291	291	.	+	.	ID=2424;Variant_seq=G;Dbxref=dbSNP_129:rs20613305;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	295	295	.	+	.	ID=2425;Variant_seq=T;Dbxref=dbSNP_129:rs20613315;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	296	296	.	+	.	ID=2426;Variant_seq=G;Dbxref=dbSNP_129:rs20613325;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	479	479	.	+	.	ID=2427;Variant_seq=T;Dbxref=dbSNP_129:rs20613385;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	540	540	.	+	.	ID=2428;Variant_seq=A;Dbxref=dbSNP_129:rs20613405;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	599	599	.	+	.	ID=2429;Variant_seq=T;Dbxref=dbSNP_129:rs20613415;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	639	639	.	+	.	ID=2430;Variant_seq=C;Dbxref=dbSNP_129:rs20613425;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	697	697	.	+	.	ID=2431;Variant_seq=C;Dbxref=dbSNP_129:rs20613445;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	711	711	.	+	.	ID=2432;Variant_seq=C;Dbxref=dbSNP_129:rs20613455;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	813	813	.	+	.	ID=2433;Variant_seq=G;Dbxref=dbSNP_129:rs20613475;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	901	901	.	+	.	ID=2434;Variant_seq=C;Dbxref=dbSNP_129:rs20613495;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	1043	1043	.	+	.	ID=2435;Variant_seq=C;Dbxref=dbSNP_129:rs20613525;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	1096	1096	.	+	.	ID=2436;Variant_seq=T;Dbxref=dbSNP_129:rs20613555;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1113	1113	.	+	.	ID=2437;Variant_seq=G;Dbxref=dbSNP_129:rs20613575;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	1133	1133	.	+	.	ID=2438;Variant_seq=A;Dbxref=dbSNP_129:rs20613595;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1442	1442	.	+	.	ID=2439;Variant_seq=G;Dbxref=dbSNP_129:rs20346962;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	1453	1453	.	+	.	ID=2440;Variant_seq=T;Dbxref=dbSNP_129:rs20346972;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1455	1455	.	+	.	ID=2441;Variant_seq=G;Dbxref=dbSNP_129:rs20346982;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	1461	1461	.	+	.	ID=2442;Variant_seq=A;Dbxref=dbSNP_129:rs20346992;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	1463	1463	.	+	.	ID=2443;Variant_seq=G;Dbxref=dbSNP_129:rs20347002;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	1464	1464	.	+	.	ID=2444;Variant_seq=T;Dbxref=dbSNP_129:rs20347012;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1473	1473	.	+	.	ID=2445;Variant_seq=G;Dbxref=dbSNP_129:rs20347022;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	1479	1479	.	+	.	ID=2446;Variant_seq=T;Dbxref=dbSNP_129:rs20347032;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1485	1485	.	+	.	ID=2447;Variant_seq=G;Dbxref=dbSNP_129:rs20347042;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	1491	1491	.	+	.	ID=2448;Variant_seq=T;Dbxref=dbSNP_129:rs20347062;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1494	1494	.	+	.	ID=2449;Variant_seq=T;Dbxref=dbSNP_129:rs20347072;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1496	1496	.	+	.	ID=2450;Variant_seq=C;Dbxref=dbSNP_129:rs20347082;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1498	1498	.	+	.	ID=2451;Variant_seq=T;Dbxref=dbSNP_129:rs20347092;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1499	1499	.	+	.	ID=2452;Variant_seq=A;Dbxref=dbSNP_129:rs20347102;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1500	1500	.	+	.	ID=2453;Variant_seq=G;Dbxref=dbSNP_129:rs20347112;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1503	1503	.	+	.	ID=2454;Variant_seq=A;Dbxref=dbSNP_129:rs20347122;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1509	1509	.	+	.	ID=2455;Variant_seq=T;Dbxref=dbSNP_129:rs20347142;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1515	1515	.	+	.	ID=2456;Variant_seq=T;Dbxref=dbSNP_129:rs20347152;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1524	1524	.	+	.	ID=2457;Variant_seq=G;Dbxref=dbSNP_129:rs20347162;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	1526	1526	.	+	.	ID=2458;Variant_seq=T;Dbxref=dbSNP_129:rs20347172;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	1531	1531	.	+	.	ID=2459;Variant_seq=T;Dbxref=dbSNP_129:rs20347182;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1532	1532	.	+	.	ID=2460;Variant_seq=G;Dbxref=dbSNP_129:rs20347192;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	1533	1533	.	+	.	ID=2461;Variant_seq=A;Dbxref=dbSNP_129:rs20347202;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1539	1539	.	+	.	ID=2462;Variant_seq=T;Dbxref=dbSNP_129:rs20347212;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1545	1545	.	+	.	ID=2463;Variant_seq=T;Dbxref=dbSNP_129:rs20347222;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1548	1548	.	+	.	ID=2464;Variant_seq=T;Dbxref=dbSNP_129:rs20347232;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1551	1551	.	+	.	ID=2465;Variant_seq=A;Dbxref=dbSNP_129:rs20347242;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1562	1562	.	+	.	ID=2466;Variant_seq=G;Dbxref=dbSNP_129:rs20347262;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	1572	1572	.	+	.	ID=2467;Variant_seq=A;Dbxref=dbSNP_129:rs20347272;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1746	1746	.	+	.	ID=2468;Variant_seq=G;Dbxref=dbSNP_129:rs20347662;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1755	1755	.	+	.	ID=2469;Variant_seq=A;Dbxref=dbSNP_129:rs20347672;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1761	1761	.	+	.	ID=2470;Variant_seq=A;Dbxref=dbSNP_129:rs20347682;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1767	1767	.	+	.	ID=2471;Variant_seq=A;Dbxref=dbSNP_129:rs20347692;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1769	1769	.	+	.	ID=2472;Variant_seq=T;Dbxref=dbSNP_129:rs20347702;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1775	1775	.	+	.	ID=2473;Variant_seq=G;Dbxref=dbSNP_129:rs20347712;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	1776	1776	.	+	.	ID=2474;Variant_seq=C;Dbxref=dbSNP_129:rs20347722;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1777	1777	.	+	.	ID=2475;Variant_seq=C;Dbxref=dbSNP_129:rs20347732;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1785	1785	.	+	.	ID=2476;Variant_seq=T;Dbxref=dbSNP_129:rs20347752;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1789	1789	.	+	.	ID=2477;Variant_seq=G;Dbxref=dbSNP_129:rs20347762;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	1790	1790	.	+	.	ID=2478;Variant_seq=T;Dbxref=dbSNP_129:rs20347772;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1796	1796	.	+	.	ID=2479;Variant_seq=T;Dbxref=dbSNP_129:rs20347792;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	1797	1797	.	+	.	ID=2480;Variant_seq=C;Dbxref=dbSNP_129:rs20347802;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1798	1798	.	+	.	ID=2481;Variant_seq=T;Dbxref=dbSNP_129:rs20347812;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1799	1799	.	+	.	ID=2482;Variant_seq=T;Dbxref=dbSNP_129:rs20347822;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1800	1800	.	+	.	ID=2483;Variant_seq=C;Dbxref=dbSNP_129:rs20347832;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1804	1804	.	+	.	ID=2484;Variant_seq=T;Dbxref=dbSNP_129:rs20347842;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1807	1807	.	+	.	ID=2485;Variant_seq=G;Dbxref=dbSNP_129:rs20347852;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1808	1808	.	+	.	ID=2486;Variant_seq=G;Dbxref=dbSNP_129:rs20347862;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	1811	1811	.	+	.	ID=2487;Variant_seq=G;Dbxref=dbSNP_129:rs20347872;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1812	1812	.	+	.	ID=2488;Variant_seq=A;Dbxref=dbSNP_129:rs20347882;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1813	1813	.	+	.	ID=2489;Variant_seq=A;Dbxref=dbSNP_129:rs20347892;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	1814	1814	.	+	.	ID=2490;Variant_seq=A;Dbxref=dbSNP_129:rs20347902;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1827	1827	.	+	.	ID=2491;Variant_seq=A;Dbxref=dbSNP_129:rs20347932;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1830	1830	.	+	.	ID=2492;Variant_seq=T;Dbxref=dbSNP_129:rs20347942;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1833	1833	.	+	.	ID=2493;Variant_seq=A;Dbxref=dbSNP_129:rs20347952;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1834	1834	.	+	.	ID=2494;Variant_seq=T;Dbxref=dbSNP_129:rs20347962;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1835	1835	.	+	.	ID=2495;Variant_seq=C;Dbxref=dbSNP_129:rs20347972;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1836	1836	.	+	.	ID=2496;Variant_seq=C;Dbxref=dbSNP_129:rs20347982;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	1837	1837	.	+	.	ID=2497;Variant_seq=A;Dbxref=dbSNP_129:rs20347992;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1848	1848	.	+	.	ID=2498;Variant_seq=T;Dbxref=dbSNP_129:rs20348002;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1854	1854	.	+	.	ID=2499;Variant_seq=G;Dbxref=dbSNP_129:rs20348012;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1856	1856	.	+	.	ID=2500;Variant_seq=T;Dbxref=dbSNP_129:rs20348022;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1857	1857	.	+	.	ID=2501;Variant_seq=G;Dbxref=dbSNP_129:rs20348032;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	1863	1863	.	+	.	ID=2502;Variant_seq=A;Dbxref=dbSNP_129:rs20348042;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1870	1870	.	+	.	ID=2503;Variant_seq=A;Dbxref=dbSNP_129:rs20348062;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1875	1875	.	+	.	ID=2504;Variant_seq=A;Dbxref=dbSNP_129:rs20348082;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	1878	1878	.	+	.	ID=2505;Variant_seq=T;Dbxref=dbSNP_129:rs20348092;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1893	1893	.	+	.	ID=2506;Variant_seq=C;Dbxref=dbSNP_129:rs20348112;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	1899	1899	.	+	.	ID=2507;Variant_seq=G;Dbxref=dbSNP_129:rs20348122;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	1903	1903	.	+	.	ID=2508;Variant_seq=T;Dbxref=dbSNP_129:rs20348132;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	1907	1907	.	+	.	ID=2509;Variant_seq=G;Dbxref=dbSNP_129:rs20348142;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	2188	2188	.	+	.	ID=2510;Variant_seq=A;Dbxref=dbSNP_129:rs18946787;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	2208	2208	.	+	.	ID=2511;Variant_seq=C;Dbxref=dbSNP_129:rs20614527;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	2219	2219	.	+	.	ID=2512;Variant_seq=G;Dbxref=dbSNP_129:rs20614537;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	2242	2242	.	+	.	ID=2513;Variant_seq=C;Dbxref=dbSNP_129:rs20614547;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	2246	2246	.	+	.	ID=2514;Variant_seq=G;Dbxref=dbSNP_129:rs20614557;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	2267	2267	.	+	.	ID=2515;Variant_seq=T;Dbxref=dbSNP_129:rs20614567;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	2274	2274	.	+	.	ID=2516;Variant_seq=T;Dbxref=dbSNP_129:rs20614577;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	2326	2326	.	+	.	ID=2517;Variant_seq=T;Dbxref=dbSNP_129:rs20614597;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	2388	2388	.	+	.	ID=2518;Variant_seq=T;Dbxref=dbSNP_129:rs20614627;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	insertion	2417	2417	.	+	.	ID=2519;Variant_seq=GACGGAGGAGGCTG;Dbxref=dbSNP_129:rs53274265;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH399358.1	dbSNP	SNV	2459	2459	.	+	.	ID=2520;Variant_seq=C;Dbxref=dbSNP_129:rs20614647;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	2461	2461	.	+	.	ID=2521;Variant_seq=A;Dbxref=dbSNP_129:rs20614657;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	2462	2462	.	+	.	ID=2522;Variant_seq=T;Dbxref=dbSNP_129:rs20614667;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	2472	2472	.	+	.	ID=2523;Variant_seq=C;Dbxref=dbSNP_129:rs20614677;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	2507	2507	.	+	.	ID=2524;Variant_seq=G;Dbxref=dbSNP_129:rs20614707;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	2519	2519	.	+	.	ID=2525;Variant_seq=G;Dbxref=dbSNP_129:rs20614727;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	2522	2522	.	+	.	ID=2526;Variant_seq=C;Dbxref=dbSNP_129:rs20614737;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	2591	2591	.	+	.	ID=2527;Variant_seq=G;Dbxref=dbSNP_129:rs20614757;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	2654	2654	.	+	.	ID=2528;Variant_seq=A;Dbxref=dbSNP_129:rs20614767;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	2662	2662	.	+	.	ID=2529;Variant_seq=G;Dbxref=dbSNP_129:rs20614777;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	2679	2679	.	+	.	ID=2530;Variant_seq=A;Dbxref=dbSNP_129:rs20614797;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	3094	3094	.	+	.	ID=2531;Variant_seq=C;Dbxref=dbSNP_129:rs20614897;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	3207	3207	.	+	.	ID=2532;Variant_seq=A;Dbxref=dbSNP_129:rs20614937;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	3230	3230	.	+	.	ID=2533;Variant_seq=G;Dbxref=dbSNP_129:rs20614957;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	3236	3236	.	+	.	ID=2534;Variant_seq=C;Dbxref=dbSNP_129:rs20614967;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	3449	3449	.	+	.	ID=2535;Variant_seq=T;Dbxref=dbSNP_129:rs20615037;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	3458	3458	.	+	.	ID=2536;Variant_seq=C;Dbxref=dbSNP_129:rs20615047;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399358.1	dbSNP	SNV	3471	3471	.	+	.	ID=2537;Variant_seq=G;Dbxref=dbSNP_129:rs20615057;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399358.1	dbSNP	SNV	3492	3492	.	+	.	ID=2538;Variant_seq=G;Dbxref=dbSNP_129:rs20615067;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399358.1	dbSNP	SNV	3517	3517	.	+	.	ID=2539;Variant_seq=G;Dbxref=dbSNP_129:rs20615077;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399358.1	dbSNP	SNV	4791	4791	.	+	.	ID=2540;Variant_seq=C;Dbxref=dbSNP_129:rs18027543;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038797.1	dbSNP	SNV	1204	1204	.	+	.	ID=2541;Variant_seq=T;Dbxref=dbSNP_129:rs20773455;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038797.1	dbSNP	SNV	1211	1211	.	+	.	ID=2542;Variant_seq=C;Dbxref=dbSNP_129:rs20773445;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038797.1	dbSNP	SNV	1220	1220	.	+	.	ID=2543;Variant_seq=A;Dbxref=dbSNP_129:rs20773425;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038797.1	dbSNP	SNV	1223	1223	.	+	.	ID=2544;Variant_seq=G;Dbxref=dbSNP_129:rs20773415;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038797.1	dbSNP	SNV	1232	1232	.	+	.	ID=2545;Variant_seq=T;Dbxref=dbSNP_129:rs20773405;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038797.1	dbSNP	SNV	1246	1246	.	+	.	ID=2546;Variant_seq=A;Dbxref=dbSNP_129:rs20773395;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038797.1	dbSNP	SNV	1247	1247	.	+	.	ID=2547;Variant_seq=A;Dbxref=dbSNP_129:rs20773385;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038797.1	dbSNP	SNV	1250	1250	.	+	.	ID=2548;Variant_seq=T;Dbxref=dbSNP_129:rs20773375;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038797.1	dbSNP	SNV	1251	1251	.	+	.	ID=2549;Variant_seq=G;Dbxref=dbSNP_129:rs20773365;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038797.1	dbSNP	SNV	1257	1257	.	+	.	ID=2550;Variant_seq=A;Dbxref=dbSNP_129:rs20773335;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038797.1	dbSNP	SNV	1259	1259	.	+	.	ID=2551;Variant_seq=G;Dbxref=dbSNP_129:rs20773325;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038797.1	dbSNP	SNV	1271	1271	.	+	.	ID=2552;Variant_seq=C;Dbxref=dbSNP_129:rs20773295;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038797.1	dbSNP	SNV	1274	1274	.	+	.	ID=2553;Variant_seq=G;Dbxref=dbSNP_129:rs20773285;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038797.1	dbSNP	insertion	3601	3601	.	+	.	ID=2554;Variant_seq=A;Dbxref=dbSNP_129:rs52919855;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02038797.1	dbSNP	SNV	3603	3603	.	+	.	ID=2555;Variant_seq=C;Dbxref=dbSNP_129:rs54093153;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041605.1	dbSNP	SNV	231	231	.	+	.	ID=2556;Variant_seq=C;Dbxref=dbSNP_129:rs53550044;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399478.1	dbSNP	SNV	221	221	.	+	.	ID=2557;Variant_seq=T;Dbxref=dbSNP_129:rs18942098;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399478.1	dbSNP	SNV	253	253	.	+	.	ID=2558;Variant_seq=C;Dbxref=dbSNP_129:rs20613525;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399478.1	dbSNP	SNV	3249	3249	.	+	.	ID=2559;Variant_seq=A;Dbxref=dbSNP_129:rs20611695;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399478.1	dbSNP	SNV	3250	3250	.	+	.	ID=2560;Variant_seq=C;Dbxref=dbSNP_129:rs20611685;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399478.1	dbSNP	SNV	3254	3254	.	+	.	ID=2561;Variant_seq=T;Dbxref=dbSNP_129:rs20611675;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399478.1	dbSNP	SNV	3732	3732	.	+	.	ID=2562;Variant_seq=A;Dbxref=dbSNP_129:rs20611065;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399478.1	dbSNP	SNV	4990	4990	.	+	.	ID=2563;Variant_seq=T;Dbxref=dbSNP_129:rs20882813;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399478.1	dbSNP	SNV	5071	5071	.	+	.	ID=2564;Variant_seq=T;Dbxref=dbSNP_129:rs53133866;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043191.1	dbSNP	SNV	3279	3279	.	+	.	ID=2565;Variant_seq=C;Dbxref=dbSNP_129:rs53447741;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043191.1	dbSNP	SNV	3288	3288	.	+	.	ID=2566;Variant_seq=A;Dbxref=dbSNP_129:rs53627069;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043191.1	dbSNP	SNV	3288	3288	.	+	.	ID=2567;Variant_seq=A;Dbxref=dbSNP_129:rs52866259;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043191.1	dbSNP	SNV	3289	3289	.	+	.	ID=2568;Variant_seq=A;Dbxref=dbSNP_129:rs53117006;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043191.1	dbSNP	SNV	3295	3295	.	+	.	ID=2569;Variant_seq=G;Dbxref=dbSNP_129:rs53331361;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043191.1	dbSNP	SNV	3295	3295	.	+	.	ID=2570;Variant_seq=G;Dbxref=dbSNP_129:rs52883976;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02035472.1	dbSNP	SNV	1373	1373	.	+	.	ID=2571;Variant_seq=A;Dbxref=dbSNP_129:rs53826322;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02035472.1	dbSNP	SNV	1435	1435	.	+	.	ID=2572;Variant_seq=G;Dbxref=dbSNP_129:rs53054517;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02035472.1	dbSNP	insertion	6956	6956	.	+	.	ID=2573;Variant_seq=TC;Dbxref=dbSNP_129:rs53650764;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02035472.1	dbSNP	SNV	11044	11044	.	+	.	ID=2574;Variant_seq=A;Dbxref=dbSNP_129:rs54070945;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035472.1	dbSNP	SNV	11058	11058	.	+	.	ID=2575;Variant_seq=T;Dbxref=dbSNP_129:rs54399583;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02035472.1	dbSNP	SNV	13035	13035	.	+	.	ID=2576;Variant_seq=T;Dbxref=dbSNP_129:rs53102578;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035472.1	dbSNP	SNV	24681	24681	.	+	.	ID=2577;Variant_seq=T;Dbxref=dbSNP_129:rs19406069;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035472.1	dbSNP	SNV	24722	24722	.	+	.	ID=2578;Variant_seq=A;Dbxref=dbSNP_129:rs19406019;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035472.1	dbSNP	SNV	24735	24735	.	+	.	ID=2579;Variant_seq=T;Dbxref=dbSNP_129:rs19406009;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035472.1	dbSNP	SNV	32441	32441	.	+	.	ID=2580;Variant_seq=A;Dbxref=dbSNP_129:rs19906369;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02035472.1	dbSNP	SNV	33452	33452	.	+	.	ID=2581;Variant_seq=T;Dbxref=dbSNP_129:rs21176042;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02035472.1	dbSNP	SNV	37823	37823	.	+	.	ID=2582;Variant_seq=G;Dbxref=dbSNP_129:rs53056817;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02035472.1	dbSNP	SNV	37824	37824	.	+	.	ID=2583;Variant_seq=A;Dbxref=dbSNP_129:rs54057325;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02035472.1	dbSNP	SNV	37830	37830	.	+	.	ID=2584;Variant_seq=T;Dbxref=dbSNP_129:rs53706857;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02035472.1	dbSNP	SNV	46091	46091	.	+	.	ID=2585;Variant_seq=C;Dbxref=dbSNP_129:rs53493902;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02035472.1	dbSNP	SNV	46098	46098	.	+	.	ID=2586;Variant_seq=C;Dbxref=dbSNP_129:rs53211955;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02035472.1	dbSNP	SNV	46100	46100	.	+	.	ID=2587;Variant_seq=A;Dbxref=dbSNP_129:rs54219184;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02035472.1	dbSNP	SNV	46108	46108	.	+	.	ID=2588;Variant_seq=A;Dbxref=dbSNP_129:rs20675141;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02035472.1	dbSNP	SNV	46152	46152	.	+	.	ID=2589;Variant_seq=C;Dbxref=dbSNP_129:rs52857384;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02035472.1	dbSNP	insertion	46172	46172	.	+	.	ID=2590;Variant_seq=A;Dbxref=dbSNP_129:rs53772123;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02035472.1	dbSNP	SNV	46252	46252	.	+	.	ID=2591;Variant_seq=C;Dbxref=dbSNP_129:rs53903855;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02035472.1	dbSNP	SNV	46255	46255	.	+	.	ID=2592;Variant_seq=T;Dbxref=dbSNP_129:rs54120772;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035472.1	dbSNP	SNV	46300	46300	.	+	.	ID=2593;Variant_seq=A;Dbxref=dbSNP_129:rs53160548;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02035472.1	dbSNP	insertion	58334	58334	.	+	.	ID=2594;Variant_seq=GAT;Dbxref=dbSNP_129:rs53306982;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02045053.1	dbSNP	SNV	2950	2950	.	+	.	ID=2595;Variant_seq=G;Dbxref=dbSNP_129:rs19038625;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045053.1	dbSNP	SNV	2951	2951	.	+	.	ID=2596;Variant_seq=T;Dbxref=dbSNP_129:rs19038635;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045053.1	dbSNP	SNV	2955	2955	.	+	.	ID=2597;Variant_seq=T;Dbxref=dbSNP_129:rs19038645;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041548.1	dbSNP	SNV	1769	1769	.	+	.	ID=2598;Variant_seq=C;Dbxref=dbSNP_129:rs21242238;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042075.1	dbSNP	SNV	1451	1451	.	+	.	ID=2599;Variant_seq=T;Dbxref=dbSNP_129:rs53031342;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042075.1	dbSNP	SNV	1461	1461	.	+	.	ID=2600;Variant_seq=C;Dbxref=dbSNP_129:rs53596921;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042075.1	dbSNP	SNV	1463	1463	.	+	.	ID=2601;Variant_seq=T;Dbxref=dbSNP_129:rs53725679;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042075.1	dbSNP	SNV	1463	1463	.	+	.	ID=2602;Variant_seq=T;Dbxref=dbSNP_129:rs53083223;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042075.1	dbSNP	SNV	1477	1477	.	+	.	ID=2603;Variant_seq=A;Dbxref=dbSNP_129:rs54403053;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042075.1	dbSNP	SNV	1479	1479	.	+	.	ID=2604;Variant_seq=C;Dbxref=dbSNP_129:rs53369438;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042075.1	dbSNP	SNV	1491	1491	.	+	.	ID=2605;Variant_seq=T;Dbxref=dbSNP_129:rs54303203;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042075.1	dbSNP	SNV	1513	1513	.	+	.	ID=2606;Variant_seq=T;Dbxref=dbSNP_129:rs53517637;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042075.1	dbSNP	SNV	1619	1619	.	+	.	ID=2607;Variant_seq=A;Dbxref=dbSNP_129:rs52922175;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042075.1	dbSNP	SNV	1669	1669	.	+	.	ID=2608;Variant_seq=G;Dbxref=dbSNP_129:rs54069062;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042075.1	dbSNP	SNV	2721	2721	.	+	.	ID=2609;Variant_seq=A;Dbxref=dbSNP_129:rs21302897;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400010.1	dbSNP	SNV	311	311	.	+	.	ID=2610;Variant_seq=A;Dbxref=dbSNP_129:rs19081147;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400010.1	dbSNP	SNV	2031	2031	.	+	.	ID=2611;Variant_seq=A,T;Dbxref=dbSNP_129:rs53642471;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400010.1	dbSNP	SNV	2032	2032	.	+	.	ID=2612;Variant_seq=A;Dbxref=dbSNP_129:rs53029390;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400010.1	dbSNP	SNV	2038	2038	.	+	.	ID=2613;Variant_seq=A;Dbxref=dbSNP_129:rs54388891;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400010.1	dbSNP	SNV	2041	2041	.	+	.	ID=2614;Variant_seq=T;Dbxref=dbSNP_129:rs54360241;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400010.1	dbSNP	SNV	3481	3481	.	+	.	ID=2615;Variant_seq=A;Dbxref=dbSNP_129:rs53092959;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400010.1	dbSNP	SNV	3490	3490	.	+	.	ID=2616;Variant_seq=C;Dbxref=dbSNP_129:rs53215693;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400010.1	dbSNP	SNV	3491	3491	.	+	.	ID=2617;Variant_seq=C;Dbxref=dbSNP_129:rs53162906;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400010.1	dbSNP	SNV	3561	3561	.	+	.	ID=2618;Variant_seq=G;Dbxref=dbSNP_129:rs54277078;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400010.1	dbSNP	SNV	3596	3596	.	+	.	ID=2619;Variant_seq=T;Dbxref=dbSNP_129:rs53226547;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400010.1	dbSNP	SNV	3723	3723	.	+	.	ID=2620;Variant_seq=T;Dbxref=dbSNP_129:rs54125606;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400010.1	dbSNP	SNV	3750	3750	.	+	.	ID=2621;Variant_seq=C;Dbxref=dbSNP_129:rs54370781;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400010.1	dbSNP	SNV	3776	3776	.	+	.	ID=2622;Variant_seq=C;Dbxref=dbSNP_129:rs53577111;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046175.1	dbSNP	SNV	1157	1157	.	+	.	ID=2623;Variant_seq=T;Dbxref=dbSNP_129:rs52848657;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046175.1	dbSNP	SNV	1589	1589	.	+	.	ID=2624;Variant_seq=C;Dbxref=dbSNP_129:rs21763741;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399964.1	dbSNP	SNV	2842	2842	.	+	.	ID=2625;Variant_seq=C;Dbxref=dbSNP_129:rs20891910;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399964.1	dbSNP	SNV	2854	2854	.	+	.	ID=2626;Variant_seq=G;Dbxref=dbSNP_129:rs20891930;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399964.1	dbSNP	SNV	2891	2891	.	+	.	ID=2627;Variant_seq=A;Dbxref=dbSNP_129:rs20891990;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038182.1	dbSNP	SNV	6834	6834	.	+	.	ID=2628;Variant_seq=A;Dbxref=dbSNP_129:rs53272003;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398556.1	dbSNP	SNV	2087	2087	.	+	.	ID=2629;Variant_seq=A;Dbxref=dbSNP_129:rs53278843;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398556.1	dbSNP	SNV	2089	2089	.	+	.	ID=2630;Variant_seq=T;Dbxref=dbSNP_129:rs52852939;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398556.1	dbSNP	SNV	2572	2572	.	+	.	ID=2631;Variant_seq=A;Dbxref=dbSNP_129:rs52998347;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398556.1	dbSNP	SNV	6363	6363	.	+	.	ID=2632;Variant_seq=T;Dbxref=dbSNP_129:rs19129052;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398556.1	dbSNP	SNV	6372	6372	.	+	.	ID=2633;Variant_seq=T;Dbxref=dbSNP_129:rs19129012;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398556.1	dbSNP	SNV	6373	6373	.	+	.	ID=2634;Variant_seq=G;Dbxref=dbSNP_129:rs19129002;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398556.1	dbSNP	SNV	6374	6374	.	+	.	ID=2635;Variant_seq=T;Dbxref=dbSNP_129:rs19128992;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398556.1	dbSNP	SNV	6375	6375	.	+	.	ID=2636;Variant_seq=T;Dbxref=dbSNP_129:rs19128982;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398556.1	dbSNP	SNV	6381	6381	.	+	.	ID=2637;Variant_seq=T;Dbxref=dbSNP_129:rs19128952;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398556.1	dbSNP	SNV	6382	6382	.	+	.	ID=2638;Variant_seq=G;Dbxref=dbSNP_129:rs19128942;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398556.1	dbSNP	SNV	7861	7861	.	+	.	ID=2639;Variant_seq=A;Dbxref=dbSNP_129:rs19977154;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398556.1	dbSNP	SNV	7871	7871	.	+	.	ID=2640;Variant_seq=A;Dbxref=dbSNP_129:rs19977174;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398556.1	dbSNP	SNV	9915	9915	.	+	.	ID=2641;Variant_seq=G;Dbxref=dbSNP_129:rs21336000;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398556.1	dbSNP	SNV	12413	12413	.	+	.	ID=2642;Variant_seq=G;Dbxref=dbSNP_129:rs18262821;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02037325.1	dbSNP	SNV	3618	3618	.	+	.	ID=2643;Variant_seq=A;Dbxref=dbSNP_129:rs54310724;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037325.1	dbSNP	SNV	3620	3620	.	+	.	ID=2644;Variant_seq=C;Dbxref=dbSNP_129:rs54109102;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037325.1	dbSNP	SNV	3635	3635	.	+	.	ID=2645;Variant_seq=A;Dbxref=dbSNP_129:rs53314903;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037325.1	dbSNP	SNV	3644	3644	.	+	.	ID=2646;Variant_seq=A;Dbxref=dbSNP_129:rs54099046;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037325.1	dbSNP	SNV	3646	3646	.	+	.	ID=2647;Variant_seq=A;Dbxref=dbSNP_129:rs52949327;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037325.1	dbSNP	SNV	3650	3650	.	+	.	ID=2648;Variant_seq=A;Dbxref=dbSNP_129:rs53175296;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037325.1	dbSNP	SNV	3655	3655	.	+	.	ID=2649;Variant_seq=T;Dbxref=dbSNP_129:rs53241271;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037325.1	dbSNP	SNV	3665	3665	.	+	.	ID=2650;Variant_seq=T;Dbxref=dbSNP_129:rs54069076;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037325.1	dbSNP	SNV	4414	4414	.	+	.	ID=2651;Variant_seq=C;Dbxref=dbSNP_129:rs20695029;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037325.1	dbSNP	SNV	7445	7445	.	+	.	ID=2652;Variant_seq=T;Dbxref=dbSNP_129:rs21577694;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037325.1	dbSNP	SNV	8621	8621	.	+	.	ID=2653;Variant_seq=A;Dbxref=dbSNP_129:rs52922258;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037325.1	dbSNP	SNV	8770	8770	.	+	.	ID=2654;Variant_seq=T;Dbxref=dbSNP_129:rs53822746;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049944.1	dbSNP	SNV	687	687	.	+	.	ID=2655;Variant_seq=A;Dbxref=dbSNP_129:rs19019087;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049944.1	dbSNP	SNV	1766	1766	.	+	.	ID=2656;Variant_seq=A;Dbxref=dbSNP_129:rs19601110;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045638.1	dbSNP	SNV	2386	2386	.	+	.	ID=2657;Variant_seq=G;Dbxref=dbSNP_129:rs53107817;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045575.1	dbSNP	SNV	2147	2147	.	+	.	ID=2658;Variant_seq=T;Dbxref=dbSNP_129:rs20955185;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044458.1	dbSNP	SNV	104	104	.	+	.	ID=2659;Variant_seq=T;Dbxref=dbSNP_129:rs21067772;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044458.1	dbSNP	SNV	107	107	.	+	.	ID=2660;Variant_seq=A;Dbxref=dbSNP_129:rs21067762;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044458.1	dbSNP	SNV	119	119	.	+	.	ID=2661;Variant_seq=G;Dbxref=dbSNP_129:rs21067752;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044458.1	dbSNP	SNV	124	124	.	+	.	ID=2662;Variant_seq=C;Dbxref=dbSNP_129:rs21067742;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044458.1	dbSNP	SNV	128	128	.	+	.	ID=2663;Variant_seq=A;Dbxref=dbSNP_129:rs21067722;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044458.1	dbSNP	SNV	131	131	.	+	.	ID=2664;Variant_seq=T;Dbxref=dbSNP_129:rs21067713;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044458.1	dbSNP	SNV	149	149	.	+	.	ID=2665;Variant_seq=G;Dbxref=dbSNP_129:rs21067703;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044458.1	dbSNP	SNV	152	152	.	+	.	ID=2666;Variant_seq=T;Dbxref=dbSNP_129:rs21067693;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044458.1	dbSNP	SNV	164	164	.	+	.	ID=2667;Variant_seq=C;Dbxref=dbSNP_129:rs21067683;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044458.1	dbSNP	SNV	167	167	.	+	.	ID=2668;Variant_seq=G;Dbxref=dbSNP_129:rs21067673;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044458.1	dbSNP	SNV	185	185	.	+	.	ID=2669;Variant_seq=C;Dbxref=dbSNP_129:rs21067653;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044458.1	dbSNP	SNV	200	200	.	+	.	ID=2670;Variant_seq=C;Dbxref=dbSNP_129:rs21067643;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044458.1	dbSNP	SNV	221	221	.	+	.	ID=2671;Variant_seq=G;Dbxref=dbSNP_129:rs21067633;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044458.1	dbSNP	SNV	241	241	.	+	.	ID=2672;Variant_seq=A;Dbxref=dbSNP_129:rs21067613;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044458.1	dbSNP	SNV	242	242	.	+	.	ID=2673;Variant_seq=T;Dbxref=dbSNP_129:rs21067603;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044458.1	dbSNP	SNV	252	252	.	+	.	ID=2674;Variant_seq=A;Dbxref=dbSNP_129:rs21067583;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044458.1	dbSNP	SNV	269	269	.	+	.	ID=2675;Variant_seq=C;Dbxref=dbSNP_129:rs21067573;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044458.1	dbSNP	SNV	302	302	.	+	.	ID=2676;Variant_seq=A;Dbxref=dbSNP_129:rs21067553;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044458.1	dbSNP	SNV	314	314	.	+	.	ID=2677;Variant_seq=A;Dbxref=dbSNP_129:rs21067533;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044458.1	dbSNP	SNV	548	548	.	+	.	ID=2678;Variant_seq=G;Dbxref=dbSNP_129:rs21067403;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044458.1	dbSNP	SNV	950	950	.	+	.	ID=2679;Variant_seq=A;Dbxref=dbSNP_129:rs21067273;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044458.1	dbSNP	SNV	962	962	.	+	.	ID=2680;Variant_seq=C;Dbxref=dbSNP_129:rs21067253;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044458.1	dbSNP	SNV	999	999	.	+	.	ID=2681;Variant_seq=A;Dbxref=dbSNP_129:rs21067202;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044458.1	dbSNP	SNV	1294	1294	.	+	.	ID=2682;Variant_seq=G;Dbxref=dbSNP_129:rs19611967;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048436.1	dbSNP	SNV	50	50	.	+	.	ID=2683;Variant_seq=G;Dbxref=dbSNP_129:rs19394856;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048436.1	dbSNP	SNV	476	476	.	+	.	ID=2684;Variant_seq=G;Dbxref=dbSNP_129:rs19394806;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048436.1	dbSNP	SNV	503	503	.	+	.	ID=2685;Variant_seq=A;Dbxref=dbSNP_129:rs19394796;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048436.1	dbSNP	SNV	549	549	.	+	.	ID=2686;Variant_seq=C,G;Dbxref=dbSNP_129:rs17901879;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048436.1	dbSNP	SNV	552	552	.	+	.	ID=2687;Variant_seq=A;Dbxref=dbSNP_129:rs19394786;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048436.1	dbSNP	SNV	613	613	.	+	.	ID=2688;Variant_seq=G;Dbxref=dbSNP_129:rs19394776;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048436.1	dbSNP	SNV	946	946	.	+	.	ID=2689;Variant_seq=A;Dbxref=dbSNP_129:rs19394746;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039937.1	dbSNP	SNV	3721	3721	.	+	.	ID=2690;Variant_seq=A;Dbxref=dbSNP_129:rs53870799;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039937.1	dbSNP	SNV	3738	3738	.	+	.	ID=2691;Variant_seq=A;Dbxref=dbSNP_129:rs53064650;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039937.1	dbSNP	SNV	3823	3823	.	+	.	ID=2692;Variant_seq=A;Dbxref=dbSNP_129:rs53143130;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399841.1	dbSNP	SNV	672	672	.	+	.	ID=2693;Variant_seq=A;Dbxref=dbSNP_129:rs19156497;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399341.1	dbSNP	SNV	4199	4199	.	+	.	ID=2694;Variant_seq=C;Dbxref=dbSNP_129:rs54244735;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399341.1	dbSNP	SNV	4205	4205	.	+	.	ID=2695;Variant_seq=G;Dbxref=dbSNP_129:rs52997073;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399341.1	dbSNP	SNV	4206	4206	.	+	.	ID=2696;Variant_seq=G;Dbxref=dbSNP_129:rs53585020;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399341.1	dbSNP	SNV	4212	4212	.	+	.	ID=2697;Variant_seq=G;Dbxref=dbSNP_129:rs53927223;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399341.1	dbSNP	SNV	4215	4215	.	+	.	ID=2698;Variant_seq=A;Dbxref=dbSNP_129:rs53699366;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399341.1	dbSNP	SNV	4216	4216	.	+	.	ID=2699;Variant_seq=T;Dbxref=dbSNP_129:rs54066227;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399341.1	dbSNP	SNV	4217	4217	.	+	.	ID=2700;Variant_seq=T;Dbxref=dbSNP_129:rs54341513;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399341.1	dbSNP	SNV	4218	4218	.	+	.	ID=2701;Variant_seq=A;Dbxref=dbSNP_129:rs53127900;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044258.1	dbSNP	SNV	150	150	.	+	.	ID=2702;Variant_seq=A;Dbxref=dbSNP_129:rs19040957;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044258.1	dbSNP	SNV	1647	1647	.	+	.	ID=2703;Variant_seq=C;Dbxref=dbSNP_129:rs19040787;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044258.1	dbSNP	SNV	2235	2235	.	+	.	ID=2704;Variant_seq=C;Dbxref=dbSNP_129:rs19040777;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042153.1	dbSNP	SNV	206	206	.	+	.	ID=2705;Variant_seq=C;Dbxref=dbSNP_129:rs53432600;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042153.1	dbSNP	SNV	2755	2755	.	+	.	ID=2706;Variant_seq=T;Dbxref=dbSNP_129:rs20396866;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042153.1	dbSNP	SNV	2792	2792	.	+	.	ID=2707;Variant_seq=T;Dbxref=dbSNP_129:rs20396906;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042153.1	dbSNP	SNV	2807	2807	.	+	.	ID=2708;Variant_seq=G;Dbxref=dbSNP_129:rs20396916;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042153.1	dbSNP	SNV	2808	2808	.	+	.	ID=2709;Variant_seq=C;Dbxref=dbSNP_129:rs20396926;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398379.1	dbSNP	SNV	15090	15090	.	+	.	ID=2710;Variant_seq=A;Dbxref=dbSNP_129:rs52928603;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398379.1	dbSNP	SNV	15093	15093	.	+	.	ID=2711;Variant_seq=C;Dbxref=dbSNP_129:rs53327985;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398379.1	dbSNP	SNV	15097	15097	.	+	.	ID=2712;Variant_seq=A;Dbxref=dbSNP_129:rs53019041;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398379.1	dbSNP	SNV	15103	15103	.	+	.	ID=2713;Variant_seq=G;Dbxref=dbSNP_129:rs53956437;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398379.1	dbSNP	SNV	16404	16404	.	+	.	ID=2714;Variant_seq=C;Dbxref=dbSNP_129:rs21425425;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047354.1	dbSNP	SNV	796	796	.	+	.	ID=2715;Variant_seq=A;Dbxref=dbSNP_129:rs18928814;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038572.1	dbSNP	SNV	5498	5498	.	+	.	ID=2716;Variant_seq=A;Dbxref=dbSNP_129:rs20893682;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038572.1	dbSNP	SNV	6202	6202	.	+	.	ID=2717;Variant_seq=C;Dbxref=dbSNP_129:rs20324534;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038572.1	dbSNP	SNV	6203	6203	.	+	.	ID=2718;Variant_seq=C;Dbxref=dbSNP_129:rs20324522;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038572.1	dbSNP	SNV	7448	7448	.	+	.	ID=2719;Variant_seq=C;Dbxref=dbSNP_129:rs53441743;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038572.1	dbSNP	SNV	7450	7450	.	+	.	ID=2720;Variant_seq=A;Dbxref=dbSNP_129:rs53133171;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038572.1	dbSNP	SNV	7451	7451	.	+	.	ID=2721;Variant_seq=T;Dbxref=dbSNP_129:rs53227060;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038572.1	dbSNP	SNV	7464	7464	.	+	.	ID=2722;Variant_seq=C;Dbxref=dbSNP_129:rs53908554;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038572.1	dbSNP	SNV	7464	7464	.	+	.	ID=2723;Variant_seq=C;Dbxref=dbSNP_129:rs54033838;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038572.1	dbSNP	SNV	7481	7481	.	+	.	ID=2724;Variant_seq=T;Dbxref=dbSNP_129:rs52931541;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038572.1	dbSNP	SNV	7482	7482	.	+	.	ID=2725;Variant_seq=A;Dbxref=dbSNP_129:rs54218498;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038572.1	dbSNP	SNV	7492	7492	.	+	.	ID=2726;Variant_seq=T;Dbxref=dbSNP_129:rs54207833;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038572.1	dbSNP	SNV	7502	7502	.	+	.	ID=2727;Variant_seq=G;Dbxref=dbSNP_129:rs53786051;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038572.1	dbSNP	SNV	7517	7517	.	+	.	ID=2728;Variant_seq=C;Dbxref=dbSNP_129:rs52921001;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038572.1	dbSNP	SNV	7522	7522	.	+	.	ID=2729;Variant_seq=C;Dbxref=dbSNP_129:rs53394276;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045740.1	dbSNP	SNV	443	443	.	+	.	ID=2730;Variant_seq=T;Dbxref=dbSNP_129:rs20772362;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045740.1	dbSNP	SNV	456	456	.	+	.	ID=2731;Variant_seq=A;Dbxref=dbSNP_129:rs20772412;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045740.1	dbSNP	SNV	460	460	.	+	.	ID=2732;Variant_seq=A;Dbxref=dbSNP_129:rs20772442;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045740.1	dbSNP	SNV	2689	2689	.	+	.	ID=2733;Variant_seq=T;Dbxref=dbSNP_129:rs53903349;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045740.1	dbSNP	SNV	2692	2692	.	+	.	ID=2734;Variant_seq=G;Dbxref=dbSNP_129:rs53984752;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045740.1	dbSNP	SNV	2693	2693	.	+	.	ID=2735;Variant_seq=A;Dbxref=dbSNP_129:rs54335170;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045740.1	dbSNP	SNV	2697	2697	.	+	.	ID=2736;Variant_seq=C;Dbxref=dbSNP_129:rs53809490;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045740.1	dbSNP	SNV	2701	2701	.	+	.	ID=2737;Variant_seq=T,G;Dbxref=dbSNP_129:rs52991399;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045740.1	dbSNP	SNV	2716	2716	.	+	.	ID=2738;Variant_seq=A;Dbxref=dbSNP_129:rs54192937;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045740.1	dbSNP	SNV	2728	2728	.	+	.	ID=2739;Variant_seq=G;Dbxref=dbSNP_129:rs53965191;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045740.1	dbSNP	SNV	2750	2750	.	+	.	ID=2740;Variant_seq=T;Dbxref=dbSNP_129:rs53900566;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045740.1	dbSNP	SNV	2755	2755	.	+	.	ID=2741;Variant_seq=C;Dbxref=dbSNP_129:rs54287140;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045740.1	dbSNP	SNV	2764	2764	.	+	.	ID=2742;Variant_seq=G;Dbxref=dbSNP_129:rs54209631;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045740.1	dbSNP	SNV	2767	2767	.	+	.	ID=2743;Variant_seq=G;Dbxref=dbSNP_129:rs53822151;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045740.1	dbSNP	SNV	2769	2769	.	+	.	ID=2744;Variant_seq=T;Dbxref=dbSNP_129:rs54057168;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042512.1	dbSNP	SNV	2971	2971	.	+	.	ID=2745;Variant_seq=G;Dbxref=dbSNP_129:rs54179635;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	deletion	2993	2995	.	+	.	ID=2746;Variant_seq=-;Dbxref=dbSNP_129:rs54310887;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=AAC
AAAA02042512.1	dbSNP	SNV	3001	3001	.	+	.	ID=2747;Variant_seq=T;Dbxref=dbSNP_129:rs52969189;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	deletion	3006	3011	.	+	.	ID=2748;Variant_seq=-;Dbxref=dbSNP_129:rs54139485;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=TCATCC
AAAA02042512.1	dbSNP	deletion	3022	3022	.	+	.	ID=2749;Variant_seq=-;Dbxref=dbSNP_129:rs54052964;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	deletion	3024	3025	.	+	.	ID=2750;Variant_seq=-;Dbxref=dbSNP_129:rs53394683;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=TA
AAAA02042512.1	dbSNP	SNV	3039	3039	.	+	.	ID=2751;Variant_seq=A;Dbxref=dbSNP_129:rs53570825;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042512.1	dbSNP	SNV	3040	3040	.	+	.	ID=2752;Variant_seq=G;Dbxref=dbSNP_129:rs53492495;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	SNV	3061	3061	.	+	.	ID=2753;Variant_seq=C;Dbxref=dbSNP_129:rs53009649;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3121	3121	.	+	.	ID=2754;Variant_seq=A;Dbxref=dbSNP_129:rs54359807;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042512.1	dbSNP	SNV	3181	3181	.	+	.	ID=2755;Variant_seq=C;Dbxref=dbSNP_129:rs52854087;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3221	3221	.	+	.	ID=2756;Variant_seq=A;Dbxref=dbSNP_129:rs53886103;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042512.1	dbSNP	SNV	3229	3229	.	+	.	ID=2757;Variant_seq=T;Dbxref=dbSNP_129:rs54168804;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042512.1	dbSNP	SNV	3274	3274	.	+	.	ID=2758;Variant_seq=C;Dbxref=dbSNP_129:rs53902059;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	deletion	3279	3284	.	+	.	ID=2759;Variant_seq=-;Dbxref=dbSNP_129:rs52934965;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=TATTGT
AAAA02042512.1	dbSNP	SNV	3303	3303	.	+	.	ID=2760;Variant_seq=T;Dbxref=dbSNP_129:rs53663880;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042512.1	dbSNP	SNV	3304	3304	.	+	.	ID=2761;Variant_seq=T;Dbxref=dbSNP_129:rs53863380;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042512.1	dbSNP	SNV	3322	3322	.	+	.	ID=2762;Variant_seq=C;Dbxref=dbSNP_129:rs53526462;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	deletion	3330	3332	.	+	.	ID=2763;Variant_seq=-;Dbxref=dbSNP_129:rs54280825;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=ACA
AAAA02042512.1	dbSNP	SNV	3336	3336	.	+	.	ID=2764;Variant_seq=C;Dbxref=dbSNP_129:rs53288915;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3337	3337	.	+	.	ID=2765;Variant_seq=C;Dbxref=dbSNP_129:rs54236006;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3345	3345	.	+	.	ID=2766;Variant_seq=G;Dbxref=dbSNP_129:rs53133834;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	SNV	3352	3352	.	+	.	ID=2767;Variant_seq=T;Dbxref=dbSNP_129:rs54047725;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042512.1	dbSNP	SNV	3364	3364	.	+	.	ID=2768;Variant_seq=A;Dbxref=dbSNP_129:rs54156800;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042512.1	dbSNP	SNV	3368	3368	.	+	.	ID=2769;Variant_seq=T;Dbxref=dbSNP_129:rs54041908;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042512.1	dbSNP	SNV	3412	3412	.	+	.	ID=2770;Variant_seq=C;Dbxref=dbSNP_129:rs54377874;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	SNV	3436	3436	.	+	.	ID=2771;Variant_seq=C;Dbxref=dbSNP_129:rs53123769;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	SNV	3442	3442	.	+	.	ID=2772;Variant_seq=C;Dbxref=dbSNP_129:rs52944988;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3449	3449	.	+	.	ID=2773;Variant_seq=G;Dbxref=dbSNP_129:rs54165799;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	SNV	3467	3467	.	+	.	ID=2774;Variant_seq=G;Dbxref=dbSNP_129:rs53371779;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3473	3473	.	+	.	ID=2775;Variant_seq=C;Dbxref=dbSNP_129:rs53481977;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042512.1	dbSNP	SNV	3482	3482	.	+	.	ID=2776;Variant_seq=A;Dbxref=dbSNP_129:rs54182029;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3485	3485	.	+	.	ID=2777;Variant_seq=A;Dbxref=dbSNP_129:rs53967038;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042512.1	dbSNP	SNV	3486	3486	.	+	.	ID=2778;Variant_seq=C;Dbxref=dbSNP_129:rs53470693;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042512.1	dbSNP	SNV	3520	3520	.	+	.	ID=2779;Variant_seq=T;Dbxref=dbSNP_129:rs54363041;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042512.1	dbSNP	SNV	3552	3552	.	+	.	ID=2780;Variant_seq=G;Dbxref=dbSNP_129:rs52967155;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3556	3556	.	+	.	ID=2781;Variant_seq=T;Dbxref=dbSNP_129:rs53965432;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042512.1	dbSNP	SNV	3581	3581	.	+	.	ID=2782;Variant_seq=T;Dbxref=dbSNP_129:rs54266610;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	SNV	3582	3582	.	+	.	ID=2783;Variant_seq=A;Dbxref=dbSNP_129:rs53870818;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3597	3597	.	+	.	ID=2784;Variant_seq=G;Dbxref=dbSNP_129:rs52994623;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	SNV	3598	3598	.	+	.	ID=2785;Variant_seq=A;Dbxref=dbSNP_129:rs54155975;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042512.1	dbSNP	SNV	3616	3616	.	+	.	ID=2786;Variant_seq=A;Dbxref=dbSNP_129:rs53920956;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3623	3623	.	+	.	ID=2787;Variant_seq=A;Dbxref=dbSNP_129:rs53213813;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042512.1	dbSNP	SNV	3624	3624	.	+	.	ID=2788;Variant_seq=A;Dbxref=dbSNP_129:rs53288602;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3626	3626	.	+	.	ID=2789;Variant_seq=C;Dbxref=dbSNP_129:rs53583424;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3640	3640	.	+	.	ID=2790;Variant_seq=A;Dbxref=dbSNP_129:rs54022800;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042512.1	dbSNP	SNV	3644	3644	.	+	.	ID=2791;Variant_seq=A;Dbxref=dbSNP_129:rs53417665;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3653	3653	.	+	.	ID=2792;Variant_seq=G;Dbxref=dbSNP_129:rs52946137;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	SNV	3659	3659	.	+	.	ID=2793;Variant_seq=G;Dbxref=dbSNP_129:rs53469029;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3660	3660	.	+	.	ID=2794;Variant_seq=A;Dbxref=dbSNP_129:rs53342222;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3668	3668	.	+	.	ID=2795;Variant_seq=G;Dbxref=dbSNP_129:rs53774769;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	SNV	3669	3669	.	+	.	ID=2796;Variant_seq=C;Dbxref=dbSNP_129:rs53860608;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042512.1	dbSNP	SNV	3679	3679	.	+	.	ID=2797;Variant_seq=C;Dbxref=dbSNP_129:rs53145995;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3681	3681	.	+	.	ID=2798;Variant_seq=C;Dbxref=dbSNP_129:rs53318655;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3686	3686	.	+	.	ID=2799;Variant_seq=A;Dbxref=dbSNP_129:rs19678481;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042512.1	dbSNP	SNV	3712	3712	.	+	.	ID=2800;Variant_seq=A;Dbxref=dbSNP_129:rs53445397;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042512.1	dbSNP	SNV	3732	3732	.	+	.	ID=2801;Variant_seq=C;Dbxref=dbSNP_129:rs54084675;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042512.1	dbSNP	SNV	3747	3747	.	+	.	ID=2802;Variant_seq=A;Dbxref=dbSNP_129:rs53929807;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042512.1	dbSNP	SNV	3773	3773	.	+	.	ID=2803;Variant_seq=G;Dbxref=dbSNP_129:rs54391009;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	SNV	3803	3803	.	+	.	ID=2804;Variant_seq=G;Dbxref=dbSNP_129:rs52850970;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	SNV	3828	3828	.	+	.	ID=2805;Variant_seq=T;Dbxref=dbSNP_129:rs54028764;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042512.1	dbSNP	SNV	3829	3829	.	+	.	ID=2806;Variant_seq=C;Dbxref=dbSNP_129:rs53543914;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	SNV	3831	3831	.	+	.	ID=2807;Variant_seq=C;Dbxref=dbSNP_129:rs53729665;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	SNV	3842	3842	.	+	.	ID=2808;Variant_seq=G;Dbxref=dbSNP_129:rs53140400;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042512.1	dbSNP	SNV	3843	3843	.	+	.	ID=2809;Variant_seq=C;Dbxref=dbSNP_129:rs54133685;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042512.1	dbSNP	SNV	3848	3848	.	+	.	ID=2810;Variant_seq=A;Dbxref=dbSNP_129:rs53466407;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042512.1	dbSNP	SNV	3849	3849	.	+	.	ID=2811;Variant_seq=T;Dbxref=dbSNP_129:rs53985566;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042512.1	dbSNP	SNV	3897	3897	.	+	.	ID=2812;Variant_seq=G;Dbxref=dbSNP_129:rs53540965;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042092.1	dbSNP	SNV	242	242	.	+	.	ID=2813;Variant_seq=G;Dbxref=dbSNP_129:rs20921195;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042092.1	dbSNP	SNV	244	244	.	+	.	ID=2814;Variant_seq=A;Dbxref=dbSNP_129:rs20921205;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042092.1	dbSNP	SNV	266	266	.	+	.	ID=2815;Variant_seq=G;Dbxref=dbSNP_129:rs20921215;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042092.1	dbSNP	SNV	267	267	.	+	.	ID=2816;Variant_seq=C;Dbxref=dbSNP_129:rs20921225;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042092.1	dbSNP	SNV	591	591	.	+	.	ID=2817;Variant_seq=C;Dbxref=dbSNP_129:rs20921235;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042092.1	dbSNP	SNV	597	597	.	+	.	ID=2818;Variant_seq=C;Dbxref=dbSNP_129:rs20921245;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042092.1	dbSNP	SNV	1438	1438	.	+	.	ID=2819;Variant_seq=T;Dbxref=dbSNP_129:rs17932335;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042092.1	dbSNP	SNV	2163	2163	.	+	.	ID=2820;Variant_seq=G;Dbxref=dbSNP_129:rs19071700;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044368.1	dbSNP	SNV	584	584	.	+	.	ID=2821;Variant_seq=A;Dbxref=dbSNP_129:rs20948786;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044368.1	dbSNP	SNV	2366	2366	.	+	.	ID=2822;Variant_seq=A;Dbxref=dbSNP_129:rs20948696;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044368.1	dbSNP	SNV	2777	2777	.	+	.	ID=2823;Variant_seq=A;Dbxref=dbSNP_129:rs20948686;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040525.1	dbSNP	SNV	3760	3760	.	+	.	ID=2824;Variant_seq=C;Dbxref=dbSNP_129:rs54342779;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040525.1	dbSNP	SNV	4144	4144	.	+	.	ID=2825;Variant_seq=T;Dbxref=dbSNP_129:rs19771121;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040525.1	dbSNP	SNV	4187	4187	.	+	.	ID=2826;Variant_seq=G;Dbxref=dbSNP_129:rs19771262;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02040525.1	dbSNP	SNV	4188	4188	.	+	.	ID=2827;Variant_seq=A;Dbxref=dbSNP_129:rs19771272;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040525.1	dbSNP	SNV	4189	4189	.	+	.	ID=2828;Variant_seq=T;Dbxref=dbSNP_129:rs19771282;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040525.1	dbSNP	SNV	4191	4191	.	+	.	ID=2829;Variant_seq=A;Dbxref=dbSNP_129:rs19771292;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040525.1	dbSNP	SNV	4309	4309	.	+	.	ID=2830;Variant_seq=T;Dbxref=dbSNP_129:rs19771472;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040525.1	dbSNP	SNV	4310	4310	.	+	.	ID=2831;Variant_seq=C;Dbxref=dbSNP_129:rs19771482;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040525.1	dbSNP	SNV	4604	4604	.	+	.	ID=2832;Variant_seq=A;Dbxref=dbSNP_129:rs21252188;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043603.1	dbSNP	SNV	1347	1347	.	+	.	ID=2833;Variant_seq=A;Dbxref=dbSNP_129:rs18827911;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043603.1	dbSNP	SNV	1358	1358	.	+	.	ID=2834;Variant_seq=A;Dbxref=dbSNP_129:rs17877126;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043603.1	dbSNP	SNV	1370	1370	.	+	.	ID=2835;Variant_seq=T;Dbxref=dbSNP_129:rs18827931;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043603.1	dbSNP	SNV	3106	3106	.	+	.	ID=2836;Variant_seq=C;Dbxref=dbSNP_129:rs18091939;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043603.1	dbSNP	SNV	3177	3177	.	+	.	ID=2837;Variant_seq=T;Dbxref=dbSNP_129:rs18091948;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043603.1	dbSNP	SNV	3299	3299	.	+	.	ID=2838;Variant_seq=T;Dbxref=dbSNP_129:rs18091975;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043603.1	dbSNP	SNV	3338	3338	.	+	.	ID=2839;Variant_seq=G;Dbxref=dbSNP_129:rs18091984;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043603.1	dbSNP	SNV	3420	3420	.	+	.	ID=2840;Variant_seq=T;Dbxref=dbSNP_129:rs18092002;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399348.1	dbSNP	SNV	3578	3578	.	+	.	ID=2841;Variant_seq=A;Dbxref=dbSNP_129:rs18725196;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399348.1	dbSNP	SNV	5913	5913	.	+	.	ID=2842;Variant_seq=A;Dbxref=dbSNP_129:rs20898958;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399348.1	dbSNP	SNV	5920	5920	.	+	.	ID=2843;Variant_seq=C;Dbxref=dbSNP_129:rs20898968;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399348.1	dbSNP	SNV	5936	5936	.	+	.	ID=2844;Variant_seq=G;Dbxref=dbSNP_129:rs20898978;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399348.1	dbSNP	SNV	5950	5950	.	+	.	ID=2845;Variant_seq=T;Dbxref=dbSNP_129:rs20898998;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399229.1	dbSNP	SNV	1126	1126	.	+	.	ID=2846;Variant_seq=A;Dbxref=dbSNP_129:rs21208874;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399229.1	dbSNP	SNV	1562	1562	.	+	.	ID=2847;Variant_seq=T;Dbxref=dbSNP_129:rs53937064;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399229.1	dbSNP	SNV	2858	2858	.	+	.	ID=2848;Variant_seq=A;Dbxref=dbSNP_129:rs17977705;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399229.1	dbSNP	SNV	2864	2864	.	+	.	ID=2849;Variant_seq=C;Dbxref=dbSNP_129:rs17977732;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399229.1	dbSNP	SNV	2865	2865	.	+	.	ID=2850;Variant_seq=C;Dbxref=dbSNP_129:rs17977741;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399229.1	dbSNP	SNV	2866	2866	.	+	.	ID=2851;Variant_seq=G;Dbxref=dbSNP_129:rs17977750;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399229.1	dbSNP	SNV	3225	3225	.	+	.	ID=2852;Variant_seq=G;Dbxref=dbSNP_129:rs20055279;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399229.1	dbSNP	SNV	3226	3226	.	+	.	ID=2853;Variant_seq=C;Dbxref=dbSNP_129:rs20055289;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399229.1	dbSNP	SNV	3227	3227	.	+	.	ID=2854;Variant_seq=T;Dbxref=dbSNP_129:rs20055299;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399229.1	dbSNP	SNV	3229	3229	.	+	.	ID=2855;Variant_seq=C;Dbxref=dbSNP_129:rs20055309;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399229.1	dbSNP	SNV	3230	3230	.	+	.	ID=2856;Variant_seq=A;Dbxref=dbSNP_129:rs20055319;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042309.1	dbSNP	SNV	120	120	.	+	.	ID=2857;Variant_seq=C;Dbxref=dbSNP_129:rs20363520;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042309.1	dbSNP	SNV	204	204	.	+	.	ID=2858;Variant_seq=A;Dbxref=dbSNP_129:rs20363460;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042309.1	dbSNP	SNV	408	408	.	+	.	ID=2859;Variant_seq=A;Dbxref=dbSNP_129:rs20363352;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042309.1	dbSNP	SNV	2871	2871	.	+	.	ID=2860;Variant_seq=T;Dbxref=dbSNP_129:rs20365058;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042309.1	dbSNP	SNV	2872	2872	.	+	.	ID=2861;Variant_seq=C;Dbxref=dbSNP_129:rs20365048;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042309.1	dbSNP	SNV	2999	2999	.	+	.	ID=2862;Variant_seq=G;Dbxref=dbSNP_129:rs20364988;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042309.1	dbSNP	SNV	3006	3006	.	+	.	ID=2863;Variant_seq=T;Dbxref=dbSNP_129:rs20364978;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040972.1	dbSNP	SNV	3492	3492	.	+	.	ID=2864;Variant_seq=G;Dbxref=dbSNP_129:rs17916807;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02040972.1	dbSNP	SNV	3495	3495	.	+	.	ID=2865;Variant_seq=T;Dbxref=dbSNP_129:rs17916816;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040972.1	dbSNP	SNV	3500	3500	.	+	.	ID=2866;Variant_seq=A;Dbxref=dbSNP_129:rs17916825;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040972.1	dbSNP	SNV	3515	3515	.	+	.	ID=2867;Variant_seq=A;Dbxref=dbSNP_129:rs17916852;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040972.1	dbSNP	SNV	3527	3527	.	+	.	ID=2868;Variant_seq=A;Dbxref=dbSNP_129:rs17916861;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040972.1	dbSNP	SNV	3545	3545	.	+	.	ID=2869;Variant_seq=A;Dbxref=dbSNP_129:rs17916870;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042447.1	dbSNP	SNV	506	506	.	+	.	ID=2870;Variant_seq=A;Dbxref=dbSNP_129:rs18305655;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399836.1	dbSNP	SNV	326	326	.	+	.	ID=2871;Variant_seq=C;Dbxref=dbSNP_129:rs21556245;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399836.1	dbSNP	SNV	1042	1042	.	+	.	ID=2872;Variant_seq=A;Dbxref=dbSNP_129:rs21193877;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399836.1	dbSNP	SNV	1052	1052	.	+	.	ID=2873;Variant_seq=A;Dbxref=dbSNP_129:rs21193907;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399836.1	dbSNP	SNV	1053	1053	.	+	.	ID=2874;Variant_seq=C;Dbxref=dbSNP_129:rs21193917;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399836.1	dbSNP	SNV	1057	1057	.	+	.	ID=2875;Variant_seq=C;Dbxref=dbSNP_129:rs21193927;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399836.1	dbSNP	SNV	1060	1060	.	+	.	ID=2876;Variant_seq=T;Dbxref=dbSNP_129:rs21193937;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399836.1	dbSNP	SNV	1069	1069	.	+	.	ID=2877;Variant_seq=T;Dbxref=dbSNP_129:rs21193957;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399836.1	dbSNP	SNV	1081	1081	.	+	.	ID=2878;Variant_seq=A;Dbxref=dbSNP_129:rs21193977;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399836.1	dbSNP	SNV	1087	1087	.	+	.	ID=2879;Variant_seq=A;Dbxref=dbSNP_129:rs21193987;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399836.1	dbSNP	SNV	1090	1090	.	+	.	ID=2880;Variant_seq=C;Dbxref=dbSNP_129:rs21193997;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399836.1	dbSNP	SNV	1094	1094	.	+	.	ID=2881;Variant_seq=G;Dbxref=dbSNP_129:rs21194007;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399836.1	dbSNP	SNV	1098	1098	.	+	.	ID=2882;Variant_seq=G;Dbxref=dbSNP_129:rs21194017;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399836.1	dbSNP	SNV	1101	1101	.	+	.	ID=2883;Variant_seq=G;Dbxref=dbSNP_129:rs21194037;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399836.1	dbSNP	SNV	1102	1102	.	+	.	ID=2884;Variant_seq=C;Dbxref=dbSNP_129:rs21194047;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399836.1	dbSNP	SNV	1104	1104	.	+	.	ID=2885;Variant_seq=C;Dbxref=dbSNP_129:rs21194057;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399836.1	dbSNP	SNV	1106	1106	.	+	.	ID=2886;Variant_seq=A;Dbxref=dbSNP_129:rs21194067;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399836.1	dbSNP	SNV	1107	1107	.	+	.	ID=2887;Variant_seq=A;Dbxref=dbSNP_129:rs21194077;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399836.1	dbSNP	SNV	1112	1112	.	+	.	ID=2888;Variant_seq=G;Dbxref=dbSNP_129:rs21194107;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399836.1	dbSNP	SNV	1113	1113	.	+	.	ID=2889;Variant_seq=C;Dbxref=dbSNP_129:rs21194117;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399836.1	dbSNP	SNV	1116	1116	.	+	.	ID=2890;Variant_seq=C;Dbxref=dbSNP_129:rs21194127;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399836.1	dbSNP	SNV	1117	1117	.	+	.	ID=2891;Variant_seq=A;Dbxref=dbSNP_129:rs21194137;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400366.1	dbSNP	SNV	216	216	.	+	.	ID=2892;Variant_seq=T;Dbxref=dbSNP_129:rs19976404;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400366.1	dbSNP	SNV	218	218	.	+	.	ID=2893;Variant_seq=T;Dbxref=dbSNP_129:rs19976394;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400366.1	dbSNP	SNV	220	220	.	+	.	ID=2894;Variant_seq=T;Dbxref=dbSNP_129:rs19976384;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400366.1	dbSNP	SNV	230	230	.	+	.	ID=2895;Variant_seq=T;Dbxref=dbSNP_129:rs19976364;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400366.1	dbSNP	SNV	242	242	.	+	.	ID=2896;Variant_seq=A;Dbxref=dbSNP_129:rs19976354;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400366.1	dbSNP	SNV	244	244	.	+	.	ID=2897;Variant_seq=A;Dbxref=dbSNP_129:rs19976344;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400366.1	dbSNP	SNV	256	256	.	+	.	ID=2898;Variant_seq=T;Dbxref=dbSNP_129:rs19976334;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400366.1	dbSNP	SNV	268	268	.	+	.	ID=2899;Variant_seq=T;Dbxref=dbSNP_129:rs19976324;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400366.1	dbSNP	SNV	277	277	.	+	.	ID=2900;Variant_seq=T;Dbxref=dbSNP_129:rs19976284;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400366.1	dbSNP	SNV	1345	1345	.	+	.	ID=2901;Variant_seq=T;Dbxref=dbSNP_129:rs53628036;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400366.1	dbSNP	SNV	1360	1360	.	+	.	ID=2902;Variant_seq=T;Dbxref=dbSNP_129:rs53889713;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400366.1	dbSNP	SNV	1363	1363	.	+	.	ID=2903;Variant_seq=A;Dbxref=dbSNP_129:rs53372527;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400366.1	dbSNP	SNV	1370	1370	.	+	.	ID=2904;Variant_seq=T;Dbxref=dbSNP_129:rs54264281;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049831.1	dbSNP	SNV	725	725	.	+	.	ID=2905;Variant_seq=T;Dbxref=dbSNP_129:rs20769913;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044132.1	dbSNP	SNV	2196	2196	.	+	.	ID=2906;Variant_seq=T;Dbxref=dbSNP_129:rs20343309;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044229.1	dbSNP	SNV	2482	2482	.	+	.	ID=2907;Variant_seq=A;Dbxref=dbSNP_129:rs20640403;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036545.1	dbSNP	SNV	6618	6618	.	+	.	ID=2908;Variant_seq=T;Dbxref=dbSNP_129:rs20344540;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036545.1	dbSNP	SNV	6633	6633	.	+	.	ID=2909;Variant_seq=A;Dbxref=dbSNP_129:rs20344520;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036545.1	dbSNP	SNV	11674	11674	.	+	.	ID=2910;Variant_seq=C;Dbxref=dbSNP_129:rs20519838;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036545.1	dbSNP	SNV	11704	11704	.	+	.	ID=2911;Variant_seq=T,C;Dbxref=dbSNP_129:rs17904316;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036545.1	dbSNP	SNV	11705	11705	.	+	.	ID=2912;Variant_seq=C;Dbxref=dbSNP_129:rs19118017;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036545.1	dbSNP	SNV	14228	14228	.	+	.	ID=2913;Variant_seq=C;Dbxref=dbSNP_129:rs21121810;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036860.1	dbSNP	SNV	1492	1492	.	+	.	ID=2914;Variant_seq=T;Dbxref=dbSNP_129:rs20283727;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036860.1	dbSNP	SNV	3743	3743	.	+	.	ID=2915;Variant_seq=A;Dbxref=dbSNP_129:rs53298447;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036860.1	dbSNP	SNV	3746	3746	.	+	.	ID=2916;Variant_seq=T;Dbxref=dbSNP_129:rs52971351;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036860.1	dbSNP	SNV	3764	3764	.	+	.	ID=2917;Variant_seq=T;Dbxref=dbSNP_129:rs53754468;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036860.1	dbSNP	SNV	3767	3767	.	+	.	ID=2918;Variant_seq=A;Dbxref=dbSNP_129:rs53093509;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036860.1	dbSNP	SNV	7259	7259	.	+	.	ID=2919;Variant_seq=A;Dbxref=dbSNP_129:rs21586714;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036860.1	dbSNP	SNV	8092	8092	.	+	.	ID=2920;Variant_seq=C;Dbxref=dbSNP_129:rs20194547;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399488.1	dbSNP	SNV	110	110	.	+	.	ID=2921;Variant_seq=A;Dbxref=dbSNP_129:rs54395375;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399488.1	dbSNP	SNV	725	725	.	+	.	ID=2922;Variant_seq=A;Dbxref=dbSNP_129:rs19613121;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398282.1	dbSNP	SNV	1761	1761	.	+	.	ID=2923;Variant_seq=G;Dbxref=dbSNP_129:rs19475997;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398282.1	dbSNP	SNV	1913	1913	.	+	.	ID=2924;Variant_seq=T;Dbxref=dbSNP_129:rs18680223;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398282.1	dbSNP	SNV	2547	2547	.	+	.	ID=2925;Variant_seq=A;Dbxref=dbSNP_129:rs53362916;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398282.1	dbSNP	SNV	3493	3493	.	+	.	ID=2926;Variant_seq=T;Dbxref=dbSNP_129:rs21772449;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398282.1	dbSNP	SNV	6376	6376	.	+	.	ID=2927;Variant_seq=A;Dbxref=dbSNP_129:rs18902539;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398282.1	dbSNP	SNV	7715	7715	.	+	.	ID=2928;Variant_seq=A;Dbxref=dbSNP_129:rs53475905;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398282.1	dbSNP	SNV	7717	7717	.	+	.	ID=2929;Variant_seq=G;Dbxref=dbSNP_129:rs53777744;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398282.1	dbSNP	SNV	7858	7858	.	+	.	ID=2930;Variant_seq=C;Dbxref=dbSNP_129:rs53727215;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398282.1	dbSNP	deletion	7865	7865	.	+	.	ID=2931;Variant_seq=-;Dbxref=dbSNP_129:rs53048872;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398282.1	dbSNP	SNV	12189	12189	.	+	.	ID=2932;Variant_seq=G;Dbxref=dbSNP_129:rs19578940;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398282.1	dbSNP	insertion	32358	32358	.	+	.	ID=2933;Variant_seq=A;Dbxref=dbSNP_129:rs53275517;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398282.1	dbSNP	SNV	32382	32382	.	+	.	ID=2934;Variant_seq=A;Dbxref=dbSNP_129:rs54262405;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398282.1	dbSNP	SNV	32418	32418	.	+	.	ID=2935;Variant_seq=A;Dbxref=dbSNP_129:rs54075369;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398282.1	dbSNP	SNV	32422	32422	.	+	.	ID=2936;Variant_seq=T;Dbxref=dbSNP_129:rs54326578;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398282.1	dbSNP	SNV	32424	32424	.	+	.	ID=2937;Variant_seq=T;Dbxref=dbSNP_129:rs53912638;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398282.1	dbSNP	SNV	32425	32425	.	+	.	ID=2938;Variant_seq=A;Dbxref=dbSNP_129:rs54404770;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398282.1	dbSNP	SNV	32426	32426	.	+	.	ID=2939;Variant_seq=A;Dbxref=dbSNP_129:rs52864900;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398282.1	dbSNP	SNV	32427	32427	.	+	.	ID=2940;Variant_seq=C;Dbxref=dbSNP_129:rs54271487;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398282.1	dbSNP	SNV	32429	32429	.	+	.	ID=2941;Variant_seq=A;Dbxref=dbSNP_129:rs53391293;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398282.1	dbSNP	deletion	32430	32430	.	+	.	ID=2942;Variant_seq=-;Dbxref=dbSNP_129:rs53656303;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398282.1	dbSNP	insertion	32430	32430	.	+	.	ID=2943;Variant_seq=T;Dbxref=dbSNP_129:rs53797204;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398282.1	dbSNP	deletion	32432	32432	.	+	.	ID=2944;Variant_seq=-;Dbxref=dbSNP_129:rs52913769;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398282.1	dbSNP	SNV	32433	32433	.	+	.	ID=2945;Variant_seq=G;Dbxref=dbSNP_129:rs53784732;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398282.1	dbSNP	SNV	32435	32435	.	+	.	ID=2946;Variant_seq=T;Dbxref=dbSNP_129:rs52861819;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398282.1	dbSNP	SNV	32436	32436	.	+	.	ID=2947;Variant_seq=T;Dbxref=dbSNP_129:rs53896535;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398282.1	dbSNP	SNV	32515	32515	.	+	.	ID=2948;Variant_seq=G;Dbxref=dbSNP_129:rs53602256;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398282.1	dbSNP	SNV	32517	32517	.	+	.	ID=2949;Variant_seq=A;Dbxref=dbSNP_129:rs53586226;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398282.1	dbSNP	SNV	32521	32521	.	+	.	ID=2950;Variant_seq=A;Dbxref=dbSNP_129:rs53436840;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398282.1	dbSNP	SNV	32525	32525	.	+	.	ID=2951;Variant_seq=C;Dbxref=dbSNP_129:rs53712323;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398282.1	dbSNP	SNV	32526	32526	.	+	.	ID=2952;Variant_seq=G;Dbxref=dbSNP_129:rs53326230;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398282.1	dbSNP	SNV	32528	32528	.	+	.	ID=2953;Variant_seq=C;Dbxref=dbSNP_129:rs53136337;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398282.1	dbSNP	deletion	32531	32531	.	+	.	ID=2954;Variant_seq=-;Dbxref=dbSNP_129:rs53209028;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398282.1	dbSNP	SNV	33100	33100	.	+	.	ID=2955;Variant_seq=T;Dbxref=dbSNP_129:rs21669344;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400962.1	dbSNP	SNV	938	938	.	+	.	ID=2956;Variant_seq=A;Dbxref=dbSNP_129:rs19537771;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400962.1	dbSNP	SNV	1775	1775	.	+	.	ID=2957;Variant_seq=A;Dbxref=dbSNP_129:rs21707651;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400962.1	dbSNP	SNV	1865	1865	.	+	.	ID=2958;Variant_seq=A;Dbxref=dbSNP_129:rs53583499;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400937.1	dbSNP	SNV	1829	1829	.	+	.	ID=2959;Variant_seq=A;Dbxref=dbSNP_129:rs53360169;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400937.1	dbSNP	SNV	1878	1878	.	+	.	ID=2960;Variant_seq=T;Dbxref=dbSNP_129:rs53818976;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400937.1	dbSNP	SNV	1913	1913	.	+	.	ID=2961;Variant_seq=T;Dbxref=dbSNP_129:rs52947773;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041707.1	dbSNP	SNV	675	675	.	+	.	ID=2962;Variant_seq=T;Dbxref=dbSNP_129:rs19570452;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041707.1	dbSNP	SNV	717	717	.	+	.	ID=2963;Variant_seq=A;Dbxref=dbSNP_129:rs19570382;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041707.1	dbSNP	SNV	3637	3637	.	+	.	ID=2964;Variant_seq=A;Dbxref=dbSNP_129:rs18425272;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041707.1	dbSNP	SNV	4258	4258	.	+	.	ID=2965;Variant_seq=C;Dbxref=dbSNP_129:rs19256658;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400683.1	dbSNP	SNV	1875	1875	.	+	.	ID=2966;Variant_seq=A;Dbxref=dbSNP_129:rs21418976;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398384.1	dbSNP	SNV	9573	9573	.	+	.	ID=2967;Variant_seq=C;Dbxref=dbSNP_129:rs54103482;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048678.1	dbSNP	SNV	1801	1801	.	+	.	ID=2968;Variant_seq=T;Dbxref=dbSNP_129:rs20621342;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048678.1	dbSNP	SNV	1808	1808	.	+	.	ID=2969;Variant_seq=A;Dbxref=dbSNP_129:rs20621352;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048678.1	dbSNP	SNV	1829	1829	.	+	.	ID=2970;Variant_seq=G;Dbxref=dbSNP_129:rs20621372;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048744.1	dbSNP	SNV	852	852	.	+	.	ID=2971;Variant_seq=G;Dbxref=dbSNP_129:rs54345869;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048744.1	dbSNP	SNV	853	853	.	+	.	ID=2972;Variant_seq=A;Dbxref=dbSNP_129:rs53366764;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048744.1	dbSNP	SNV	854	854	.	+	.	ID=2973;Variant_seq=C;Dbxref=dbSNP_129:rs54297027;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048744.1	dbSNP	SNV	857	857	.	+	.	ID=2974;Variant_seq=A;Dbxref=dbSNP_129:rs53150340;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048744.1	dbSNP	SNV	857	857	.	+	.	ID=2975;Variant_seq=A;Dbxref=dbSNP_129:rs53855601;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048744.1	dbSNP	insertion	859	859	.	+	.	ID=2976;Variant_seq=TA;Dbxref=dbSNP_129:rs53408131;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02048744.1	dbSNP	SNV	866	866	.	+	.	ID=2977;Variant_seq=T;Dbxref=dbSNP_129:rs53562646;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048744.1	dbSNP	SNV	866	866	.	+	.	ID=2978;Variant_seq=T;Dbxref=dbSNP_129:rs54210582;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048744.1	dbSNP	SNV	869	869	.	+	.	ID=2979;Variant_seq=A;Dbxref=dbSNP_129:rs53820108;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048744.1	dbSNP	SNV	872	872	.	+	.	ID=2980;Variant_seq=A,T;Dbxref=dbSNP_129:rs53510271;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048744.1	dbSNP	SNV	876	876	.	+	.	ID=2981;Variant_seq=G;Dbxref=dbSNP_129:rs54341007;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048744.1	dbSNP	SNV	876	876	.	+	.	ID=2982;Variant_seq=G;Dbxref=dbSNP_129:rs53315814;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048744.1	dbSNP	SNV	878	878	.	+	.	ID=2983;Variant_seq=A,T;Dbxref=dbSNP_129:rs53061113;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048744.1	dbSNP	SNV	886	886	.	+	.	ID=2984;Variant_seq=T;Dbxref=dbSNP_129:rs53962228;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048744.1	dbSNP	SNV	895	895	.	+	.	ID=2985;Variant_seq=C;Dbxref=dbSNP_129:rs52908793;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048744.1	dbSNP	SNV	897	897	.	+	.	ID=2986;Variant_seq=A;Dbxref=dbSNP_129:rs54001360;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048744.1	dbSNP	SNV	900	900	.	+	.	ID=2987;Variant_seq=A;Dbxref=dbSNP_129:rs53909614;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048744.1	dbSNP	SNV	904	904	.	+	.	ID=2988;Variant_seq=A,T;Dbxref=dbSNP_129:rs53870974;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048744.1	dbSNP	SNV	907	907	.	+	.	ID=2989;Variant_seq=A;Dbxref=dbSNP_129:rs54122080;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048744.1	dbSNP	SNV	909	909	.	+	.	ID=2990;Variant_seq=G;Dbxref=dbSNP_129:rs54094299;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048744.1	dbSNP	SNV	916	916	.	+	.	ID=2991;Variant_seq=G;Dbxref=dbSNP_129:rs52933779;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048744.1	dbSNP	SNV	917	917	.	+	.	ID=2992;Variant_seq=T;Dbxref=dbSNP_129:rs53557092;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048744.1	dbSNP	SNV	917	917	.	+	.	ID=2993;Variant_seq=A;Dbxref=dbSNP_129:rs53362919;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048744.1	dbSNP	SNV	919	919	.	+	.	ID=2994;Variant_seq=A;Dbxref=dbSNP_129:rs53479539;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048744.1	dbSNP	SNV	919	919	.	+	.	ID=2995;Variant_seq=A;Dbxref=dbSNP_129:rs52923493;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048744.1	dbSNP	SNV	924	924	.	+	.	ID=2996;Variant_seq=T;Dbxref=dbSNP_129:rs54137225;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048744.1	dbSNP	SNV	930	930	.	+	.	ID=2997;Variant_seq=T;Dbxref=dbSNP_129:rs54355230;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048744.1	dbSNP	deletion	932	932	.	+	.	ID=2998;Variant_seq=-;Dbxref=dbSNP_129:rs53487916;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038320.1	dbSNP	SNV	5129	5129	.	+	.	ID=2999;Variant_seq=C;Dbxref=dbSNP_129:rs54232669;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038320.1	dbSNP	SNV	5195	5195	.	+	.	ID=3000;Variant_seq=C;Dbxref=dbSNP_129:rs53015126;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398418.1	dbSNP	SNV	4361	4361	.	+	.	ID=3001;Variant_seq=A;Dbxref=dbSNP_129:rs53660987;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398418.1	dbSNP	SNV	10663	10663	.	+	.	ID=3002;Variant_seq=T;Dbxref=dbSNP_129:rs18921571;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398418.1	dbSNP	SNV	11014	11014	.	+	.	ID=3003;Variant_seq=T;Dbxref=dbSNP_129:rs18567702;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398418.1	dbSNP	SNV	11802	11802	.	+	.	ID=3004;Variant_seq=T;Dbxref=dbSNP_129:rs53465684;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398418.1	dbSNP	SNV	11804	11804	.	+	.	ID=3005;Variant_seq=G;Dbxref=dbSNP_129:rs53294119;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398418.1	dbSNP	SNV	11811	11811	.	+	.	ID=3006;Variant_seq=A;Dbxref=dbSNP_129:rs53661347;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398418.1	dbSNP	SNV	11817	11817	.	+	.	ID=3007;Variant_seq=A;Dbxref=dbSNP_129:rs53737133;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398418.1	dbSNP	SNV	11818	11818	.	+	.	ID=3008;Variant_seq=A;Dbxref=dbSNP_129:rs53431854;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398418.1	dbSNP	SNV	11821	11821	.	+	.	ID=3009;Variant_seq=C;Dbxref=dbSNP_129:rs53742640;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398418.1	dbSNP	SNV	17979	17979	.	+	.	ID=3010;Variant_seq=T;Dbxref=dbSNP_129:rs54171543;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046876.1	dbSNP	SNV	669	669	.	+	.	ID=3011;Variant_seq=T;Dbxref=dbSNP_129:rs53061083;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046876.1	dbSNP	SNV	671	671	.	+	.	ID=3012;Variant_seq=T;Dbxref=dbSNP_129:rs53330470;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046876.1	dbSNP	SNV	674	674	.	+	.	ID=3013;Variant_seq=A;Dbxref=dbSNP_129:rs53543759;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046876.1	dbSNP	insertion	691	691	.	+	.	ID=3014;Variant_seq=G;Dbxref=dbSNP_129:rs54028519;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02046876.1	dbSNP	SNV	695	695	.	+	.	ID=3015;Variant_seq=A;Dbxref=dbSNP_129:rs53375964;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046876.1	dbSNP	SNV	696	696	.	+	.	ID=3016;Variant_seq=C;Dbxref=dbSNP_129:rs54162684;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046876.1	dbSNP	SNV	1270	1270	.	+	.	ID=3017;Variant_seq=A;Dbxref=dbSNP_129:rs54154193;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046876.1	dbSNP	SNV	1280	1280	.	+	.	ID=3018;Variant_seq=T;Dbxref=dbSNP_129:rs54280731;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046876.1	dbSNP	SNV	1286	1286	.	+	.	ID=3019;Variant_seq=A;Dbxref=dbSNP_129:rs53321476;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046876.1	dbSNP	SNV	1288	1288	.	+	.	ID=3020;Variant_seq=A;Dbxref=dbSNP_129:rs53326082;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046876.1	dbSNP	SNV	1289	1289	.	+	.	ID=3021;Variant_seq=T;Dbxref=dbSNP_129:rs53644769;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046876.1	dbSNP	SNV	1290	1290	.	+	.	ID=3022;Variant_seq=T;Dbxref=dbSNP_129:rs53058284;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046876.1	dbSNP	SNV	1572	1572	.	+	.	ID=3023;Variant_seq=C;Dbxref=dbSNP_129:rs54336432;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046876.1	dbSNP	SNV	1573	1573	.	+	.	ID=3024;Variant_seq=C;Dbxref=dbSNP_129:rs53984526;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046876.1	dbSNP	SNV	1575	1575	.	+	.	ID=3025;Variant_seq=A;Dbxref=dbSNP_129:rs53439332;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046876.1	dbSNP	SNV	1583	1583	.	+	.	ID=3026;Variant_seq=C;Dbxref=dbSNP_129:rs52967429;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046876.1	dbSNP	SNV	1584	1584	.	+	.	ID=3027;Variant_seq=A;Dbxref=dbSNP_129:rs53088572;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046876.1	dbSNP	SNV	1589	1589	.	+	.	ID=3028;Variant_seq=T;Dbxref=dbSNP_129:rs52990614;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046876.1	dbSNP	deletion	1593	1593	.	+	.	ID=3029;Variant_seq=-;Dbxref=dbSNP_129:rs53615117;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046876.1	dbSNP	deletion	1594	1594	.	+	.	ID=3030;Variant_seq=-;Dbxref=dbSNP_129:rs54186955;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046876.1	dbSNP	SNV	1595	1595	.	+	.	ID=3031;Variant_seq=T;Dbxref=dbSNP_129:rs54191499;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046876.1	dbSNP	SNV	1597	1597	.	+	.	ID=3032;Variant_seq=G;Dbxref=dbSNP_129:rs52989320;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046876.1	dbSNP	SNV	1602	1602	.	+	.	ID=3033;Variant_seq=G;Dbxref=dbSNP_129:rs54358650;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046876.1	dbSNP	SNV	1608	1608	.	+	.	ID=3034;Variant_seq=C;Dbxref=dbSNP_129:rs53090606;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046876.1	dbSNP	SNV	1609	1609	.	+	.	ID=3035;Variant_seq=A,C;Dbxref=dbSNP_129:rs53065357;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046876.1	dbSNP	SNV	1621	1621	.	+	.	ID=3036;Variant_seq=A;Dbxref=dbSNP_129:rs54213381;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046876.1	dbSNP	SNV	1626	1626	.	+	.	ID=3037;Variant_seq=C;Dbxref=dbSNP_129:rs54157190;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046876.1	dbSNP	SNV	1655	1655	.	+	.	ID=3038;Variant_seq=T;Dbxref=dbSNP_129:rs53366072;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046876.1	dbSNP	SNV	1711	1711	.	+	.	ID=3039;Variant_seq=T;Dbxref=dbSNP_129:rs54331867;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046876.1	dbSNP	SNV	1723	1723	.	+	.	ID=3040;Variant_seq=T;Dbxref=dbSNP_129:rs53128996;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046876.1	dbSNP	SNV	1726	1726	.	+	.	ID=3041;Variant_seq=A;Dbxref=dbSNP_129:rs53811151;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046876.1	dbSNP	SNV	1729	1729	.	+	.	ID=3042;Variant_seq=T;Dbxref=dbSNP_129:rs54282384;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398722.1	dbSNP	SNV	2678	2678	.	+	.	ID=3043;Variant_seq=G;Dbxref=dbSNP_129:rs53767995;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398722.1	dbSNP	SNV	2830	2830	.	+	.	ID=3044;Variant_seq=A;Dbxref=dbSNP_129:rs53998446;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398722.1	dbSNP	SNV	3387	3387	.	+	.	ID=3045;Variant_seq=A;Dbxref=dbSNP_129:rs53496194;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398722.1	dbSNP	SNV	3388	3388	.	+	.	ID=3046;Variant_seq=T;Dbxref=dbSNP_129:rs54180316;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398722.1	dbSNP	SNV	3389	3389	.	+	.	ID=3047;Variant_seq=T;Dbxref=dbSNP_129:rs53886138;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398722.1	dbSNP	SNV	3395	3395	.	+	.	ID=3048;Variant_seq=G;Dbxref=dbSNP_129:rs53120092;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398722.1	dbSNP	SNV	3399	3399	.	+	.	ID=3049;Variant_seq=G;Dbxref=dbSNP_129:rs53014375;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398722.1	dbSNP	SNV	3407	3407	.	+	.	ID=3050;Variant_seq=T;Dbxref=dbSNP_129:rs53595029;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398722.1	dbSNP	insertion	3448	3448	.	+	.	ID=3051;Variant_seq=GCTTAAT;Dbxref=dbSNP_129:rs53180667;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398722.1	dbSNP	SNV	3453	3453	.	+	.	ID=3052;Variant_seq=C;Dbxref=dbSNP_129:rs53475270;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398722.1	dbSNP	SNV	3458	3458	.	+	.	ID=3053;Variant_seq=A;Dbxref=dbSNP_129:rs54399107;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398722.1	dbSNP	SNV	3465	3465	.	+	.	ID=3054;Variant_seq=T;Dbxref=dbSNP_129:rs53737267;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398722.1	dbSNP	SNV	8293	8293	.	+	.	ID=3055;Variant_seq=T;Dbxref=dbSNP_129:rs19609142;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398722.1	dbSNP	SNV	8811	8811	.	+	.	ID=3056;Variant_seq=A;Dbxref=dbSNP_129:rs19609082;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	160	160	.	+	.	ID=3057;Variant_seq=G;Dbxref=dbSNP_129:rs19124435;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	167	167	.	+	.	ID=3058;Variant_seq=A;Dbxref=dbSNP_129:rs19124425;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	183	183	.	+	.	ID=3059;Variant_seq=T;Dbxref=dbSNP_129:rs19124415;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	206	206	.	+	.	ID=3060;Variant_seq=G;Dbxref=dbSNP_129:rs19124395;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	344	344	.	+	.	ID=3061;Variant_seq=A;Dbxref=dbSNP_129:rs19124193;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	346	346	.	+	.	ID=3062;Variant_seq=A;Dbxref=dbSNP_129:rs19124183;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	352	352	.	+	.	ID=3063;Variant_seq=T;Dbxref=dbSNP_129:rs19124173;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	362	362	.	+	.	ID=3064;Variant_seq=T;Dbxref=dbSNP_129:rs19124153;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	363	363	.	+	.	ID=3065;Variant_seq=T;Dbxref=dbSNP_129:rs19124143;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	364	364	.	+	.	ID=3066;Variant_seq=C;Dbxref=dbSNP_129:rs19124133;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	371	371	.	+	.	ID=3067;Variant_seq=C;Dbxref=dbSNP_129:rs19124113;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	376	376	.	+	.	ID=3068;Variant_seq=G;Dbxref=dbSNP_129:rs19124093;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	380	380	.	+	.	ID=3069;Variant_seq=G;Dbxref=dbSNP_129:rs19124083;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	381	381	.	+	.	ID=3070;Variant_seq=T;Dbxref=dbSNP_129:rs19124073;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	394	394	.	+	.	ID=3071;Variant_seq=C;Dbxref=dbSNP_129:rs19124043;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	399	399	.	+	.	ID=3072;Variant_seq=C;Dbxref=dbSNP_129:rs19124023;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	405	405	.	+	.	ID=3073;Variant_seq=C;Dbxref=dbSNP_129:rs19124013;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	406	406	.	+	.	ID=3074;Variant_seq=C;Dbxref=dbSNP_129:rs19124003;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	407	407	.	+	.	ID=3075;Variant_seq=G;Dbxref=dbSNP_129:rs19123993;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	412	412	.	+	.	ID=3076;Variant_seq=G;Dbxref=dbSNP_129:rs19123973;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	413	413	.	+	.	ID=3077;Variant_seq=C;Dbxref=dbSNP_129:rs19123963;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	424	424	.	+	.	ID=3078;Variant_seq=A;Dbxref=dbSNP_129:rs19123953;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	436	436	.	+	.	ID=3079;Variant_seq=C;Dbxref=dbSNP_129:rs19123943;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	453	453	.	+	.	ID=3080;Variant_seq=A;Dbxref=dbSNP_129:rs19123923;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	464	464	.	+	.	ID=3081;Variant_seq=C;Dbxref=dbSNP_129:rs19123913;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	716	716	.	+	.	ID=3082;Variant_seq=C;Dbxref=dbSNP_129:rs19123623;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	725	725	.	+	.	ID=3083;Variant_seq=C;Dbxref=dbSNP_129:rs19123613;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	730	730	.	+	.	ID=3084;Variant_seq=C;Dbxref=dbSNP_129:rs19123603;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	737	737	.	+	.	ID=3085;Variant_seq=A;Dbxref=dbSNP_129:rs19123593;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	740	740	.	+	.	ID=3086;Variant_seq=G;Dbxref=dbSNP_129:rs19123583;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	759	759	.	+	.	ID=3087;Variant_seq=G;Dbxref=dbSNP_129:rs19123563;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	760	760	.	+	.	ID=3088;Variant_seq=G;Dbxref=dbSNP_129:rs19123553;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	767	767	.	+	.	ID=3089;Variant_seq=C;Dbxref=dbSNP_129:rs19123523;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	773	773	.	+	.	ID=3090;Variant_seq=T;Dbxref=dbSNP_129:rs19123513;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	778	778	.	+	.	ID=3091;Variant_seq=G;Dbxref=dbSNP_129:rs19123503;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	789	789	.	+	.	ID=3092;Variant_seq=C;Dbxref=dbSNP_129:rs19123473;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	795	795	.	+	.	ID=3093;Variant_seq=A;Dbxref=dbSNP_129:rs19123452;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	800	800	.	+	.	ID=3094;Variant_seq=T;Dbxref=dbSNP_129:rs19123442;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	803	803	.	+	.	ID=3095;Variant_seq=G;Dbxref=dbSNP_129:rs19123432;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	808	808	.	+	.	ID=3096;Variant_seq=C;Dbxref=dbSNP_129:rs19123422;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	813	813	.	+	.	ID=3097;Variant_seq=A;Dbxref=dbSNP_129:rs19123402;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	913	913	.	+	.	ID=3098;Variant_seq=C;Dbxref=dbSNP_129:rs19123272;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	928	928	.	+	.	ID=3099;Variant_seq=C;Dbxref=dbSNP_129:rs19123242;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	932	932	.	+	.	ID=3100;Variant_seq=C;Dbxref=dbSNP_129:rs19123232;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	946	946	.	+	.	ID=3101;Variant_seq=T;Dbxref=dbSNP_129:rs19123222;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	952	952	.	+	.	ID=3102;Variant_seq=C;Dbxref=dbSNP_129:rs19123212;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	965	965	.	+	.	ID=3103;Variant_seq=C;Dbxref=dbSNP_129:rs19123182;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	984	984	.	+	.	ID=3104;Variant_seq=T;Dbxref=dbSNP_129:rs19123153;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	993	993	.	+	.	ID=3105;Variant_seq=A;Dbxref=dbSNP_129:rs19123143;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1006	1006	.	+	.	ID=3106;Variant_seq=C;Dbxref=dbSNP_129:rs19123123;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1023	1023	.	+	.	ID=3107;Variant_seq=C;Dbxref=dbSNP_129:rs19123103;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1034	1034	.	+	.	ID=3108;Variant_seq=T;Dbxref=dbSNP_129:rs19123093;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1035	1035	.	+	.	ID=3109;Variant_seq=C;Dbxref=dbSNP_129:rs19123083;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1036	1036	.	+	.	ID=3110;Variant_seq=T;Dbxref=dbSNP_129:rs19123073;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1040	1040	.	+	.	ID=3111;Variant_seq=A;Dbxref=dbSNP_129:rs19123063;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1044	1044	.	+	.	ID=3112;Variant_seq=T;Dbxref=dbSNP_129:rs19123053;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1061	1061	.	+	.	ID=3113;Variant_seq=G;Dbxref=dbSNP_129:rs19123023;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1067	1067	.	+	.	ID=3114;Variant_seq=G;Dbxref=dbSNP_129:rs19123011;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1078	1078	.	+	.	ID=3115;Variant_seq=T;Dbxref=dbSNP_129:rs19122981;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1079	1079	.	+	.	ID=3116;Variant_seq=C;Dbxref=dbSNP_129:rs19122971;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1083	1083	.	+	.	ID=3117;Variant_seq=C;Dbxref=dbSNP_129:rs19122951;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1129	1129	.	+	.	ID=3118;Variant_seq=G;Dbxref=dbSNP_129:rs19122771;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1150	1150	.	+	.	ID=3119;Variant_seq=G;Dbxref=dbSNP_129:rs19122751;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1151	1151	.	+	.	ID=3120;Variant_seq=T;Dbxref=dbSNP_129:rs19122741;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1155	1155	.	+	.	ID=3121;Variant_seq=T;Dbxref=dbSNP_129:rs19122721;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1174	1174	.	+	.	ID=3122;Variant_seq=C;Dbxref=dbSNP_129:rs19122711;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1175	1175	.	+	.	ID=3123;Variant_seq=G;Dbxref=dbSNP_129:rs19122701;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1179	1179	.	+	.	ID=3124;Variant_seq=A;Dbxref=dbSNP_129:rs19122691;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1180	1180	.	+	.	ID=3125;Variant_seq=G;Dbxref=dbSNP_129:rs19122681;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1184	1184	.	+	.	ID=3126;Variant_seq=G;Dbxref=dbSNP_129:rs19122671;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1190	1190	.	+	.	ID=3127;Variant_seq=G;Dbxref=dbSNP_129:rs19122651;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1204	1204	.	+	.	ID=3128;Variant_seq=A;Dbxref=dbSNP_129:rs19122641;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1211	1211	.	+	.	ID=3129;Variant_seq=C;Dbxref=dbSNP_129:rs19122621;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1214	1214	.	+	.	ID=3130;Variant_seq=G;Dbxref=dbSNP_129:rs19122601;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1216	1216	.	+	.	ID=3131;Variant_seq=T;Dbxref=dbSNP_129:rs19122591;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1218	1218	.	+	.	ID=3132;Variant_seq=G;Dbxref=dbSNP_129:rs19122581;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1220	1220	.	+	.	ID=3133;Variant_seq=A;Dbxref=dbSNP_129:rs19122571;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1229	1229	.	+	.	ID=3134;Variant_seq=C;Dbxref=dbSNP_129:rs19122561;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1238	1238	.	+	.	ID=3135;Variant_seq=A;Dbxref=dbSNP_129:rs19122541;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1241	1241	.	+	.	ID=3136;Variant_seq=C;Dbxref=dbSNP_129:rs19122531;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1244	1244	.	+	.	ID=3137;Variant_seq=T;Dbxref=dbSNP_129:rs19122521;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1250	1250	.	+	.	ID=3138;Variant_seq=T;Dbxref=dbSNP_129:rs19122491;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1251	1251	.	+	.	ID=3139;Variant_seq=A;Dbxref=dbSNP_129:rs19122481;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1269	1269	.	+	.	ID=3140;Variant_seq=G;Dbxref=dbSNP_129:rs19122471;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1270	1270	.	+	.	ID=3141;Variant_seq=C;Dbxref=dbSNP_129:rs19122461;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1274	1274	.	+	.	ID=3142;Variant_seq=G;Dbxref=dbSNP_129:rs19122451;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1275	1275	.	+	.	ID=3143;Variant_seq=G;Dbxref=dbSNP_129:rs19122441;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1277	1277	.	+	.	ID=3144;Variant_seq=T;Dbxref=dbSNP_129:rs19122431;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1282	1282	.	+	.	ID=3145;Variant_seq=C;Dbxref=dbSNP_129:rs19122411;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1354	1354	.	+	.	ID=3146;Variant_seq=C;Dbxref=dbSNP_129:rs19122351;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1359	1359	.	+	.	ID=3147;Variant_seq=C;Dbxref=dbSNP_129:rs19122341;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1361	1361	.	+	.	ID=3148;Variant_seq=T;Dbxref=dbSNP_129:rs19122331;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1372	1372	.	+	.	ID=3149;Variant_seq=G;Dbxref=dbSNP_129:rs19122311;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1373	1373	.	+	.	ID=3150;Variant_seq=A;Dbxref=dbSNP_129:rs19122301;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1378	1378	.	+	.	ID=3151;Variant_seq=T;Dbxref=dbSNP_129:rs19122291;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1380	1380	.	+	.	ID=3152;Variant_seq=C;Dbxref=dbSNP_129:rs19122281;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1388	1388	.	+	.	ID=3153;Variant_seq=T;Dbxref=dbSNP_129:rs19122251;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1399	1399	.	+	.	ID=3154;Variant_seq=T;Dbxref=dbSNP_129:rs19122241;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1401	1401	.	+	.	ID=3155;Variant_seq=T;Dbxref=dbSNP_129:rs19122231;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1402	1402	.	+	.	ID=3156;Variant_seq=C;Dbxref=dbSNP_129:rs19122221;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1408	1408	.	+	.	ID=3157;Variant_seq=C;Dbxref=dbSNP_129:rs19122211;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1426	1426	.	+	.	ID=3158;Variant_seq=C;Dbxref=dbSNP_129:rs19122191;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1438	1438	.	+	.	ID=3159;Variant_seq=G;Dbxref=dbSNP_129:rs19122171;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1444	1444	.	+	.	ID=3160;Variant_seq=G;Dbxref=dbSNP_129:rs19122161;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1445	1445	.	+	.	ID=3161;Variant_seq=T;Dbxref=dbSNP_129:rs19122151;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1467	1467	.	+	.	ID=3162;Variant_seq=G;Dbxref=dbSNP_129:rs19122131;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1479	1479	.	+	.	ID=3163;Variant_seq=G;Dbxref=dbSNP_129:rs19122121;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1492	1492	.	+	.	ID=3164;Variant_seq=C;Dbxref=dbSNP_129:rs19122111;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1499	1499	.	+	.	ID=3165;Variant_seq=A;Dbxref=dbSNP_129:rs19122091;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1505	1505	.	+	.	ID=3166;Variant_seq=T;Dbxref=dbSNP_129:rs19122071;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1510	1510	.	+	.	ID=3167;Variant_seq=T;Dbxref=dbSNP_129:rs19122051;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1511	1511	.	+	.	ID=3168;Variant_seq=G;Dbxref=dbSNP_129:rs19122041;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1516	1516	.	+	.	ID=3169;Variant_seq=G;Dbxref=dbSNP_129:rs19122031;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1526	1526	.	+	.	ID=3170;Variant_seq=C;Dbxref=dbSNP_129:rs19122011;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1550	1550	.	+	.	ID=3171;Variant_seq=T;Dbxref=dbSNP_129:rs19121971;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1552	1552	.	+	.	ID=3172;Variant_seq=C;Dbxref=dbSNP_129:rs19121961;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1572	1572	.	+	.	ID=3173;Variant_seq=T;Dbxref=dbSNP_129:rs19121951;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1574	1574	.	+	.	ID=3174;Variant_seq=T;Dbxref=dbSNP_129:rs19121941;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1576	1576	.	+	.	ID=3175;Variant_seq=A;Dbxref=dbSNP_129:rs19121931;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1582	1582	.	+	.	ID=3176;Variant_seq=G;Dbxref=dbSNP_129:rs19121921;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1592	1592	.	+	.	ID=3177;Variant_seq=C;Dbxref=dbSNP_129:rs19121911;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1598	1598	.	+	.	ID=3178;Variant_seq=G;Dbxref=dbSNP_129:rs19121901;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1607	1607	.	+	.	ID=3179;Variant_seq=C;Dbxref=dbSNP_129:rs19121891;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1611	1611	.	+	.	ID=3180;Variant_seq=C;Dbxref=dbSNP_129:rs19121882;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1616	1616	.	+	.	ID=3181;Variant_seq=C;Dbxref=dbSNP_129:rs19121872;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1617	1617	.	+	.	ID=3182;Variant_seq=T;Dbxref=dbSNP_129:rs19121862;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1628	1628	.	+	.	ID=3183;Variant_seq=A;Dbxref=dbSNP_129:rs19121842;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1631	1631	.	+	.	ID=3184;Variant_seq=A;Dbxref=dbSNP_129:rs19121832;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1640	1640	.	+	.	ID=3185;Variant_seq=G;Dbxref=dbSNP_129:rs19121822;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1712	1712	.	+	.	ID=3186;Variant_seq=A;Dbxref=dbSNP_129:rs19121752;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1718	1718	.	+	.	ID=3187;Variant_seq=C;Dbxref=dbSNP_129:rs19121732;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1725	1725	.	+	.	ID=3188;Variant_seq=T;Dbxref=dbSNP_129:rs19121722;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1726	1726	.	+	.	ID=3189;Variant_seq=G;Dbxref=dbSNP_129:rs19121712;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1741	1741	.	+	.	ID=3190;Variant_seq=A;Dbxref=dbSNP_129:rs19121692;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1743	1743	.	+	.	ID=3191;Variant_seq=T;Dbxref=dbSNP_129:rs19121682;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1750	1750	.	+	.	ID=3192;Variant_seq=T;Dbxref=dbSNP_129:rs19121662;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1751	1751	.	+	.	ID=3193;Variant_seq=C;Dbxref=dbSNP_129:rs19121652;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1755	1755	.	+	.	ID=3194;Variant_seq=C;Dbxref=dbSNP_129:rs19121642;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	1768	1768	.	+	.	ID=3195;Variant_seq=G;Dbxref=dbSNP_129:rs19121622;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1773	1773	.	+	.	ID=3196;Variant_seq=G;Dbxref=dbSNP_129:rs19121612;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	1780	1780	.	+	.	ID=3197;Variant_seq=T;Dbxref=dbSNP_129:rs19121602;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1786	1786	.	+	.	ID=3198;Variant_seq=C;Dbxref=dbSNP_129:rs19121582;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1919	1919	.	+	.	ID=3199;Variant_seq=T;Dbxref=dbSNP_129:rs19121432;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	1929	1929	.	+	.	ID=3200;Variant_seq=C;Dbxref=dbSNP_129:rs19121412;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1955	1955	.	+	.	ID=3201;Variant_seq=C;Dbxref=dbSNP_129:rs19121402;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399240.1	dbSNP	SNV	1983	1983	.	+	.	ID=3202;Variant_seq=A;Dbxref=dbSNP_129:rs19121373;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399240.1	dbSNP	SNV	3890	3890	.	+	.	ID=3203;Variant_seq=T;Dbxref=dbSNP_129:rs54037669;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399240.1	dbSNP	SNV	3914	3914	.	+	.	ID=3204;Variant_seq=G;Dbxref=dbSNP_129:rs53324129;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399240.1	dbSNP	SNV	3929	3929	.	+	.	ID=3205;Variant_seq=G;Dbxref=dbSNP_129:rs53473905;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043130.1	dbSNP	SNV	1191	1191	.	+	.	ID=3206;Variant_seq=G;Dbxref=dbSNP_129:rs53118524;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043130.1	dbSNP	SNV	1194	1194	.	+	.	ID=3207;Variant_seq=C;Dbxref=dbSNP_129:rs54130618;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043130.1	dbSNP	SNV	1636	1636	.	+	.	ID=3208;Variant_seq=A;Dbxref=dbSNP_129:rs53521439;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047744.1	dbSNP	SNV	1441	1441	.	+	.	ID=3209;Variant_seq=G;Dbxref=dbSNP_129:rs21756159;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047744.1	dbSNP	SNV	1452	1452	.	+	.	ID=3210;Variant_seq=C;Dbxref=dbSNP_129:rs21756231;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399797.1	dbSNP	SNV	1586	1586	.	+	.	ID=3211;Variant_seq=A;Dbxref=dbSNP_129:rs19565934;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399797.1	dbSNP	SNV	1592	1592	.	+	.	ID=3212;Variant_seq=C;Dbxref=dbSNP_129:rs19565904;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399797.1	dbSNP	SNV	1593	1593	.	+	.	ID=3213;Variant_seq=T;Dbxref=dbSNP_129:rs19565894;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399797.1	dbSNP	SNV	1598	1598	.	+	.	ID=3214;Variant_seq=G;Dbxref=dbSNP_129:rs19565884;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399797.1	dbSNP	SNV	1616	1616	.	+	.	ID=3215;Variant_seq=C;Dbxref=dbSNP_129:rs19565814;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399797.1	dbSNP	SNV	1621	1621	.	+	.	ID=3216;Variant_seq=C;Dbxref=dbSNP_129:rs19565784;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399797.1	dbSNP	SNV	1631	1631	.	+	.	ID=3217;Variant_seq=C;Dbxref=dbSNP_129:rs19565724;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399797.1	dbSNP	SNV	1635	1635	.	+	.	ID=3218;Variant_seq=G;Dbxref=dbSNP_129:rs19565714;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399797.1	dbSNP	SNV	1643	1643	.	+	.	ID=3219;Variant_seq=C;Dbxref=dbSNP_129:rs19565684;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399797.1	dbSNP	SNV	1644	1644	.	+	.	ID=3220;Variant_seq=G;Dbxref=dbSNP_129:rs19565674;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042879.1	dbSNP	SNV	2152	2152	.	+	.	ID=3221;Variant_seq=A;Dbxref=dbSNP_129:rs53264343;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042879.1	dbSNP	SNV	2153	2153	.	+	.	ID=3222;Variant_seq=A,T;Dbxref=dbSNP_129:rs54316358;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045346.1	dbSNP	SNV	486	486	.	+	.	ID=3223;Variant_seq=A;Dbxref=dbSNP_129:rs54401964;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045346.1	dbSNP	SNV	534	534	.	+	.	ID=3224;Variant_seq=A;Dbxref=dbSNP_129:rs54010900;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045346.1	dbSNP	SNV	538	538	.	+	.	ID=3225;Variant_seq=G;Dbxref=dbSNP_129:rs53645208;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045346.1	dbSNP	SNV	548	548	.	+	.	ID=3226;Variant_seq=G;Dbxref=dbSNP_129:rs54277150;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045346.1	dbSNP	SNV	558	558	.	+	.	ID=3227;Variant_seq=A;Dbxref=dbSNP_129:rs53054601;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045346.1	dbSNP	SNV	796	796	.	+	.	ID=3228;Variant_seq=A;Dbxref=dbSNP_129:rs54203512;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040680.1	dbSNP	SNV	406	406	.	+	.	ID=3229;Variant_seq=A;Dbxref=dbSNP_129:rs19847357;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040680.1	dbSNP	SNV	734	734	.	+	.	ID=3230;Variant_seq=A;Dbxref=dbSNP_129:rs19847427;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040680.1	dbSNP	SNV	825	825	.	+	.	ID=3231;Variant_seq=T;Dbxref=dbSNP_129:rs19847437;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040680.1	dbSNP	SNV	1124	1124	.	+	.	ID=3232;Variant_seq=T;Dbxref=dbSNP_129:rs19847487;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040680.1	dbSNP	SNV	1269	1269	.	+	.	ID=3233;Variant_seq=A;Dbxref=dbSNP_129:rs19847497;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040680.1	dbSNP	SNV	1322	1322	.	+	.	ID=3234;Variant_seq=A;Dbxref=dbSNP_129:rs19847507;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040680.1	dbSNP	SNV	1391	1391	.	+	.	ID=3235;Variant_seq=T;Dbxref=dbSNP_129:rs19847517;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040680.1	dbSNP	SNV	1731	1731	.	+	.	ID=3236;Variant_seq=T;Dbxref=dbSNP_129:rs19847597;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040680.1	dbSNP	SNV	1790	1790	.	+	.	ID=3237;Variant_seq=C;Dbxref=dbSNP_129:rs19847617;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02040680.1	dbSNP	SNV	1881	1881	.	+	.	ID=3238;Variant_seq=A;Dbxref=dbSNP_129:rs19847637;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040680.1	dbSNP	SNV	2063	2063	.	+	.	ID=3239;Variant_seq=T;Dbxref=dbSNP_129:rs19847657;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040680.1	dbSNP	SNV	2135	2135	.	+	.	ID=3240;Variant_seq=T;Dbxref=dbSNP_129:rs19847667;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040680.1	dbSNP	SNV	2399	2399	.	+	.	ID=3241;Variant_seq=A;Dbxref=dbSNP_129:rs19847677;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040680.1	dbSNP	SNV	2582	2582	.	+	.	ID=3242;Variant_seq=G;Dbxref=dbSNP_129:rs19847687;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040680.1	dbSNP	SNV	2783	2783	.	+	.	ID=3243;Variant_seq=T;Dbxref=dbSNP_129:rs19847727;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040680.1	dbSNP	SNV	3205	3205	.	+	.	ID=3244;Variant_seq=T;Dbxref=dbSNP_129:rs19847787;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02040680.1	dbSNP	SNV	3278	3278	.	+	.	ID=3245;Variant_seq=T;Dbxref=dbSNP_129:rs19847797;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040680.1	dbSNP	SNV	3447	3447	.	+	.	ID=3246;Variant_seq=T;Dbxref=dbSNP_129:rs19847837;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040680.1	dbSNP	SNV	3692	3692	.	+	.	ID=3247;Variant_seq=A;Dbxref=dbSNP_129:rs19847877;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040680.1	dbSNP	SNV	3708	3708	.	+	.	ID=3248;Variant_seq=A;Dbxref=dbSNP_129:rs19847887;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040680.1	dbSNP	SNV	3814	3814	.	+	.	ID=3249;Variant_seq=A;Dbxref=dbSNP_129:rs19847897;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040680.1	dbSNP	SNV	3980	3980	.	+	.	ID=3250;Variant_seq=A;Dbxref=dbSNP_129:rs19847907;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040680.1	dbSNP	SNV	4316	4316	.	+	.	ID=3251;Variant_seq=T;Dbxref=dbSNP_129:rs19847927;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040680.1	dbSNP	SNV	4498	4498	.	+	.	ID=3252;Variant_seq=G;Dbxref=dbSNP_129:rs19847937;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02040680.1	dbSNP	SNV	4636	4636	.	+	.	ID=3253;Variant_seq=C;Dbxref=dbSNP_129:rs53972578;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040680.1	dbSNP	SNV	4640	4640	.	+	.	ID=3254;Variant_seq=A;Dbxref=dbSNP_129:rs53706601;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040680.1	dbSNP	SNV	4650	4650	.	+	.	ID=3255;Variant_seq=T;Dbxref=dbSNP_129:rs53481401;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040680.1	dbSNP	SNV	4664	4664	.	+	.	ID=3256;Variant_seq=G;Dbxref=dbSNP_129:rs53966555;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02040680.1	dbSNP	SNV	4670	4670	.	+	.	ID=3257;Variant_seq=C;Dbxref=dbSNP_129:rs53304507;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040680.1	dbSNP	SNV	4692	4692	.	+	.	ID=3258;Variant_seq=A;Dbxref=dbSNP_129:rs53678932;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040680.1	dbSNP	SNV	4718	4718	.	+	.	ID=3259;Variant_seq=T;Dbxref=dbSNP_129:rs53713805;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040680.1	dbSNP	SNV	4732	4732	.	+	.	ID=3260;Variant_seq=A;Dbxref=dbSNP_129:rs53132997;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040680.1	dbSNP	SNV	4732	4732	.	+	.	ID=3261;Variant_seq=A;Dbxref=dbSNP_129:rs19847947;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040680.1	dbSNP	SNV	4738	4738	.	+	.	ID=3262;Variant_seq=A;Dbxref=dbSNP_129:rs54042358;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040680.1	dbSNP	SNV	4742	4742	.	+	.	ID=3263;Variant_seq=T;Dbxref=dbSNP_129:rs54250220;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040680.1	dbSNP	SNV	4749	4749	.	+	.	ID=3264;Variant_seq=C;Dbxref=dbSNP_129:rs54289148;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399378.1	dbSNP	SNV	5289	5289	.	+	.	ID=3265;Variant_seq=G;Dbxref=dbSNP_129:rs20486523;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399378.1	dbSNP	SNV	5321	5321	.	+	.	ID=3266;Variant_seq=T;Dbxref=dbSNP_129:rs20486533;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399378.1	dbSNP	SNV	5352	5352	.	+	.	ID=3267;Variant_seq=A;Dbxref=dbSNP_129:rs20486543;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399378.1	dbSNP	SNV	5360	5360	.	+	.	ID=3268;Variant_seq=A;Dbxref=dbSNP_129:rs20486553;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399378.1	dbSNP	SNV	5364	5364	.	+	.	ID=3269;Variant_seq=G;Dbxref=dbSNP_129:rs20486563;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399378.1	dbSNP	SNV	5385	5385	.	+	.	ID=3270;Variant_seq=C;Dbxref=dbSNP_129:rs20486573;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399378.1	dbSNP	SNV	5429	5429	.	+	.	ID=3271;Variant_seq=G;Dbxref=dbSNP_129:rs20486583;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399378.1	dbSNP	SNV	5441	5441	.	+	.	ID=3272;Variant_seq=C;Dbxref=dbSNP_129:rs20486593;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399378.1	dbSNP	SNV	5547	5547	.	+	.	ID=3273;Variant_seq=G;Dbxref=dbSNP_129:rs20486603;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399378.1	dbSNP	SNV	5680	5680	.	+	.	ID=3274;Variant_seq=T;Dbxref=dbSNP_129:rs20486613;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398371.1	dbSNP	SNV	8438	8438	.	+	.	ID=3275;Variant_seq=T;Dbxref=dbSNP_129:rs54142067;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398371.1	dbSNP	SNV	8468	8468	.	+	.	ID=3276;Variant_seq=T;Dbxref=dbSNP_129:rs54246128;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398371.1	dbSNP	SNV	8476	8476	.	+	.	ID=3277;Variant_seq=A;Dbxref=dbSNP_129:rs54105203;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398371.1	dbSNP	SNV	8489	8489	.	+	.	ID=3278;Variant_seq=A;Dbxref=dbSNP_129:rs52903620;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398371.1	dbSNP	insertion	8494	8494	.	+	.	ID=3279;Variant_seq=GAGAAGGC;Dbxref=dbSNP_129:rs54035788;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398371.1	dbSNP	insertion	8497	8497	.	+	.	ID=3280;Variant_seq=TCC;Dbxref=dbSNP_129:rs53782545;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398371.1	dbSNP	insertion	8498	8498	.	+	.	ID=3281;Variant_seq=GTT;Dbxref=dbSNP_129:rs54362209;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398371.1	dbSNP	insertion	8499	8499	.	+	.	ID=3282;Variant_seq=GGAA;Dbxref=dbSNP_129:rs53868922;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398371.1	dbSNP	insertion	8519	8519	.	+	.	ID=3283;Variant_seq=GAA;Dbxref=dbSNP_129:rs53095061;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398371.1	dbSNP	SNV	12154	12154	.	+	.	ID=3284;Variant_seq=G;Dbxref=dbSNP_129:rs53347107;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049027.1	dbSNP	SNV	221	221	.	+	.	ID=3285;Variant_seq=C;Dbxref=dbSNP_129:rs19686056;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049027.1	dbSNP	SNV	705	705	.	+	.	ID=3286;Variant_seq=A;Dbxref=dbSNP_129:rs19686176;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049027.1	dbSNP	SNV	769	769	.	+	.	ID=3287;Variant_seq=A;Dbxref=dbSNP_129:rs21728741;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049027.1	dbSNP	SNV	948	948	.	+	.	ID=3288;Variant_seq=T;Dbxref=dbSNP_129:rs19686216;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049027.1	dbSNP	SNV	1078	1078	.	+	.	ID=3289;Variant_seq=A;Dbxref=dbSNP_129:rs19686226;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049027.1	dbSNP	SNV	1631	1631	.	+	.	ID=3290;Variant_seq=T;Dbxref=dbSNP_129:rs19876340;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049027.1	dbSNP	SNV	1925	1925	.	+	.	ID=3291;Variant_seq=T;Dbxref=dbSNP_129:rs19686316;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048847.1	dbSNP	SNV	1741	1741	.	+	.	ID=3292;Variant_seq=A;Dbxref=dbSNP_129:rs53869276;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398396.1	dbSNP	SNV	4545	4545	.	+	.	ID=3293;Variant_seq=G;Dbxref=dbSNP_129:rs53387719;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398396.1	dbSNP	SNV	15058	15058	.	+	.	ID=3294;Variant_seq=C;Dbxref=dbSNP_129:rs21691463;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398396.1	dbSNP	SNV	19163	19163	.	+	.	ID=3295;Variant_seq=G;Dbxref=dbSNP_129:rs20115220;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049504.1	dbSNP	SNV	1536	1536	.	+	.	ID=3296;Variant_seq=A;Dbxref=dbSNP_129:rs20819298;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049504.1	dbSNP	SNV	1996	1996	.	+	.	ID=3297;Variant_seq=C;Dbxref=dbSNP_129:rs20819288;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044616.1	dbSNP	SNV	243	243	.	+	.	ID=3298;Variant_seq=A;Dbxref=dbSNP_129:rs54355187;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044616.1	dbSNP	SNV	1537	1537	.	+	.	ID=3299;Variant_seq=T;Dbxref=dbSNP_129:rs53736567;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039888.1	dbSNP	SNV	3206	3206	.	+	.	ID=3300;Variant_seq=G;Dbxref=dbSNP_129:rs18478846;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039888.1	dbSNP	SNV	3551	3551	.	+	.	ID=3301;Variant_seq=G;Dbxref=dbSNP_129:rs18478810;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039888.1	dbSNP	SNV	3552	3552	.	+	.	ID=3302;Variant_seq=T;Dbxref=dbSNP_129:rs18478801;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039888.1	dbSNP	SNV	3554	3554	.	+	.	ID=3303;Variant_seq=G;Dbxref=dbSNP_129:rs18478792;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039888.1	dbSNP	SNV	3555	3555	.	+	.	ID=3304;Variant_seq=G;Dbxref=dbSNP_129:rs18478783;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039888.1	dbSNP	SNV	3574	3574	.	+	.	ID=3305;Variant_seq=C;Dbxref=dbSNP_129:rs18478774;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039888.1	dbSNP	SNV	3581	3581	.	+	.	ID=3306;Variant_seq=C;Dbxref=dbSNP_129:rs18478765;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039888.1	dbSNP	SNV	3585	3585	.	+	.	ID=3307;Variant_seq=C;Dbxref=dbSNP_129:rs18478756;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039888.1	dbSNP	SNV	3586	3586	.	+	.	ID=3308;Variant_seq=G;Dbxref=dbSNP_129:rs18478747;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039888.1	dbSNP	SNV	3598	3598	.	+	.	ID=3309;Variant_seq=T;Dbxref=dbSNP_129:rs18478729;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039888.1	dbSNP	SNV	3599	3599	.	+	.	ID=3310;Variant_seq=T;Dbxref=dbSNP_129:rs18478720;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039888.1	dbSNP	SNV	3601	3601	.	+	.	ID=3311;Variant_seq=A;Dbxref=dbSNP_129:rs18478711;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039888.1	dbSNP	SNV	4157	4157	.	+	.	ID=3312;Variant_seq=T;Dbxref=dbSNP_129:rs18238200;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039888.1	dbSNP	SNV	4160	4160	.	+	.	ID=3313;Variant_seq=A;Dbxref=dbSNP_129:rs18238191;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039888.1	dbSNP	SNV	4162	4162	.	+	.	ID=3314;Variant_seq=G;Dbxref=dbSNP_129:rs18238182;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039888.1	dbSNP	SNV	4184	4184	.	+	.	ID=3315;Variant_seq=A;Dbxref=dbSNP_129:rs18478467;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039888.1	dbSNP	SNV	4745	4745	.	+	.	ID=3316;Variant_seq=C;Dbxref=dbSNP_129:rs53677200;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039888.1	dbSNP	deletion	4747	4747	.	+	.	ID=3317;Variant_seq=-;Dbxref=dbSNP_129:rs53170406;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039888.1	dbSNP	SNV	5237	5237	.	+	.	ID=3318;Variant_seq=G;Dbxref=dbSNP_129:rs20516963;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039888.1	dbSNP	SNV	5241	5241	.	+	.	ID=3319;Variant_seq=A;Dbxref=dbSNP_129:rs20516953;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039888.1	dbSNP	SNV	5244	5244	.	+	.	ID=3320;Variant_seq=C;Dbxref=dbSNP_129:rs20516943;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039888.1	dbSNP	SNV	5458	5458	.	+	.	ID=3321;Variant_seq=A;Dbxref=dbSNP_129:rs20516933;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049826.1	dbSNP	SNV	576	576	.	+	.	ID=3322;Variant_seq=A,T;Dbxref=dbSNP_129:rs53627670;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049826.1	dbSNP	SNV	578	578	.	+	.	ID=3323;Variant_seq=A;Dbxref=dbSNP_129:rs52975131;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049826.1	dbSNP	SNV	602	602	.	+	.	ID=3324;Variant_seq=A,C;Dbxref=dbSNP_129:rs53788883;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049826.1	dbSNP	SNV	1815	1815	.	+	.	ID=3325;Variant_seq=C;Dbxref=dbSNP_129:rs19049760;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399968.1	dbSNP	SNV	107	107	.	+	.	ID=3326;Variant_seq=C;Dbxref=dbSNP_129:rs20123011;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399968.1	dbSNP	SNV	139	139	.	+	.	ID=3327;Variant_seq=T;Dbxref=dbSNP_129:rs20122991;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399968.1	dbSNP	SNV	536	536	.	+	.	ID=3328;Variant_seq=G;Dbxref=dbSNP_129:rs54156920;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399968.1	dbSNP	SNV	587	587	.	+	.	ID=3329;Variant_seq=G;Dbxref=dbSNP_129:rs53892279;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041104.1	dbSNP	SNV	1187	1187	.	+	.	ID=3330;Variant_seq=T;Dbxref=dbSNP_129:rs53852129;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041104.1	dbSNP	SNV	1192	1192	.	+	.	ID=3331;Variant_seq=A;Dbxref=dbSNP_129:rs54182387;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041104.1	dbSNP	SNV	1194	1194	.	+	.	ID=3332;Variant_seq=T;Dbxref=dbSNP_129:rs53242038;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041104.1	dbSNP	SNV	1200	1200	.	+	.	ID=3333;Variant_seq=A;Dbxref=dbSNP_129:rs53485380;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041104.1	dbSNP	SNV	1204	1204	.	+	.	ID=3334;Variant_seq=A;Dbxref=dbSNP_129:rs53023283;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041104.1	dbSNP	SNV	1215	1215	.	+	.	ID=3335;Variant_seq=C;Dbxref=dbSNP_129:rs53683910;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041104.1	dbSNP	insertion	1229	1229	.	+	.	ID=3336;Variant_seq=C;Dbxref=dbSNP_129:rs54194456;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02041104.1	dbSNP	SNV	1231	1231	.	+	.	ID=3337;Variant_seq=T;Dbxref=dbSNP_129:rs53058575;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041104.1	dbSNP	insertion	1232	1232	.	+	.	ID=3338;Variant_seq=TC;Dbxref=dbSNP_129:rs53888469;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02041104.1	dbSNP	SNV	1379	1379	.	+	.	ID=3339;Variant_seq=C;Dbxref=dbSNP_129:rs19776137;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041104.1	dbSNP	SNV	2369	2369	.	+	.	ID=3340;Variant_seq=C;Dbxref=dbSNP_129:rs19036434;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041104.1	dbSNP	SNV	3107	3107	.	+	.	ID=3341;Variant_seq=A;Dbxref=dbSNP_129:rs18804048;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039680.1	dbSNP	SNV	343	343	.	+	.	ID=3342;Variant_seq=G;Dbxref=dbSNP_129:rs54030305;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039680.1	dbSNP	SNV	352	352	.	+	.	ID=3343;Variant_seq=A;Dbxref=dbSNP_129:rs54100571;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039680.1	dbSNP	SNV	368	368	.	+	.	ID=3344;Variant_seq=C;Dbxref=dbSNP_129:rs54235603;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039680.1	dbSNP	SNV	423	423	.	+	.	ID=3345;Variant_seq=T;Dbxref=dbSNP_129:rs54040361;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039680.1	dbSNP	SNV	431	431	.	+	.	ID=3346;Variant_seq=C;Dbxref=dbSNP_129:rs53296394;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039680.1	dbSNP	SNV	444	444	.	+	.	ID=3347;Variant_seq=C;Dbxref=dbSNP_129:rs53772549;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039680.1	dbSNP	SNV	453	453	.	+	.	ID=3348;Variant_seq=G;Dbxref=dbSNP_129:rs53840934;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039680.1	dbSNP	SNV	455	455	.	+	.	ID=3349;Variant_seq=G;Dbxref=dbSNP_129:rs52883197;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039680.1	dbSNP	SNV	460	460	.	+	.	ID=3350;Variant_seq=G;Dbxref=dbSNP_129:rs52890799;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039680.1	dbSNP	SNV	464	464	.	+	.	ID=3351;Variant_seq=T;Dbxref=dbSNP_129:rs53683082;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039680.1	dbSNP	SNV	468	468	.	+	.	ID=3352;Variant_seq=G;Dbxref=dbSNP_129:rs53844194;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039680.1	dbSNP	SNV	474	474	.	+	.	ID=3353;Variant_seq=T;Dbxref=dbSNP_129:rs53806038;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039680.1	dbSNP	SNV	487	487	.	+	.	ID=3354;Variant_seq=G;Dbxref=dbSNP_129:rs53750548;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039680.1	dbSNP	SNV	491	491	.	+	.	ID=3355;Variant_seq=C;Dbxref=dbSNP_129:rs53070073;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039680.1	dbSNP	SNV	1728	1728	.	+	.	ID=3356;Variant_seq=T;Dbxref=dbSNP_129:rs52985479;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039680.1	dbSNP	SNV	1731	1731	.	+	.	ID=3357;Variant_seq=T;Dbxref=dbSNP_129:rs53821138;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039680.1	dbSNP	SNV	1733	1733	.	+	.	ID=3358;Variant_seq=T;Dbxref=dbSNP_129:rs54184178;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039680.1	dbSNP	SNV	1734	1734	.	+	.	ID=3359;Variant_seq=T;Dbxref=dbSNP_129:rs53013586;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039680.1	dbSNP	SNV	1735	1735	.	+	.	ID=3360;Variant_seq=A;Dbxref=dbSNP_129:rs53301430;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039680.1	dbSNP	SNV	1772	1772	.	+	.	ID=3361;Variant_seq=A;Dbxref=dbSNP_129:rs53811719;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039680.1	dbSNP	SNV	1870	1870	.	+	.	ID=3362;Variant_seq=G;Dbxref=dbSNP_129:rs52967098;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039680.1	dbSNP	SNV	2056	2056	.	+	.	ID=3363;Variant_seq=C;Dbxref=dbSNP_129:rs53667987;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039680.1	dbSNP	SNV	2059	2059	.	+	.	ID=3364;Variant_seq=T;Dbxref=dbSNP_129:rs53106554;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039680.1	dbSNP	SNV	2107	2107	.	+	.	ID=3365;Variant_seq=T;Dbxref=dbSNP_129:rs54252244;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039680.1	dbSNP	SNV	2109	2109	.	+	.	ID=3366;Variant_seq=C;Dbxref=dbSNP_129:rs54045568;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039680.1	dbSNP	SNV	2112	2112	.	+	.	ID=3367;Variant_seq=A;Dbxref=dbSNP_129:rs54296215;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039680.1	dbSNP	deletion	4301	4301	.	+	.	ID=3368;Variant_seq=-;Dbxref=dbSNP_129:rs53384740;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039680.1	dbSNP	SNV	4302	4302	.	+	.	ID=3369;Variant_seq=G;Dbxref=dbSNP_129:rs52976434;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039680.1	dbSNP	SNV	4303	4303	.	+	.	ID=3370;Variant_seq=C;Dbxref=dbSNP_129:rs54331902;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039680.1	dbSNP	SNV	4307	4307	.	+	.	ID=3371;Variant_seq=C;Dbxref=dbSNP_129:rs53353437;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039680.1	dbSNP	SNV	4310	4310	.	+	.	ID=3372;Variant_seq=A;Dbxref=dbSNP_129:rs54017085;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039680.1	dbSNP	SNV	4721	4721	.	+	.	ID=3373;Variant_seq=A;Dbxref=dbSNP_129:rs18885148;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398539.1	dbSNP	SNV	1070	1070	.	+	.	ID=3374;Variant_seq=G;Dbxref=dbSNP_129:rs53392609;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398539.1	dbSNP	SNV	1421	1421	.	+	.	ID=3375;Variant_seq=A;Dbxref=dbSNP_129:rs20660141;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398539.1	dbSNP	SNV	4575	4575	.	+	.	ID=3376;Variant_seq=G;Dbxref=dbSNP_129:rs53926549;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398539.1	dbSNP	SNV	4585	4585	.	+	.	ID=3377;Variant_seq=C;Dbxref=dbSNP_129:rs54154215;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398539.1	dbSNP	SNV	4596	4596	.	+	.	ID=3378;Variant_seq=G;Dbxref=dbSNP_129:rs53318487;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398539.1	dbSNP	SNV	4599	4599	.	+	.	ID=3379;Variant_seq=T;Dbxref=dbSNP_129:rs53257701;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398539.1	dbSNP	deletion	4600	4600	.	+	.	ID=3380;Variant_seq=-;Dbxref=dbSNP_129:rs53922230;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398539.1	dbSNP	deletion	4606	4606	.	+	.	ID=3381;Variant_seq=-;Dbxref=dbSNP_129:rs53504684;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398539.1	dbSNP	SNV	5351	5351	.	+	.	ID=3382;Variant_seq=A;Dbxref=dbSNP_129:rs53087460;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398539.1	dbSNP	SNV	6215	6215	.	+	.	ID=3383;Variant_seq=T;Dbxref=dbSNP_129:rs19871790;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398539.1	dbSNP	SNV	6220	6220	.	+	.	ID=3384;Variant_seq=C;Dbxref=dbSNP_129:rs19871800;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398539.1	dbSNP	SNV	6245	6245	.	+	.	ID=3385;Variant_seq=T;Dbxref=dbSNP_129:rs19871820;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398539.1	dbSNP	SNV	6248	6248	.	+	.	ID=3386;Variant_seq=C;Dbxref=dbSNP_129:rs19871830;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398539.1	dbSNP	SNV	6948	6948	.	+	.	ID=3387;Variant_seq=G;Dbxref=dbSNP_129:rs20460321;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398539.1	dbSNP	SNV	8986	8986	.	+	.	ID=3388;Variant_seq=A;Dbxref=dbSNP_129:rs53365045;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398539.1	dbSNP	SNV	9091	9091	.	+	.	ID=3389;Variant_seq=T;Dbxref=dbSNP_129:rs53108802;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398539.1	dbSNP	SNV	9098	9098	.	+	.	ID=3390;Variant_seq=T;Dbxref=dbSNP_129:rs53357713;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398539.1	dbSNP	SNV	9409	9409	.	+	.	ID=3391;Variant_seq=A;Dbxref=dbSNP_129:rs53121685;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398539.1	dbSNP	SNV	9434	9434	.	+	.	ID=3392;Variant_seq=A;Dbxref=dbSNP_129:rs54287821;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398539.1	dbSNP	SNV	9501	9501	.	+	.	ID=3393;Variant_seq=A;Dbxref=dbSNP_129:rs54401053;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398539.1	dbSNP	SNV	9504	9504	.	+	.	ID=3394;Variant_seq=G;Dbxref=dbSNP_129:rs53147704;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398539.1	dbSNP	SNV	9506	9506	.	+	.	ID=3395;Variant_seq=A;Dbxref=dbSNP_129:rs53832096;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398539.1	dbSNP	SNV	9523	9523	.	+	.	ID=3396;Variant_seq=G;Dbxref=dbSNP_129:rs53029041;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398539.1	dbSNP	SNV	9804	9804	.	+	.	ID=3397;Variant_seq=C;Dbxref=dbSNP_129:rs53818543;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398539.1	dbSNP	SNV	9805	9805	.	+	.	ID=3398;Variant_seq=A;Dbxref=dbSNP_129:rs53898134;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398539.1	dbSNP	deletion	9806	9806	.	+	.	ID=3399;Variant_seq=-;Dbxref=dbSNP_129:rs53479625;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398539.1	dbSNP	SNV	9810	9810	.	+	.	ID=3400;Variant_seq=T;Dbxref=dbSNP_129:rs53351843;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398539.1	dbSNP	SNV	9817	9817	.	+	.	ID=3401;Variant_seq=G;Dbxref=dbSNP_129:rs53125427;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398539.1	dbSNP	SNV	9820	9820	.	+	.	ID=3402;Variant_seq=T;Dbxref=dbSNP_129:rs53027050;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398539.1	dbSNP	SNV	9838	9838	.	+	.	ID=3403;Variant_seq=T;Dbxref=dbSNP_129:rs54306309;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398539.1	dbSNP	SNV	9868	9868	.	+	.	ID=3404;Variant_seq=C;Dbxref=dbSNP_129:rs53445584;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398539.1	dbSNP	SNV	9878	9878	.	+	.	ID=3405;Variant_seq=G;Dbxref=dbSNP_129:rs54320802;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398539.1	dbSNP	SNV	9885	9885	.	+	.	ID=3406;Variant_seq=T;Dbxref=dbSNP_129:rs54103969;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398539.1	dbSNP	SNV	9895	9895	.	+	.	ID=3407;Variant_seq=A;Dbxref=dbSNP_129:rs53569650;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398539.1	dbSNP	SNV	9905	9905	.	+	.	ID=3408;Variant_seq=A;Dbxref=dbSNP_129:rs53403219;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398539.1	dbSNP	SNV	10286	10286	.	+	.	ID=3409;Variant_seq=T;Dbxref=dbSNP_129:rs53173065;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398539.1	dbSNP	SNV	10302	10302	.	+	.	ID=3410;Variant_seq=C;Dbxref=dbSNP_129:rs54094205;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398539.1	dbSNP	SNV	10330	10330	.	+	.	ID=3411;Variant_seq=C;Dbxref=dbSNP_129:rs53111689;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398539.1	dbSNP	SNV	10361	10361	.	+	.	ID=3412;Variant_seq=A;Dbxref=dbSNP_129:rs53767965;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398539.1	dbSNP	SNV	10747	10747	.	+	.	ID=3413;Variant_seq=T;Dbxref=dbSNP_129:rs53742274;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398539.1	dbSNP	SNV	11735	11735	.	+	.	ID=3414;Variant_seq=C;Dbxref=dbSNP_129:rs19871488;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398539.1	dbSNP	deletion	12998	12998	.	+	.	ID=3415;Variant_seq=-;Dbxref=dbSNP_129:rs53574095;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398539.1	dbSNP	deletion	13099	13099	.	+	.	ID=3416;Variant_seq=-;Dbxref=dbSNP_129:rs53331236;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398539.1	dbSNP	SNV	13106	13106	.	+	.	ID=3417;Variant_seq=A;Dbxref=dbSNP_129:rs53564072;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398539.1	dbSNP	SNV	13107	13107	.	+	.	ID=3418;Variant_seq=C,G;Dbxref=dbSNP_129:rs52982408;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398539.1	dbSNP	insertion	13150	13150	.	+	.	ID=3419;Variant_seq=TT;Dbxref=dbSNP_129:rs54271993;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398539.1	dbSNP	SNV	13163	13163	.	+	.	ID=3420;Variant_seq=G;Dbxref=dbSNP_129:rs53127614;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398539.1	dbSNP	SNV	13373	13373	.	+	.	ID=3421;Variant_seq=T;Dbxref=dbSNP_129:rs53054914;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398500.1	dbSNP	SNV	4705	4705	.	+	.	ID=3422;Variant_seq=T;Dbxref=dbSNP_129:rs18849050;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047801.1	dbSNP	SNV	2245	2245	.	+	.	ID=3423;Variant_seq=G;Dbxref=dbSNP_129:rs54240337;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02049426.1	dbSNP	SNV	1609	1609	.	+	.	ID=3424;Variant_seq=G;Dbxref=dbSNP_129:rs19795356;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038807.1	dbSNP	SNV	2987	2987	.	+	.	ID=3425;Variant_seq=T;Dbxref=dbSNP_129:rs20374155;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038807.1	dbSNP	SNV	6021	6021	.	+	.	ID=3426;Variant_seq=C;Dbxref=dbSNP_129:rs53138713;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040827.1	dbSNP	SNV	330	330	.	+	.	ID=3427;Variant_seq=T;Dbxref=dbSNP_129:rs54048746;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040827.1	dbSNP	insertion	465	465	.	+	.	ID=3428;Variant_seq=TATCATTAAGC;Dbxref=dbSNP_129:rs54296850;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02040827.1	dbSNP	SNV	1515	1515	.	+	.	ID=3429;Variant_seq=T;Dbxref=dbSNP_129:rs18546451;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040827.1	dbSNP	SNV	2124	2124	.	+	.	ID=3430;Variant_seq=T;Dbxref=dbSNP_129:rs21361236;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040827.1	dbSNP	SNV	3336	3336	.	+	.	ID=3431;Variant_seq=A;Dbxref=dbSNP_129:rs19293700;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399374.1	dbSNP	SNV	2716	2716	.	+	.	ID=3432;Variant_seq=A;Dbxref=dbSNP_129:rs18218848;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399374.1	dbSNP	SNV	4320	4320	.	+	.	ID=3433;Variant_seq=A;Dbxref=dbSNP_129:rs19728444;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399374.1	dbSNP	SNV	4394	4394	.	+	.	ID=3434;Variant_seq=T;Dbxref=dbSNP_129:rs19728464;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399767.1	dbSNP	SNV	1701	1701	.	+	.	ID=3435;Variant_seq=T;Dbxref=dbSNP_129:rs21198246;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02040923.1	dbSNP	SNV	1092	1092	.	+	.	ID=3436;Variant_seq=T;Dbxref=dbSNP_129:rs20404027;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040923.1	dbSNP	SNV	2212	2212	.	+	.	ID=3437;Variant_seq=T;Dbxref=dbSNP_129:rs53933731;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040923.1	dbSNP	SNV	2253	2253	.	+	.	ID=3438;Variant_seq=A;Dbxref=dbSNP_129:rs54049517;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036261.1	dbSNP	SNV	3300	3300	.	+	.	ID=3439;Variant_seq=T;Dbxref=dbSNP_129:rs21366580;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036261.1	dbSNP	SNV	3302	3302	.	+	.	ID=3440;Variant_seq=C;Dbxref=dbSNP_129:rs21366570;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036261.1	dbSNP	SNV	3303	3303	.	+	.	ID=3441;Variant_seq=A;Dbxref=dbSNP_129:rs21366560;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036261.1	dbSNP	SNV	3304	3304	.	+	.	ID=3442;Variant_seq=G;Dbxref=dbSNP_129:rs21366550;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036261.1	dbSNP	SNV	3305	3305	.	+	.	ID=3443;Variant_seq=G;Dbxref=dbSNP_129:rs21366540;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036261.1	dbSNP	SNV	3698	3698	.	+	.	ID=3444;Variant_seq=G;Dbxref=dbSNP_129:rs21364897;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036261.1	dbSNP	SNV	4271	4271	.	+	.	ID=3445;Variant_seq=G;Dbxref=dbSNP_129:rs21362758;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036261.1	dbSNP	SNV	4278	4278	.	+	.	ID=3446;Variant_seq=A;Dbxref=dbSNP_129:rs21362748;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036261.1	dbSNP	SNV	4280	4280	.	+	.	ID=3447;Variant_seq=G;Dbxref=dbSNP_129:rs21362728;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036261.1	dbSNP	SNV	4281	4281	.	+	.	ID=3448;Variant_seq=C;Dbxref=dbSNP_129:rs21362718;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036261.1	dbSNP	SNV	4283	4283	.	+	.	ID=3449;Variant_seq=T;Dbxref=dbSNP_129:rs21362708;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036261.1	dbSNP	SNV	4505	4505	.	+	.	ID=3450;Variant_seq=C;Dbxref=dbSNP_129:rs21362158;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036261.1	dbSNP	SNV	4979	4979	.	+	.	ID=3451;Variant_seq=C;Dbxref=dbSNP_129:rs21360647;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036261.1	dbSNP	SNV	4980	4980	.	+	.	ID=3452;Variant_seq=G;Dbxref=dbSNP_129:rs21360637;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036261.1	dbSNP	SNV	4985	4985	.	+	.	ID=3453;Variant_seq=A;Dbxref=dbSNP_129:rs21360627;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036261.1	dbSNP	SNV	4992	4992	.	+	.	ID=3454;Variant_seq=A;Dbxref=dbSNP_129:rs21360607;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036261.1	dbSNP	SNV	9536	9536	.	+	.	ID=3455;Variant_seq=A;Dbxref=dbSNP_129:rs21595343;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036261.1	dbSNP	SNV	10623	10623	.	+	.	ID=3456;Variant_seq=T;Dbxref=dbSNP_129:rs53788637;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036261.1	dbSNP	SNV	14589	14589	.	+	.	ID=3457;Variant_seq=T;Dbxref=dbSNP_129:rs18403408;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036261.1	dbSNP	SNV	14590	14590	.	+	.	ID=3458;Variant_seq=T;Dbxref=dbSNP_129:rs18403417;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046262.1	dbSNP	SNV	2256	2256	.	+	.	ID=3459;Variant_seq=C;Dbxref=dbSNP_129:rs52935983;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046262.1	dbSNP	SNV	2275	2275	.	+	.	ID=3460;Variant_seq=T;Dbxref=dbSNP_129:rs53254942;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398358.1	dbSNP	SNV	2292	2292	.	+	.	ID=3461;Variant_seq=T;Dbxref=dbSNP_129:rs21430121;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398358.1	dbSNP	SNV	21887	21887	.	+	.	ID=3462;Variant_seq=G;Dbxref=dbSNP_129:rs53030300;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400297.1	dbSNP	SNV	711	711	.	+	.	ID=3463;Variant_seq=G;Dbxref=dbSNP_129:rs53469940;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400297.1	dbSNP	SNV	2409	2409	.	+	.	ID=3464;Variant_seq=A;Dbxref=dbSNP_129:rs53934906;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400297.1	dbSNP	SNV	2416	2416	.	+	.	ID=3465;Variant_seq=T;Dbxref=dbSNP_129:rs53074628;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400297.1	dbSNP	SNV	3105	3105	.	+	.	ID=3466;Variant_seq=C;Dbxref=dbSNP_129:rs20210895;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400297.1	dbSNP	SNV	3157	3157	.	+	.	ID=3467;Variant_seq=A;Dbxref=dbSNP_129:rs20210865;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039805.1	dbSNP	SNV	84	84	.	+	.	ID=3468;Variant_seq=A;Dbxref=dbSNP_129:rs21418595;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039805.1	dbSNP	SNV	85	85	.	+	.	ID=3469;Variant_seq=C;Dbxref=dbSNP_129:rs21418605;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039805.1	dbSNP	SNV	156	156	.	+	.	ID=3470;Variant_seq=T;Dbxref=dbSNP_129:rs21418625;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039805.1	dbSNP	SNV	232	232	.	+	.	ID=3471;Variant_seq=G;Dbxref=dbSNP_129:rs21418635;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039805.1	dbSNP	SNV	233	233	.	+	.	ID=3472;Variant_seq=C;Dbxref=dbSNP_129:rs21418645;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039805.1	dbSNP	SNV	245	245	.	+	.	ID=3473;Variant_seq=G;Dbxref=dbSNP_129:rs21418665;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039805.1	dbSNP	SNV	257	257	.	+	.	ID=3474;Variant_seq=G;Dbxref=dbSNP_129:rs21418685;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039805.1	dbSNP	SNV	266	266	.	+	.	ID=3475;Variant_seq=G;Dbxref=dbSNP_129:rs21418695;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039805.1	dbSNP	SNV	267	267	.	+	.	ID=3476;Variant_seq=G;Dbxref=dbSNP_129:rs21418705;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039805.1	dbSNP	SNV	268	268	.	+	.	ID=3477;Variant_seq=T;Dbxref=dbSNP_129:rs21418715;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039805.1	dbSNP	SNV	269	269	.	+	.	ID=3478;Variant_seq=T;Dbxref=dbSNP_129:rs21418725;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039805.1	dbSNP	SNV	270	270	.	+	.	ID=3479;Variant_seq=T;Dbxref=dbSNP_129:rs21418735;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039805.1	dbSNP	SNV	274	274	.	+	.	ID=3480;Variant_seq=C;Dbxref=dbSNP_129:rs21418765;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039805.1	dbSNP	SNV	276	276	.	+	.	ID=3481;Variant_seq=G;Dbxref=dbSNP_129:rs21418775;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039805.1	dbSNP	SNV	280	280	.	+	.	ID=3482;Variant_seq=A;Dbxref=dbSNP_129:rs21418785;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039805.1	dbSNP	SNV	289	289	.	+	.	ID=3483;Variant_seq=C;Dbxref=dbSNP_129:rs21418805;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039805.1	dbSNP	SNV	293	293	.	+	.	ID=3484;Variant_seq=T;Dbxref=dbSNP_129:rs21418815;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039805.1	dbSNP	SNV	303	303	.	+	.	ID=3485;Variant_seq=T;Dbxref=dbSNP_129:rs21418835;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039805.1	dbSNP	SNV	310	310	.	+	.	ID=3486;Variant_seq=C;Dbxref=dbSNP_129:rs21418865;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039805.1	dbSNP	SNV	312	312	.	+	.	ID=3487;Variant_seq=A;Dbxref=dbSNP_129:rs21418875;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039805.1	dbSNP	SNV	339	339	.	+	.	ID=3488;Variant_seq=C;Dbxref=dbSNP_129:rs21418885;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039805.1	dbSNP	SNV	347	347	.	+	.	ID=3489;Variant_seq=G;Dbxref=dbSNP_129:rs21418895;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039805.1	dbSNP	SNV	351	351	.	+	.	ID=3490;Variant_seq=A;Dbxref=dbSNP_129:rs21418905;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039805.1	dbSNP	SNV	352	352	.	+	.	ID=3491;Variant_seq=G;Dbxref=dbSNP_129:rs21418915;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039805.1	dbSNP	SNV	353	353	.	+	.	ID=3492;Variant_seq=A;Dbxref=dbSNP_129:rs21418925;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039805.1	dbSNP	SNV	361	361	.	+	.	ID=3493;Variant_seq=T;Dbxref=dbSNP_129:rs21418945;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039805.1	dbSNP	SNV	370	370	.	+	.	ID=3494;Variant_seq=A;Dbxref=dbSNP_129:rs21418965;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039805.1	dbSNP	SNV	372	372	.	+	.	ID=3495;Variant_seq=T;Dbxref=dbSNP_129:rs21418975;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039805.1	dbSNP	SNV	373	373	.	+	.	ID=3496;Variant_seq=T;Dbxref=dbSNP_129:rs21418985;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039805.1	dbSNP	SNV	380	380	.	+	.	ID=3497;Variant_seq=G;Dbxref=dbSNP_129:rs21418995;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039805.1	dbSNP	SNV	381	381	.	+	.	ID=3498;Variant_seq=A;Dbxref=dbSNP_129:rs21419005;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039805.1	dbSNP	SNV	390	390	.	+	.	ID=3499;Variant_seq=T;Dbxref=dbSNP_129:rs21419045;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039805.1	dbSNP	SNV	395	395	.	+	.	ID=3500;Variant_seq=C;Dbxref=dbSNP_129:rs21419065;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039805.1	dbSNP	SNV	396	396	.	+	.	ID=3501;Variant_seq=G;Dbxref=dbSNP_129:rs21419075;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039805.1	dbSNP	SNV	400	400	.	+	.	ID=3502;Variant_seq=T;Dbxref=dbSNP_129:rs54201002;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039805.1	dbSNP	SNV	420	420	.	+	.	ID=3503;Variant_seq=G;Dbxref=dbSNP_129:rs21419085;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039805.1	dbSNP	SNV	422	422	.	+	.	ID=3504;Variant_seq=C;Dbxref=dbSNP_129:rs21419095;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039805.1	dbSNP	SNV	441	441	.	+	.	ID=3505;Variant_seq=A;Dbxref=dbSNP_129:rs21419105;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039805.1	dbSNP	SNV	446	446	.	+	.	ID=3506;Variant_seq=G;Dbxref=dbSNP_129:rs21419115;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039805.1	dbSNP	SNV	457	457	.	+	.	ID=3507;Variant_seq=G;Dbxref=dbSNP_129:rs21419125;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039805.1	dbSNP	SNV	468	468	.	+	.	ID=3508;Variant_seq=T;Dbxref=dbSNP_129:rs21419135;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039805.1	dbSNP	SNV	475	475	.	+	.	ID=3509;Variant_seq=G;Dbxref=dbSNP_129:rs21419145;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039805.1	dbSNP	SNV	477	477	.	+	.	ID=3510;Variant_seq=A;Dbxref=dbSNP_129:rs21419155;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039805.1	dbSNP	SNV	480	480	.	+	.	ID=3511;Variant_seq=G;Dbxref=dbSNP_129:rs21419165;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039805.1	dbSNP	SNV	488	488	.	+	.	ID=3512;Variant_seq=C;Dbxref=dbSNP_129:rs21419175;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039805.1	dbSNP	SNV	515	515	.	+	.	ID=3513;Variant_seq=T;Dbxref=dbSNP_129:rs21419195;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039805.1	dbSNP	SNV	5763	5763	.	+	.	ID=3514;Variant_seq=A;Dbxref=dbSNP_129:rs20769296;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043099.1	dbSNP	SNV	2250	2250	.	+	.	ID=3515;Variant_seq=T;Dbxref=dbSNP_129:rs21346146;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042091.1	dbSNP	SNV	1125	1125	.	+	.	ID=3516;Variant_seq=A;Dbxref=dbSNP_129:rs20764745;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042091.1	dbSNP	SNV	1220	1220	.	+	.	ID=3517;Variant_seq=C;Dbxref=dbSNP_129:rs21043481;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042091.1	dbSNP	SNV	3138	3138	.	+	.	ID=3518;Variant_seq=G;Dbxref=dbSNP_129:rs54076376;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047591.1	dbSNP	SNV	167	167	.	+	.	ID=3519;Variant_seq=A;Dbxref=dbSNP_129:rs17909095;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047591.1	dbSNP	SNV	661	661	.	+	.	ID=3520;Variant_seq=C;Dbxref=dbSNP_129:rs21479069;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047591.1	dbSNP	SNV	749	749	.	+	.	ID=3521;Variant_seq=A;Dbxref=dbSNP_129:rs21479099;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047591.1	dbSNP	SNV	770	770	.	+	.	ID=3522;Variant_seq=C;Dbxref=dbSNP_129:rs21479109;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047591.1	dbSNP	SNV	874	874	.	+	.	ID=3523;Variant_seq=C;Dbxref=dbSNP_129:rs21479150;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047591.1	dbSNP	SNV	875	875	.	+	.	ID=3524;Variant_seq=A;Dbxref=dbSNP_129:rs21479160;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047591.1	dbSNP	SNV	896	896	.	+	.	ID=3525;Variant_seq=A;Dbxref=dbSNP_129:rs21479180;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047591.1	dbSNP	SNV	897	897	.	+	.	ID=3526;Variant_seq=A;Dbxref=dbSNP_129:rs21479190;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047591.1	dbSNP	SNV	909	909	.	+	.	ID=3527;Variant_seq=A;Dbxref=dbSNP_129:rs21479200;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047591.1	dbSNP	SNV	913	913	.	+	.	ID=3528;Variant_seq=G;Dbxref=dbSNP_129:rs21479210;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047591.1	dbSNP	SNV	926	926	.	+	.	ID=3529;Variant_seq=T;Dbxref=dbSNP_129:rs21479220;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047591.1	dbSNP	SNV	987	987	.	+	.	ID=3530;Variant_seq=T;Dbxref=dbSNP_129:rs21479230;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047591.1	dbSNP	SNV	995	995	.	+	.	ID=3531;Variant_seq=T;Dbxref=dbSNP_129:rs21479240;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047591.1	dbSNP	SNV	1017	1017	.	+	.	ID=3532;Variant_seq=T;Dbxref=dbSNP_129:rs21479260;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047591.1	dbSNP	SNV	1019	1019	.	+	.	ID=3533;Variant_seq=G;Dbxref=dbSNP_129:rs21479270;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047591.1	dbSNP	SNV	1022	1022	.	+	.	ID=3534;Variant_seq=A;Dbxref=dbSNP_129:rs21479280;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047591.1	dbSNP	SNV	1145	1145	.	+	.	ID=3535;Variant_seq=G;Dbxref=dbSNP_129:rs21479310;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047591.1	dbSNP	SNV	2291	2291	.	+	.	ID=3536;Variant_seq=G;Dbxref=dbSNP_129:rs19141468;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047591.1	dbSNP	SNV	2352	2352	.	+	.	ID=3537;Variant_seq=A;Dbxref=dbSNP_129:rs19141348;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044683.1	dbSNP	SNV	116	116	.	+	.	ID=3538;Variant_seq=A;Dbxref=dbSNP_129:rs18812921;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044683.1	dbSNP	SNV	708	708	.	+	.	ID=3539;Variant_seq=C;Dbxref=dbSNP_129:rs17920187;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044683.1	dbSNP	SNV	2899	2899	.	+	.	ID=3540;Variant_seq=A;Dbxref=dbSNP_129:rs52895831;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044683.1	dbSNP	SNV	2906	2906	.	+	.	ID=3541;Variant_seq=A;Dbxref=dbSNP_129:rs53104115;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044683.1	dbSNP	SNV	2928	2928	.	+	.	ID=3542;Variant_seq=A;Dbxref=dbSNP_129:rs53881699;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044683.1	dbSNP	SNV	3049	3049	.	+	.	ID=3543;Variant_seq=T;Dbxref=dbSNP_129:rs53953295;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047533.1	dbSNP	SNV	1196	1196	.	+	.	ID=3544;Variant_seq=G;Dbxref=dbSNP_129:rs52945245;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047533.1	dbSNP	SNV	1216	1216	.	+	.	ID=3545;Variant_seq=A;Dbxref=dbSNP_129:rs53322774;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047533.1	dbSNP	SNV	1219	1219	.	+	.	ID=3546;Variant_seq=T;Dbxref=dbSNP_129:rs53529448;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047533.1	dbSNP	SNV	1220	1220	.	+	.	ID=3547;Variant_seq=A;Dbxref=dbSNP_129:rs53191632;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047533.1	dbSNP	SNV	1221	1221	.	+	.	ID=3548;Variant_seq=C;Dbxref=dbSNP_129:rs53463518;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047533.1	dbSNP	SNV	1222	1222	.	+	.	ID=3549;Variant_seq=A;Dbxref=dbSNP_129:rs53577006;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047533.1	dbSNP	SNV	1222	1222	.	+	.	ID=3550;Variant_seq=G;Dbxref=dbSNP_129:rs53642963;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047533.1	dbSNP	SNV	1226	1226	.	+	.	ID=3551;Variant_seq=T;Dbxref=dbSNP_129:rs53218379;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047533.1	dbSNP	SNV	1227	1227	.	+	.	ID=3552;Variant_seq=C;Dbxref=dbSNP_129:rs53630473;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047533.1	dbSNP	SNV	1227	1227	.	+	.	ID=3553;Variant_seq=C;Dbxref=dbSNP_129:rs53809911;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047533.1	dbSNP	SNV	1228	1228	.	+	.	ID=3554;Variant_seq=G;Dbxref=dbSNP_129:rs54241257;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047533.1	dbSNP	SNV	1233	1233	.	+	.	ID=3555;Variant_seq=A;Dbxref=dbSNP_129:rs54191582;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047533.1	dbSNP	SNV	1233	1233	.	+	.	ID=3556;Variant_seq=A;Dbxref=dbSNP_129:rs53771364;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047533.1	dbSNP	SNV	1234	1234	.	+	.	ID=3557;Variant_seq=A;Dbxref=dbSNP_129:rs53178494;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047533.1	dbSNP	SNV	2145	2145	.	+	.	ID=3558;Variant_seq=C;Dbxref=dbSNP_129:rs54120154;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH401043.1	dbSNP	SNV	2089	2089	.	+	.	ID=3559;Variant_seq=A;Dbxref=dbSNP_129:rs19565988;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039211.1	dbSNP	SNV	5956	5956	.	+	.	ID=3560;Variant_seq=G;Dbxref=dbSNP_129:rs53888410;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048743.1	dbSNP	SNV	184	184	.	+	.	ID=3561;Variant_seq=C;Dbxref=dbSNP_129:rs54088609;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048743.1	dbSNP	SNV	189	189	.	+	.	ID=3562;Variant_seq=A;Dbxref=dbSNP_129:rs52969763;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048743.1	dbSNP	SNV	191	191	.	+	.	ID=3563;Variant_seq=T;Dbxref=dbSNP_129:rs53761818;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048743.1	dbSNP	SNV	194	194	.	+	.	ID=3564;Variant_seq=T;Dbxref=dbSNP_129:rs52954261;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048743.1	dbSNP	SNV	332	332	.	+	.	ID=3565;Variant_seq=T;Dbxref=dbSNP_129:rs53385211;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048743.1	dbSNP	SNV	718	718	.	+	.	ID=3566;Variant_seq=C;Dbxref=dbSNP_129:rs20287914;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400053.1	dbSNP	SNV	308	308	.	+	.	ID=3567;Variant_seq=A;Dbxref=dbSNP_129:rs19814777;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400053.1	dbSNP	SNV	349	349	.	+	.	ID=3568;Variant_seq=T;Dbxref=dbSNP_129:rs19814627;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400053.1	dbSNP	SNV	357	357	.	+	.	ID=3569;Variant_seq=A;Dbxref=dbSNP_129:rs19814597;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400053.1	dbSNP	SNV	364	364	.	+	.	ID=3570;Variant_seq=A;Dbxref=dbSNP_129:rs20689735;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400053.1	dbSNP	SNV	3088	3088	.	+	.	ID=3571;Variant_seq=C;Dbxref=dbSNP_129:rs53322370;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400053.1	dbSNP	SNV	3089	3089	.	+	.	ID=3572;Variant_seq=T;Dbxref=dbSNP_129:rs54116037;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400053.1	dbSNP	SNV	3093	3093	.	+	.	ID=3573;Variant_seq=T;Dbxref=dbSNP_129:rs53859191;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400053.1	dbSNP	SNV	3659	3659	.	+	.	ID=3574;Variant_seq=C;Dbxref=dbSNP_129:rs54330684;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038178.1	dbSNP	SNV	3782	3782	.	+	.	ID=3575;Variant_seq=A;Dbxref=dbSNP_129:rs18110452;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038178.1	dbSNP	SNV	5430	5430	.	+	.	ID=3576;Variant_seq=G;Dbxref=dbSNP_129:rs54381690;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038178.1	dbSNP	insertion	5449	5449	.	+	.	ID=3577;Variant_seq=C;Dbxref=dbSNP_129:rs52920890;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02038178.1	dbSNP	insertion	5494	5494	.	+	.	ID=3578;Variant_seq=A;Dbxref=dbSNP_129:rs53010540;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02038178.1	dbSNP	SNV	8182	8182	.	+	.	ID=3579;Variant_seq=G;Dbxref=dbSNP_129:rs20628861;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044061.1	dbSNP	SNV	806	806	.	+	.	ID=3580;Variant_seq=C;Dbxref=dbSNP_129:rs21756557;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044061.1	dbSNP	SNV	815	815	.	+	.	ID=3581;Variant_seq=A;Dbxref=dbSNP_129:rs21756575;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044061.1	dbSNP	SNV	816	816	.	+	.	ID=3582;Variant_seq=T;Dbxref=dbSNP_129:rs21756584;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044061.1	dbSNP	SNV	817	817	.	+	.	ID=3583;Variant_seq=T;Dbxref=dbSNP_129:rs21756593;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044061.1	dbSNP	SNV	820	820	.	+	.	ID=3584;Variant_seq=A;Dbxref=dbSNP_129:rs21756602;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044061.1	dbSNP	SNV	912	912	.	+	.	ID=3585;Variant_seq=C;Dbxref=dbSNP_129:rs53072531;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044061.1	dbSNP	SNV	963	963	.	+	.	ID=3586;Variant_seq=G;Dbxref=dbSNP_129:rs21756647;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044061.1	dbSNP	deletion	966	966	.	+	.	ID=3587;Variant_seq=-;Dbxref=dbSNP_129:rs53948529;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044061.1	dbSNP	SNV	968	968	.	+	.	ID=3588;Variant_seq=T;Dbxref=dbSNP_129:rs21756665;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044061.1	dbSNP	SNV	969	969	.	+	.	ID=3589;Variant_seq=C;Dbxref=dbSNP_129:rs21756674;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044061.1	dbSNP	SNV	970	970	.	+	.	ID=3590;Variant_seq=A;Dbxref=dbSNP_129:rs21756683;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044061.1	dbSNP	SNV	977	977	.	+	.	ID=3591;Variant_seq=T;Dbxref=dbSNP_129:rs21756701;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044061.1	dbSNP	SNV	985	985	.	+	.	ID=3592;Variant_seq=A;Dbxref=dbSNP_129:rs21756710;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044061.1	dbSNP	SNV	986	986	.	+	.	ID=3593;Variant_seq=G;Dbxref=dbSNP_129:rs21756719;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044061.1	dbSNP	SNV	2180	2180	.	+	.	ID=3594;Variant_seq=T;Dbxref=dbSNP_129:rs53071215;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044061.1	dbSNP	SNV	2181	2181	.	+	.	ID=3595;Variant_seq=C;Dbxref=dbSNP_129:rs54336592;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044061.1	dbSNP	SNV	2221	2221	.	+	.	ID=3596;Variant_seq=G;Dbxref=dbSNP_129:rs21427381;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044061.1	dbSNP	SNV	2223	2223	.	+	.	ID=3597;Variant_seq=A;Dbxref=dbSNP_129:rs53031168;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044061.1	dbSNP	SNV	2242	2242	.	+	.	ID=3598;Variant_seq=A,C;Dbxref=dbSNP_129:rs53150517;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044061.1	dbSNP	SNV	2338	2338	.	+	.	ID=3599;Variant_seq=T,G;Dbxref=dbSNP_129:rs53567314;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044061.1	dbSNP	SNV	2345	2345	.	+	.	ID=3600;Variant_seq=T,C;Dbxref=dbSNP_129:rs54052301;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02037115.1	dbSNP	SNV	2601	2601	.	+	.	ID=3601;Variant_seq=C;Dbxref=dbSNP_129:rs52992195;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037115.1	dbSNP	SNV	2614	2614	.	+	.	ID=3602;Variant_seq=A;Dbxref=dbSNP_129:rs54008932;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037115.1	dbSNP	SNV	10750	10750	.	+	.	ID=3603;Variant_seq=A;Dbxref=dbSNP_129:rs18699566;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037115.1	dbSNP	SNV	10825	10825	.	+	.	ID=3604;Variant_seq=C;Dbxref=dbSNP_129:rs19902969;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037115.1	dbSNP	SNV	11175	11175	.	+	.	ID=3605;Variant_seq=G;Dbxref=dbSNP_129:rs19709498;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02037115.1	dbSNP	SNV	11176	11176	.	+	.	ID=3606;Variant_seq=T;Dbxref=dbSNP_129:rs19709508;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398419.1	dbSNP	SNV	7821	7821	.	+	.	ID=3607;Variant_seq=C;Dbxref=dbSNP_129:rs52938857;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398419.1	dbSNP	SNV	8930	8930	.	+	.	ID=3608;Variant_seq=C;Dbxref=dbSNP_129:rs52938857;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398419.1	dbSNP	SNV	15325	15325	.	+	.	ID=3609;Variant_seq=A;Dbxref=dbSNP_129:rs21783841;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400212.1	dbSNP	SNV	290	290	.	+	.	ID=3610;Variant_seq=A;Dbxref=dbSNP_129:rs19123505;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400212.1	dbSNP	SNV	432	432	.	+	.	ID=3611;Variant_seq=A;Dbxref=dbSNP_129:rs18330481;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400212.1	dbSNP	SNV	2847	2847	.	+	.	ID=3612;Variant_seq=C;Dbxref=dbSNP_129:rs18929837;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400212.1	dbSNP	SNV	2848	2848	.	+	.	ID=3613;Variant_seq=A;Dbxref=dbSNP_129:rs18929827;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400212.1	dbSNP	SNV	2849	2849	.	+	.	ID=3614;Variant_seq=C;Dbxref=dbSNP_129:rs18929817;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400212.1	dbSNP	SNV	2852	2852	.	+	.	ID=3615;Variant_seq=A;Dbxref=dbSNP_129:rs18929787;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400212.1	dbSNP	SNV	2853	2853	.	+	.	ID=3616;Variant_seq=T;Dbxref=dbSNP_129:rs18929777;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400212.1	dbSNP	SNV	2854	2854	.	+	.	ID=3617;Variant_seq=C;Dbxref=dbSNP_129:rs18929767;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400212.1	dbSNP	SNV	2857	2857	.	+	.	ID=3618;Variant_seq=T;Dbxref=dbSNP_129:rs18929757;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400212.1	dbSNP	SNV	2866	2866	.	+	.	ID=3619;Variant_seq=T;Dbxref=dbSNP_129:rs18929747;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400212.1	dbSNP	SNV	2869	2869	.	+	.	ID=3620;Variant_seq=G;Dbxref=dbSNP_129:rs18929737;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048830.1	dbSNP	SNV	231	231	.	+	.	ID=3621;Variant_seq=C;Dbxref=dbSNP_129:rs53296644;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048830.1	dbSNP	SNV	2074	2074	.	+	.	ID=3622;Variant_seq=C;Dbxref=dbSNP_129:rs20168249;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400960.1	dbSNP	SNV	1784	1784	.	+	.	ID=3623;Variant_seq=A;Dbxref=dbSNP_129:rs21336235;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400960.1	dbSNP	SNV	1802	1802	.	+	.	ID=3624;Variant_seq=C;Dbxref=dbSNP_129:rs21336135;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400960.1	dbSNP	SNV	1803	1803	.	+	.	ID=3625;Variant_seq=A;Dbxref=dbSNP_129:rs21336125;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400960.1	dbSNP	SNV	1898	1898	.	+	.	ID=3626;Variant_seq=C;Dbxref=dbSNP_129:rs53797926;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400960.1	dbSNP	SNV	1923	1923	.	+	.	ID=3627;Variant_seq=T;Dbxref=dbSNP_129:rs18559256;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400960.1	dbSNP	SNV	2064	2064	.	+	.	ID=3628;Variant_seq=T;Dbxref=dbSNP_129:rs52950146;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400960.1	dbSNP	SNV	2069	2069	.	+	.	ID=3629;Variant_seq=C;Dbxref=dbSNP_129:rs54239957;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400960.1	dbSNP	SNV	2105	2105	.	+	.	ID=3630;Variant_seq=A;Dbxref=dbSNP_129:rs53055845;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400960.1	dbSNP	SNV	2108	2108	.	+	.	ID=3631;Variant_seq=T;Dbxref=dbSNP_129:rs54214479;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400960.1	dbSNP	SNV	2131	2131	.	+	.	ID=3632;Variant_seq=T;Dbxref=dbSNP_129:rs53284162;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400960.1	dbSNP	SNV	2133	2133	.	+	.	ID=3633;Variant_seq=C;Dbxref=dbSNP_129:rs54209558;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038339.1	dbSNP	SNV	2553	2553	.	+	.	ID=3634;Variant_seq=A;Dbxref=dbSNP_129:rs17902927;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038339.1	dbSNP	SNV	2589	2589	.	+	.	ID=3635;Variant_seq=A;Dbxref=dbSNP_129:rs18292738;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036888.1	dbSNP	SNV	11015	11015	.	+	.	ID=3636;Variant_seq=T;Dbxref=dbSNP_129:rs20030963;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036888.1	dbSNP	SNV	11135	11135	.	+	.	ID=3637;Variant_seq=C;Dbxref=dbSNP_129:rs18455161;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036888.1	dbSNP	SNV	12576	12576	.	+	.	ID=3638;Variant_seq=C;Dbxref=dbSNP_129:rs18867432;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02050049.1	dbSNP	SNV	1329	1329	.	+	.	ID=3639;Variant_seq=C;Dbxref=dbSNP_129:rs21425365;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042307.1	dbSNP	SNV	1850	1850	.	+	.	ID=3640;Variant_seq=A;Dbxref=dbSNP_129:rs21575542;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042307.1	dbSNP	SNV	1870	1870	.	+	.	ID=3641;Variant_seq=T;Dbxref=dbSNP_129:rs19905167;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042307.1	dbSNP	SNV	2798	2798	.	+	.	ID=3642;Variant_seq=T;Dbxref=dbSNP_129:rs20558272;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399560.1	dbSNP	SNV	1205	1205	.	+	.	ID=3643;Variant_seq=C;Dbxref=dbSNP_129:rs19840550;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399560.1	dbSNP	SNV	1347	1347	.	+	.	ID=3644;Variant_seq=G;Dbxref=dbSNP_129:rs19840540;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399560.1	dbSNP	SNV	3190	3190	.	+	.	ID=3645;Variant_seq=G;Dbxref=dbSNP_129:rs19840170;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399560.1	dbSNP	SNV	3298	3298	.	+	.	ID=3646;Variant_seq=A;Dbxref=dbSNP_129:rs19840140;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399560.1	dbSNP	SNV	3663	3663	.	+	.	ID=3647;Variant_seq=T;Dbxref=dbSNP_129:rs53800642;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399560.1	dbSNP	SNV	4217	4217	.	+	.	ID=3648;Variant_seq=A;Dbxref=dbSNP_129:rs21465099;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037656.1	dbSNP	SNV	1750	1750	.	+	.	ID=3649;Variant_seq=A;Dbxref=dbSNP_129:rs18543271;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037656.1	dbSNP	SNV	1798	1798	.	+	.	ID=3650;Variant_seq=C;Dbxref=dbSNP_129:rs18543232;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037656.1	dbSNP	SNV	1849	1849	.	+	.	ID=3651;Variant_seq=C;Dbxref=dbSNP_129:rs18543216;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037656.1	dbSNP	SNV	1858	1858	.	+	.	ID=3652;Variant_seq=C;Dbxref=dbSNP_129:rs18543200;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02037656.1	dbSNP	SNV	1873	1873	.	+	.	ID=3653;Variant_seq=G;Dbxref=dbSNP_129:rs18543177;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02037656.1	dbSNP	SNV	1874	1874	.	+	.	ID=3654;Variant_seq=A;Dbxref=dbSNP_129:rs18543169;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037656.1	dbSNP	SNV	1881	1881	.	+	.	ID=3655;Variant_seq=T;Dbxref=dbSNP_129:rs18543162;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02037656.1	dbSNP	SNV	2780	2780	.	+	.	ID=3656;Variant_seq=T;Dbxref=dbSNP_129:rs54101161;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037656.1	dbSNP	SNV	6111	6111	.	+	.	ID=3657;Variant_seq=A;Dbxref=dbSNP_129:rs20759360;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037656.1	dbSNP	SNV	7665	7665	.	+	.	ID=3658;Variant_seq=T;Dbxref=dbSNP_129:rs19842277;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037656.1	dbSNP	SNV	7675	7675	.	+	.	ID=3659;Variant_seq=T;Dbxref=dbSNP_129:rs19842267;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037656.1	dbSNP	insertion	8580	8580	.	+	.	ID=3660;Variant_seq=T;Dbxref=dbSNP_129:rs53363323;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02037656.1	dbSNP	SNV	8607	8607	.	+	.	ID=3661;Variant_seq=C;Dbxref=dbSNP_129:rs52875256;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044693.1	dbSNP	SNV	644	644	.	+	.	ID=3662;Variant_seq=T;Dbxref=dbSNP_129:rs53067785;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044693.1	dbSNP	SNV	660	660	.	+	.	ID=3663;Variant_seq=T;Dbxref=dbSNP_129:rs53261915;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044693.1	dbSNP	SNV	889	889	.	+	.	ID=3664;Variant_seq=C;Dbxref=dbSNP_129:rs54051650;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398795.1	dbSNP	SNV	7737	7737	.	+	.	ID=3665;Variant_seq=A;Dbxref=dbSNP_129:rs52974891;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398795.1	dbSNP	SNV	7779	7779	.	+	.	ID=3666;Variant_seq=G;Dbxref=dbSNP_129:rs53739643;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398795.1	dbSNP	SNV	7787	7787	.	+	.	ID=3667;Variant_seq=T;Dbxref=dbSNP_129:rs54103783;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398795.1	dbSNP	SNV	7796	7796	.	+	.	ID=3668;Variant_seq=A;Dbxref=dbSNP_129:rs54161141;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398795.1	dbSNP	SNV	7802	7802	.	+	.	ID=3669;Variant_seq=G;Dbxref=dbSNP_129:rs54228695;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398795.1	dbSNP	SNV	7803	7803	.	+	.	ID=3670;Variant_seq=T;Dbxref=dbSNP_129:rs54087930;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398795.1	dbSNP	SNV	7808	7808	.	+	.	ID=3671;Variant_seq=T;Dbxref=dbSNP_129:rs53751948;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041808.1	dbSNP	SNV	2798	2798	.	+	.	ID=3672;Variant_seq=A;Dbxref=dbSNP_129:rs54098271;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041808.1	dbSNP	SNV	2804	2804	.	+	.	ID=3673;Variant_seq=A;Dbxref=dbSNP_129:rs53597875;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041808.1	dbSNP	SNV	2805	2805	.	+	.	ID=3674;Variant_seq=A;Dbxref=dbSNP_129:rs53419375;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041808.1	dbSNP	SNV	2811	2811	.	+	.	ID=3675;Variant_seq=C;Dbxref=dbSNP_129:rs54154070;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041808.1	dbSNP	SNV	2813	2813	.	+	.	ID=3676;Variant_seq=C;Dbxref=dbSNP_129:rs54384590;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041808.1	dbSNP	SNV	2813	2813	.	+	.	ID=3677;Variant_seq=C;Dbxref=dbSNP_129:rs53051611;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041808.1	dbSNP	SNV	2813	2813	.	+	.	ID=3678;Variant_seq=G;Dbxref=dbSNP_129:rs53896144;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041808.1	dbSNP	SNV	2830	2830	.	+	.	ID=3679;Variant_seq=G;Dbxref=dbSNP_129:rs53601594;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041808.1	dbSNP	SNV	2842	2842	.	+	.	ID=3680;Variant_seq=T;Dbxref=dbSNP_129:rs53115194;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041808.1	dbSNP	SNV	2843	2843	.	+	.	ID=3681;Variant_seq=A;Dbxref=dbSNP_129:rs53512375;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041808.1	dbSNP	insertion	2867	2867	.	+	.	ID=3682;Variant_seq=AT;Dbxref=dbSNP_129:rs53826028;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02041808.1	dbSNP	deletion	2869	2869	.	+	.	ID=3683;Variant_seq=-;Dbxref=dbSNP_129:rs52852580;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041808.1	dbSNP	SNV	2870	2870	.	+	.	ID=3684;Variant_seq=T;Dbxref=dbSNP_129:rs53005283;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041808.1	dbSNP	SNV	2872	2872	.	+	.	ID=3685;Variant_seq=A;Dbxref=dbSNP_129:rs53204569;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041808.1	dbSNP	SNV	2876	2876	.	+	.	ID=3686;Variant_seq=A;Dbxref=dbSNP_129:rs54052455;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041808.1	dbSNP	SNV	3122	3122	.	+	.	ID=3687;Variant_seq=C;Dbxref=dbSNP_129:rs54167307;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041808.1	dbSNP	SNV	3132	3132	.	+	.	ID=3688;Variant_seq=T;Dbxref=dbSNP_129:rs54406954;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041808.1	dbSNP	SNV	3138	3138	.	+	.	ID=3689;Variant_seq=T;Dbxref=dbSNP_129:rs53376473;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	2833	2833	.	+	.	ID=3690;Variant_seq=A;Dbxref=dbSNP_129:rs21555945;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041953.1	dbSNP	SNV	2835	2835	.	+	.	ID=3691;Variant_seq=A;Dbxref=dbSNP_129:rs21555955;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041953.1	dbSNP	SNV	2843	2843	.	+	.	ID=3692;Variant_seq=T;Dbxref=dbSNP_129:rs21555965;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	2854	2854	.	+	.	ID=3693;Variant_seq=G;Dbxref=dbSNP_129:rs21555985;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	2864	2864	.	+	.	ID=3694;Variant_seq=T;Dbxref=dbSNP_129:rs21556005;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	2866	2866	.	+	.	ID=3695;Variant_seq=G;Dbxref=dbSNP_129:rs21556015;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	2868	2868	.	+	.	ID=3696;Variant_seq=G;Dbxref=dbSNP_129:rs21556025;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	2911	2911	.	+	.	ID=3697;Variant_seq=T;Dbxref=dbSNP_129:rs21556055;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	2926	2926	.	+	.	ID=3698;Variant_seq=T;Dbxref=dbSNP_129:rs21556065;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	2927	2927	.	+	.	ID=3699;Variant_seq=G;Dbxref=dbSNP_129:rs21556075;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	2933	2933	.	+	.	ID=3700;Variant_seq=A;Dbxref=dbSNP_129:rs21556085;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041953.1	dbSNP	SNV	3040	3040	.	+	.	ID=3701;Variant_seq=G;Dbxref=dbSNP_129:rs21556105;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041953.1	dbSNP	SNV	3041	3041	.	+	.	ID=3702;Variant_seq=G;Dbxref=dbSNP_129:rs21556115;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	3043	3043	.	+	.	ID=3703;Variant_seq=T;Dbxref=dbSNP_129:rs21556125;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	3082	3082	.	+	.	ID=3704;Variant_seq=A,T,C;Dbxref=dbSNP_129:rs17892188;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041953.1	dbSNP	SNV	3083	3083	.	+	.	ID=3705;Variant_seq=T;Dbxref=dbSNP_129:rs17892187;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	3084	3084	.	+	.	ID=3706;Variant_seq=T;Dbxref=dbSNP_129:rs17892186;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	3095	3095	.	+	.	ID=3707;Variant_seq=A;Dbxref=dbSNP_129:rs21556155;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041953.1	dbSNP	SNV	3098	3098	.	+	.	ID=3708;Variant_seq=A;Dbxref=dbSNP_129:rs21556165;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041953.1	dbSNP	SNV	3100	3100	.	+	.	ID=3709;Variant_seq=G;Dbxref=dbSNP_129:rs21556175;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	3105	3105	.	+	.	ID=3710;Variant_seq=A;Dbxref=dbSNP_129:rs21556185;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041953.1	dbSNP	SNV	3123	3123	.	+	.	ID=3711;Variant_seq=G;Dbxref=dbSNP_129:rs21556195;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	3125	3125	.	+	.	ID=3712;Variant_seq=T;Dbxref=dbSNP_129:rs21556205;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	3134	3134	.	+	.	ID=3713;Variant_seq=T;Dbxref=dbSNP_129:rs21556215;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	3144	3144	.	+	.	ID=3714;Variant_seq=A;Dbxref=dbSNP_129:rs21556225;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041953.1	dbSNP	SNV	3145	3145	.	+	.	ID=3715;Variant_seq=T;Dbxref=dbSNP_129:rs21556235;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	3173	3173	.	+	.	ID=3716;Variant_seq=T;Dbxref=dbSNP_129:rs21556265;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	3177	3177	.	+	.	ID=3717;Variant_seq=G;Dbxref=dbSNP_129:rs21556275;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	3183	3183	.	+	.	ID=3718;Variant_seq=T,C,G;Dbxref=dbSNP_129:rs17893133;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	3187	3187	.	+	.	ID=3719;Variant_seq=G;Dbxref=dbSNP_129:rs21556285;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	3188	3188	.	+	.	ID=3720;Variant_seq=T;Dbxref=dbSNP_129:rs21556295;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	3190	3190	.	+	.	ID=3721;Variant_seq=C;Dbxref=dbSNP_129:rs21556305;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041953.1	dbSNP	SNV	3191	3191	.	+	.	ID=3722;Variant_seq=T;Dbxref=dbSNP_129:rs21556315;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	3193	3193	.	+	.	ID=3723;Variant_seq=T;Dbxref=dbSNP_129:rs21556325;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	3417	3417	.	+	.	ID=3724;Variant_seq=C;Dbxref=dbSNP_129:rs21556435;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041953.1	dbSNP	SNV	3429	3429	.	+	.	ID=3725;Variant_seq=G;Dbxref=dbSNP_129:rs21556445;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	3439	3439	.	+	.	ID=3726;Variant_seq=T;Dbxref=dbSNP_129:rs21556455;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	3455	3455	.	+	.	ID=3727;Variant_seq=T;Dbxref=dbSNP_129:rs21556475;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	3458	3458	.	+	.	ID=3728;Variant_seq=T;Dbxref=dbSNP_129:rs21556485;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	3459	3459	.	+	.	ID=3729;Variant_seq=C;Dbxref=dbSNP_129:rs21556495;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041953.1	dbSNP	SNV	3462	3462	.	+	.	ID=3730;Variant_seq=T;Dbxref=dbSNP_129:rs21556505;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	3463	3463	.	+	.	ID=3731;Variant_seq=T;Dbxref=dbSNP_129:rs21556515;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	3468	3468	.	+	.	ID=3732;Variant_seq=C;Dbxref=dbSNP_129:rs21556525;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041953.1	dbSNP	SNV	3781	3781	.	+	.	ID=3733;Variant_seq=T;Dbxref=dbSNP_129:rs21556645;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	3790	3790	.	+	.	ID=3734;Variant_seq=T;Dbxref=dbSNP_129:rs21556665;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	3791	3791	.	+	.	ID=3735;Variant_seq=A;Dbxref=dbSNP_129:rs21556675;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	3797	3797	.	+	.	ID=3736;Variant_seq=G;Dbxref=dbSNP_129:rs21556685;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	3804	3804	.	+	.	ID=3737;Variant_seq=C;Dbxref=dbSNP_129:rs21556695;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	3813	3813	.	+	.	ID=3738;Variant_seq=T;Dbxref=dbSNP_129:rs21556705;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	3820	3820	.	+	.	ID=3739;Variant_seq=T;Dbxref=dbSNP_129:rs21556715;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	3862	3862	.	+	.	ID=3740;Variant_seq=T;Dbxref=dbSNP_129:rs21556745;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	3865	3865	.	+	.	ID=3741;Variant_seq=C;Dbxref=dbSNP_129:rs21556755;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041953.1	dbSNP	SNV	3938	3938	.	+	.	ID=3742;Variant_seq=G;Dbxref=dbSNP_129:rs21556795;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	3939	3939	.	+	.	ID=3743;Variant_seq=A;Dbxref=dbSNP_129:rs21556805;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041953.1	dbSNP	SNV	3941	3941	.	+	.	ID=3744;Variant_seq=C;Dbxref=dbSNP_129:rs21556815;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041953.1	dbSNP	SNV	3957	3957	.	+	.	ID=3745;Variant_seq=T;Dbxref=dbSNP_129:rs21556825;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	3961	3961	.	+	.	ID=3746;Variant_seq=T;Dbxref=dbSNP_129:rs21556835;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	3962	3962	.	+	.	ID=3747;Variant_seq=T;Dbxref=dbSNP_129:rs21556845;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041953.1	dbSNP	SNV	3971	3971	.	+	.	ID=3748;Variant_seq=T;Dbxref=dbSNP_129:rs21556865;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041953.1	dbSNP	SNV	4003	4003	.	+	.	ID=3749;Variant_seq=T;Dbxref=dbSNP_129:rs21556875;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044843.1	dbSNP	SNV	2531	2531	.	+	.	ID=3750;Variant_seq=C;Dbxref=dbSNP_129:rs53581141;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044843.1	dbSNP	SNV	2531	2531	.	+	.	ID=3751;Variant_seq=C;Dbxref=dbSNP_129:rs54171680;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044843.1	dbSNP	SNV	2537	2537	.	+	.	ID=3752;Variant_seq=T;Dbxref=dbSNP_129:rs52995451;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044843.1	dbSNP	SNV	2546	2546	.	+	.	ID=3753;Variant_seq=T;Dbxref=dbSNP_129:rs53603543;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044843.1	dbSNP	SNV	2548	2548	.	+	.	ID=3754;Variant_seq=T;Dbxref=dbSNP_129:rs52931159;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044843.1	dbSNP	SNV	2550	2550	.	+	.	ID=3755;Variant_seq=T;Dbxref=dbSNP_129:rs54157861;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044843.1	dbSNP	SNV	2561	2561	.	+	.	ID=3756;Variant_seq=A;Dbxref=dbSNP_129:rs54260064;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044843.1	dbSNP	SNV	2570	2570	.	+	.	ID=3757;Variant_seq=A;Dbxref=dbSNP_129:rs54056402;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044753.1	dbSNP	SNV	3033	3033	.	+	.	ID=3758;Variant_seq=C;Dbxref=dbSNP_129:rs18826323;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044753.1	dbSNP	SNV	3051	3051	.	+	.	ID=3759;Variant_seq=T;Dbxref=dbSNP_129:rs18826333;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044753.1	dbSNP	SNV	3068	3068	.	+	.	ID=3760;Variant_seq=A;Dbxref=dbSNP_129:rs18826363;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044753.1	dbSNP	SNV	3069	3069	.	+	.	ID=3761;Variant_seq=A;Dbxref=dbSNP_129:rs18826372;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040522.1	dbSNP	deletion	826	826	.	+	.	ID=3762;Variant_seq=-;Dbxref=dbSNP_129:rs53496291;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399349.1	dbSNP	SNV	3856	3856	.	+	.	ID=3763;Variant_seq=G;Dbxref=dbSNP_129:rs54316628;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399349.1	dbSNP	SNV	3859	3859	.	+	.	ID=3764;Variant_seq=A;Dbxref=dbSNP_129:rs54379380;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399349.1	dbSNP	SNV	3862	3862	.	+	.	ID=3765;Variant_seq=T;Dbxref=dbSNP_129:rs53506224;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044404.1	dbSNP	SNV	2661	2661	.	+	.	ID=3766;Variant_seq=A;Dbxref=dbSNP_129:rs54224371;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044404.1	dbSNP	SNV	2662	2662	.	+	.	ID=3767;Variant_seq=C;Dbxref=dbSNP_129:rs54186066;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044404.1	dbSNP	SNV	2663	2663	.	+	.	ID=3768;Variant_seq=C;Dbxref=dbSNP_129:rs20169162;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044404.1	dbSNP	SNV	2673	2673	.	+	.	ID=3769;Variant_seq=T;Dbxref=dbSNP_129:rs20169152;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02050107.1	dbSNP	SNV	496	496	.	+	.	ID=3770;Variant_seq=G;Dbxref=dbSNP_129:rs20766970;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02050107.1	dbSNP	SNV	501	501	.	+	.	ID=3771;Variant_seq=A;Dbxref=dbSNP_129:rs20766980;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02050107.1	dbSNP	SNV	564	564	.	+	.	ID=3772;Variant_seq=G;Dbxref=dbSNP_129:rs20766990;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02050107.1	dbSNP	SNV	581	581	.	+	.	ID=3773;Variant_seq=A;Dbxref=dbSNP_129:rs20767000;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02050107.1	dbSNP	SNV	593	593	.	+	.	ID=3774;Variant_seq=G;Dbxref=dbSNP_129:rs20767010;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02050107.1	dbSNP	SNV	673	673	.	+	.	ID=3775;Variant_seq=C;Dbxref=dbSNP_129:rs20767020;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02050107.1	dbSNP	SNV	723	723	.	+	.	ID=3776;Variant_seq=T;Dbxref=dbSNP_129:rs20767030;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02050107.1	dbSNP	SNV	735	735	.	+	.	ID=3777;Variant_seq=T;Dbxref=dbSNP_129:rs20767040;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02050107.1	dbSNP	SNV	804	804	.	+	.	ID=3778;Variant_seq=C;Dbxref=dbSNP_129:rs20767050;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02050107.1	dbSNP	SNV	806	806	.	+	.	ID=3779;Variant_seq=C;Dbxref=dbSNP_129:rs20767060;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02050107.1	dbSNP	SNV	1285	1285	.	+	.	ID=3780;Variant_seq=T;Dbxref=dbSNP_129:rs21013086;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02050107.1	dbSNP	SNV	1372	1372	.	+	.	ID=3781;Variant_seq=G;Dbxref=dbSNP_129:rs19012207;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02050107.1	dbSNP	SNV	1376	1376	.	+	.	ID=3782;Variant_seq=T;Dbxref=dbSNP_129:rs19012198;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02050107.1	dbSNP	SNV	1378	1378	.	+	.	ID=3783;Variant_seq=A;Dbxref=dbSNP_129:rs19012190;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02050107.1	dbSNP	SNV	1381	1381	.	+	.	ID=3784;Variant_seq=T;Dbxref=dbSNP_129:rs19012182;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02050107.1	dbSNP	SNV	1385	1385	.	+	.	ID=3785;Variant_seq=T;Dbxref=dbSNP_129:rs19012174;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02050107.1	dbSNP	SNV	1389	1389	.	+	.	ID=3786;Variant_seq=T;Dbxref=dbSNP_129:rs19012158;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048207.1	dbSNP	SNV	1764	1764	.	+	.	ID=3787;Variant_seq=T;Dbxref=dbSNP_129:rs21252502;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048207.1	dbSNP	SNV	1793	1793	.	+	.	ID=3788;Variant_seq=A;Dbxref=dbSNP_129:rs54275248;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049234.1	dbSNP	SNV	315	315	.	+	.	ID=3789;Variant_seq=C;Dbxref=dbSNP_129:rs20310685;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043542.1	dbSNP	SNV	2415	2415	.	+	.	ID=3790;Variant_seq=C;Dbxref=dbSNP_129:rs19204449;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398969.1	dbSNP	SNV	5173	5173	.	+	.	ID=3791;Variant_seq=A;Dbxref=dbSNP_129:rs21031898;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400124.1	dbSNP	SNV	3279	3279	.	+	.	ID=3792;Variant_seq=C;Dbxref=dbSNP_129:rs18641415;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400124.1	dbSNP	SNV	3485	3485	.	+	.	ID=3793;Variant_seq=A;Dbxref=dbSNP_129:rs18641442;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398296.1	dbSNP	SNV	1834	1834	.	+	.	ID=3794;Variant_seq=A;Dbxref=dbSNP_129:rs19372730;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398296.1	dbSNP	SNV	1841	1841	.	+	.	ID=3795;Variant_seq=G;Dbxref=dbSNP_129:rs19372720;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398296.1	dbSNP	SNV	8822	8822	.	+	.	ID=3796;Variant_seq=A;Dbxref=dbSNP_129:rs18797491;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398296.1	dbSNP	SNV	13709	13709	.	+	.	ID=3797;Variant_seq=T;Dbxref=dbSNP_129:rs19414733;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398296.1	dbSNP	SNV	15128	15128	.	+	.	ID=3798;Variant_seq=C;Dbxref=dbSNP_129:rs21655720;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398296.1	dbSNP	SNV	18816	18816	.	+	.	ID=3799;Variant_seq=T;Dbxref=dbSNP_129:rs20168356;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398296.1	dbSNP	SNV	27588	27588	.	+	.	ID=3800;Variant_seq=T;Dbxref=dbSNP_129:rs19929609;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398296.1	dbSNP	SNV	30143	30143	.	+	.	ID=3801;Variant_seq=A;Dbxref=dbSNP_129:rs18112480;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399464.1	dbSNP	SNV	1264	1264	.	+	.	ID=3802;Variant_seq=G;Dbxref=dbSNP_129:rs18533813;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399464.1	dbSNP	SNV	2633	2633	.	+	.	ID=3803;Variant_seq=G;Dbxref=dbSNP_129:rs20971203;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399464.1	dbSNP	SNV	3141	3141	.	+	.	ID=3804;Variant_seq=A;Dbxref=dbSNP_129:rs52893354;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399464.1	dbSNP	SNV	3945	3945	.	+	.	ID=3805;Variant_seq=C;Dbxref=dbSNP_129:rs19204109;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399464.1	dbSNP	SNV	3948	3948	.	+	.	ID=3806;Variant_seq=G;Dbxref=dbSNP_129:rs19204119;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399464.1	dbSNP	SNV	5103	5103	.	+	.	ID=3807;Variant_seq=G;Dbxref=dbSNP_129:rs18533813;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043336.1	dbSNP	SNV	1357	1357	.	+	.	ID=3808;Variant_seq=T;Dbxref=dbSNP_129:rs19058426;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398831.1	dbSNP	SNV	1177	1177	.	+	.	ID=3809;Variant_seq=G;Dbxref=dbSNP_129:rs52902162;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398831.1	dbSNP	SNV	1178	1178	.	+	.	ID=3810;Variant_seq=G;Dbxref=dbSNP_129:rs54340529;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398831.1	dbSNP	SNV	1191	1191	.	+	.	ID=3811;Variant_seq=C;Dbxref=dbSNP_129:rs53417718;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398831.1	dbSNP	SNV	4056	4056	.	+	.	ID=3812;Variant_seq=A;Dbxref=dbSNP_129:rs19019682;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398831.1	dbSNP	SNV	7358	7358	.	+	.	ID=3813;Variant_seq=G;Dbxref=dbSNP_129:rs20901615;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398831.1	dbSNP	SNV	7364	7364	.	+	.	ID=3814;Variant_seq=T;Dbxref=dbSNP_129:rs20901625;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045514.1	dbSNP	SNV	1192	1192	.	+	.	ID=3815;Variant_seq=A;Dbxref=dbSNP_129:rs20847505;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045514.1	dbSNP	SNV	1197	1197	.	+	.	ID=3816;Variant_seq=A;Dbxref=dbSNP_129:rs20847495;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399096.1	dbSNP	SNV	230	230	.	+	.	ID=3817;Variant_seq=G;Dbxref=dbSNP_129:rs53906820;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399096.1	dbSNP	SNV	3555	3555	.	+	.	ID=3818;Variant_seq=T;Dbxref=dbSNP_129:rs19038765;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399096.1	dbSNP	SNV	3573	3573	.	+	.	ID=3819;Variant_seq=A;Dbxref=dbSNP_129:rs19038814;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399096.1	dbSNP	SNV	3585	3585	.	+	.	ID=3820;Variant_seq=A;Dbxref=dbSNP_129:rs19038834;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047756.1	dbSNP	SNV	1337	1337	.	+	.	ID=3821;Variant_seq=T;Dbxref=dbSNP_129:rs21073894;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047756.1	dbSNP	SNV	1503	1503	.	+	.	ID=3822;Variant_seq=G;Dbxref=dbSNP_129:rs21073884;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047756.1	dbSNP	SNV	1808	1808	.	+	.	ID=3823;Variant_seq=A;Dbxref=dbSNP_129:rs21073874;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047756.1	dbSNP	SNV	2180	2180	.	+	.	ID=3824;Variant_seq=T;Dbxref=dbSNP_129:rs21073854;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042346.1	dbSNP	SNV	3705	3705	.	+	.	ID=3825;Variant_seq=T;Dbxref=dbSNP_129:rs20380160;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047707.1	dbSNP	SNV	1991	1991	.	+	.	ID=3826;Variant_seq=G;Dbxref=dbSNP_129:rs54052745;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047707.1	dbSNP	SNV	1992	1992	.	+	.	ID=3827;Variant_seq=A;Dbxref=dbSNP_129:rs53230773;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047707.1	dbSNP	SNV	1996	1996	.	+	.	ID=3828;Variant_seq=T;Dbxref=dbSNP_129:rs53156103;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047707.1	dbSNP	SNV	2026	2026	.	+	.	ID=3829;Variant_seq=T;Dbxref=dbSNP_129:rs53316677;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047707.1	dbSNP	SNV	2029	2029	.	+	.	ID=3830;Variant_seq=A;Dbxref=dbSNP_129:rs53521321;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047707.1	dbSNP	SNV	2040	2040	.	+	.	ID=3831;Variant_seq=A;Dbxref=dbSNP_129:rs19167840;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040199.1	dbSNP	SNV	556	556	.	+	.	ID=3832;Variant_seq=T;Dbxref=dbSNP_129:rs54116714;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02040199.1	dbSNP	SNV	565	565	.	+	.	ID=3833;Variant_seq=G;Dbxref=dbSNP_129:rs53265472;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040199.1	dbSNP	SNV	4655	4655	.	+	.	ID=3834;Variant_seq=A;Dbxref=dbSNP_129:rs20814636;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040199.1	dbSNP	SNV	4875	4875	.	+	.	ID=3835;Variant_seq=T;Dbxref=dbSNP_129:rs53132408;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399977.1	dbSNP	SNV	3861	3861	.	+	.	ID=3836;Variant_seq=T;Dbxref=dbSNP_129:rs19061508;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039592.1	dbSNP	SNV	3447	3447	.	+	.	ID=3837;Variant_seq=G;Dbxref=dbSNP_129:rs53045690;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039592.1	dbSNP	SNV	3451	3451	.	+	.	ID=3838;Variant_seq=T;Dbxref=dbSNP_129:rs52975129;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039592.1	dbSNP	insertion	3496	3496	.	+	.	ID=3839;Variant_seq=T;Dbxref=dbSNP_129:rs53753517;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02039592.1	dbSNP	SNV	5816	5816	.	+	.	ID=3840;Variant_seq=A;Dbxref=dbSNP_129:rs19643847;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049158.1	dbSNP	SNV	1225	1225	.	+	.	ID=3841;Variant_seq=T;Dbxref=dbSNP_129:rs54345804;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049158.1	dbSNP	SNV	1236	1236	.	+	.	ID=3842;Variant_seq=G;Dbxref=dbSNP_129:rs53815595;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398343.1	dbSNP	SNV	1539	1539	.	+	.	ID=3843;Variant_seq=A;Dbxref=dbSNP_129:rs21711522;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398343.1	dbSNP	SNV	1553	1553	.	+	.	ID=3844;Variant_seq=T;Dbxref=dbSNP_129:rs17973806;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398343.1	dbSNP	SNV	2897	2897	.	+	.	ID=3845;Variant_seq=A;Dbxref=dbSNP_129:rs18020602;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398343.1	dbSNP	SNV	2901	2901	.	+	.	ID=3846;Variant_seq=T;Dbxref=dbSNP_129:rs18020575;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398343.1	dbSNP	SNV	2902	2902	.	+	.	ID=3847;Variant_seq=T;Dbxref=dbSNP_129:rs18020566;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398343.1	dbSNP	SNV	2908	2908	.	+	.	ID=3848;Variant_seq=G;Dbxref=dbSNP_129:rs18020539;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398343.1	dbSNP	SNV	2909	2909	.	+	.	ID=3849;Variant_seq=A;Dbxref=dbSNP_129:rs18020530;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398343.1	dbSNP	SNV	2932	2932	.	+	.	ID=3850;Variant_seq=G;Dbxref=dbSNP_129:rs18020467;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398343.1	dbSNP	SNV	2933	2933	.	+	.	ID=3851;Variant_seq=T;Dbxref=dbSNP_129:rs18020458;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398343.1	dbSNP	SNV	2944	2944	.	+	.	ID=3852;Variant_seq=A;Dbxref=dbSNP_129:rs18020413;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398343.1	dbSNP	SNV	2945	2945	.	+	.	ID=3853;Variant_seq=C;Dbxref=dbSNP_129:rs18020404;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398343.1	dbSNP	SNV	3209	3209	.	+	.	ID=3854;Variant_seq=A;Dbxref=dbSNP_129:rs21466369;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398343.1	dbSNP	SNV	3215	3215	.	+	.	ID=3855;Variant_seq=G;Dbxref=dbSNP_129:rs21466389;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398343.1	dbSNP	SNV	5006	5006	.	+	.	ID=3856;Variant_seq=A;Dbxref=dbSNP_129:rs20575121;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398343.1	dbSNP	SNV	5017	5017	.	+	.	ID=3857;Variant_seq=T;Dbxref=dbSNP_129:rs20575101;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398343.1	dbSNP	SNV	5021	5021	.	+	.	ID=3858;Variant_seq=G;Dbxref=dbSNP_129:rs20575091;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398343.1	dbSNP	SNV	5033	5033	.	+	.	ID=3859;Variant_seq=T;Dbxref=dbSNP_129:rs20575071;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398343.1	dbSNP	SNV	5048	5048	.	+	.	ID=3860;Variant_seq=A;Dbxref=dbSNP_129:rs20575061;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398343.1	dbSNP	SNV	5054	5054	.	+	.	ID=3861;Variant_seq=T;Dbxref=dbSNP_129:rs20575051;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398343.1	dbSNP	SNV	5056	5056	.	+	.	ID=3862;Variant_seq=G;Dbxref=dbSNP_129:rs20575041;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398343.1	dbSNP	SNV	5060	5060	.	+	.	ID=3863;Variant_seq=T;Dbxref=dbSNP_129:rs20575031;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398343.1	dbSNP	SNV	5063	5063	.	+	.	ID=3864;Variant_seq=T;Dbxref=dbSNP_129:rs20575021;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398343.1	dbSNP	SNV	15538	15538	.	+	.	ID=3865;Variant_seq=G;Dbxref=dbSNP_129:rs19742764;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398343.1	dbSNP	SNV	15587	15587	.	+	.	ID=3866;Variant_seq=G;Dbxref=dbSNP_129:rs19742624;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398343.1	dbSNP	SNV	15611	15611	.	+	.	ID=3867;Variant_seq=T;Dbxref=dbSNP_129:rs19742594;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398343.1	dbSNP	SNV	16502	16502	.	+	.	ID=3868;Variant_seq=T;Dbxref=dbSNP_129:rs17918933;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398343.1	dbSNP	SNV	16503	16503	.	+	.	ID=3869;Variant_seq=C;Dbxref=dbSNP_129:rs17918942;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398343.1	dbSNP	SNV	16539	16539	.	+	.	ID=3870;Variant_seq=G;Dbxref=dbSNP_129:rs17918951;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398343.1	dbSNP	SNV	16588	16588	.	+	.	ID=3871;Variant_seq=T;Dbxref=dbSNP_129:rs17918960;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398343.1	dbSNP	SNV	16684	16684	.	+	.	ID=3872;Variant_seq=T;Dbxref=dbSNP_129:rs17918978;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398343.1	dbSNP	SNV	17014	17014	.	+	.	ID=3873;Variant_seq=T;Dbxref=dbSNP_129:rs53671274;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398343.1	dbSNP	SNV	17027	17027	.	+	.	ID=3874;Variant_seq=A;Dbxref=dbSNP_129:rs53698768;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398343.1	dbSNP	SNV	17032	17032	.	+	.	ID=3875;Variant_seq=G;Dbxref=dbSNP_129:rs53671610;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398343.1	dbSNP	SNV	17035	17035	.	+	.	ID=3876;Variant_seq=G;Dbxref=dbSNP_129:rs54276756;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398343.1	dbSNP	SNV	17037	17037	.	+	.	ID=3877;Variant_seq=T;Dbxref=dbSNP_129:rs53091074;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398343.1	dbSNP	SNV	17039	17039	.	+	.	ID=3878;Variant_seq=A;Dbxref=dbSNP_129:rs52906665;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398343.1	dbSNP	SNV	17040	17040	.	+	.	ID=3879;Variant_seq=T;Dbxref=dbSNP_129:rs53511023;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398343.1	dbSNP	SNV	17048	17048	.	+	.	ID=3880;Variant_seq=C;Dbxref=dbSNP_129:rs54011616;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398343.1	dbSNP	SNV	17050	17050	.	+	.	ID=3881;Variant_seq=A;Dbxref=dbSNP_129:rs53559831;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398343.1	dbSNP	SNV	17051	17051	.	+	.	ID=3882;Variant_seq=A;Dbxref=dbSNP_129:rs54140745;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398343.1	dbSNP	SNV	17053	17053	.	+	.	ID=3883;Variant_seq=A;Dbxref=dbSNP_129:rs53159421;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398343.1	dbSNP	SNV	20289	20289	.	+	.	ID=3884;Variant_seq=A;Dbxref=dbSNP_129:rs18028605;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048254.1	dbSNP	SNV	1313	1313	.	+	.	ID=3885;Variant_seq=T;Dbxref=dbSNP_129:rs52881227;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048254.1	dbSNP	SNV	1417	1417	.	+	.	ID=3886;Variant_seq=C;Dbxref=dbSNP_129:rs53593344;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048621.1	dbSNP	SNV	1004	1004	.	+	.	ID=3887;Variant_seq=G;Dbxref=dbSNP_129:rs20971949;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048621.1	dbSNP	SNV	1016	1016	.	+	.	ID=3888;Variant_seq=C;Dbxref=dbSNP_129:rs20971929;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048621.1	dbSNP	SNV	1028	1028	.	+	.	ID=3889;Variant_seq=A;Dbxref=dbSNP_129:rs20971919;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048621.1	dbSNP	SNV	1034	1034	.	+	.	ID=3890;Variant_seq=C;Dbxref=dbSNP_129:rs20971909;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048621.1	dbSNP	SNV	1048	1048	.	+	.	ID=3891;Variant_seq=C;Dbxref=dbSNP_129:rs20971899;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048621.1	dbSNP	SNV	1057	1057	.	+	.	ID=3892;Variant_seq=C;Dbxref=dbSNP_129:rs20971889;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048621.1	dbSNP	SNV	1059	1059	.	+	.	ID=3893;Variant_seq=T;Dbxref=dbSNP_129:rs20971879;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048621.1	dbSNP	SNV	1377	1377	.	+	.	ID=3894;Variant_seq=G;Dbxref=dbSNP_129:rs20971739;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048621.1	dbSNP	SNV	1397	1397	.	+	.	ID=3895;Variant_seq=A;Dbxref=dbSNP_129:rs20971729;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048621.1	dbSNP	SNV	1413	1413	.	+	.	ID=3896;Variant_seq=G;Dbxref=dbSNP_129:rs20971709;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048621.1	dbSNP	SNV	1438	1438	.	+	.	ID=3897;Variant_seq=G;Dbxref=dbSNP_129:rs20971699;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048621.1	dbSNP	SNV	1443	1443	.	+	.	ID=3898;Variant_seq=G;Dbxref=dbSNP_129:rs20971689;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048621.1	dbSNP	SNV	1445	1445	.	+	.	ID=3899;Variant_seq=T;Dbxref=dbSNP_129:rs20971679;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048621.1	dbSNP	SNV	1448	1448	.	+	.	ID=3900;Variant_seq=T;Dbxref=dbSNP_129:rs20971669;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048621.1	dbSNP	SNV	1452	1452	.	+	.	ID=3901;Variant_seq=G;Dbxref=dbSNP_129:rs20971659;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048621.1	dbSNP	SNV	1461	1461	.	+	.	ID=3902;Variant_seq=C;Dbxref=dbSNP_129:rs20971649;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048621.1	dbSNP	SNV	1489	1489	.	+	.	ID=3903;Variant_seq=A;Dbxref=dbSNP_129:rs20971639;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047842.1	dbSNP	SNV	616	616	.	+	.	ID=3904;Variant_seq=C;Dbxref=dbSNP_129:rs53763765;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047842.1	dbSNP	SNV	621	621	.	+	.	ID=3905;Variant_seq=G;Dbxref=dbSNP_129:rs54097621;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047842.1	dbSNP	SNV	625	625	.	+	.	ID=3906;Variant_seq=A;Dbxref=dbSNP_129:rs54339191;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047842.1	dbSNP	SNV	630	630	.	+	.	ID=3907;Variant_seq=A;Dbxref=dbSNP_129:rs54008401;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047842.1	dbSNP	SNV	649	649	.	+	.	ID=3908;Variant_seq=T;Dbxref=dbSNP_129:rs54065416;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047842.1	dbSNP	SNV	649	649	.	+	.	ID=3909;Variant_seq=A;Dbxref=dbSNP_129:rs53723154;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047842.1	dbSNP	SNV	758	758	.	+	.	ID=3910;Variant_seq=G;Dbxref=dbSNP_129:rs54014579;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047842.1	dbSNP	SNV	766	766	.	+	.	ID=3911;Variant_seq=G;Dbxref=dbSNP_129:rs53954891;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047842.1	dbSNP	SNV	768	768	.	+	.	ID=3912;Variant_seq=C;Dbxref=dbSNP_129:rs52960537;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047842.1	dbSNP	insertion	889	889	.	+	.	ID=3913;Variant_seq=GTT;Dbxref=dbSNP_129:rs53073030;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02047842.1	dbSNP	insertion	932	932	.	+	.	ID=3914;Variant_seq=A;Dbxref=dbSNP_129:rs53281458;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02047842.1	dbSNP	SNV	955	955	.	+	.	ID=3915;Variant_seq=A;Dbxref=dbSNP_129:rs53324061;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400776.1	dbSNP	SNV	1054	1054	.	+	.	ID=3916;Variant_seq=A;Dbxref=dbSNP_129:rs17907792;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400776.1	dbSNP	SNV	1064	1064	.	+	.	ID=3917;Variant_seq=G;Dbxref=dbSNP_129:rs17907801;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400776.1	dbSNP	SNV	1214	1214	.	+	.	ID=3918;Variant_seq=C;Dbxref=dbSNP_129:rs17907846;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400776.1	dbSNP	SNV	1254	1254	.	+	.	ID=3919;Variant_seq=T;Dbxref=dbSNP_129:rs17907864;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400776.1	dbSNP	SNV	1317	1317	.	+	.	ID=3920;Variant_seq=C;Dbxref=dbSNP_129:rs17907882;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400776.1	dbSNP	SNV	1354	1354	.	+	.	ID=3921;Variant_seq=A;Dbxref=dbSNP_129:rs17907891;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400776.1	dbSNP	SNV	1361	1361	.	+	.	ID=3922;Variant_seq=A;Dbxref=dbSNP_129:rs17907900;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400776.1	dbSNP	SNV	1384	1384	.	+	.	ID=3923;Variant_seq=T;Dbxref=dbSNP_129:rs17907936;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400776.1	dbSNP	SNV	1414	1414	.	+	.	ID=3924;Variant_seq=T;Dbxref=dbSNP_129:rs17907954;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400776.1	dbSNP	SNV	1419	1419	.	+	.	ID=3925;Variant_seq=A;Dbxref=dbSNP_129:rs17907963;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400776.1	dbSNP	SNV	1431	1431	.	+	.	ID=3926;Variant_seq=T;Dbxref=dbSNP_129:rs17907981;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400776.1	dbSNP	SNV	1432	1432	.	+	.	ID=3927;Variant_seq=T;Dbxref=dbSNP_129:rs17907990;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400776.1	dbSNP	SNV	1438	1438	.	+	.	ID=3928;Variant_seq=G;Dbxref=dbSNP_129:rs17907999;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400776.1	dbSNP	SNV	1448	1448	.	+	.	ID=3929;Variant_seq=G;Dbxref=dbSNP_129:rs17908017;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400776.1	dbSNP	SNV	1449	1449	.	+	.	ID=3930;Variant_seq=G;Dbxref=dbSNP_129:rs17908026;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400776.1	dbSNP	SNV	1462	1462	.	+	.	ID=3931;Variant_seq=A;Dbxref=dbSNP_129:rs17908053;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400776.1	dbSNP	SNV	1474	1474	.	+	.	ID=3932;Variant_seq=A;Dbxref=dbSNP_129:rs17908062;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400776.1	dbSNP	SNV	1481	1481	.	+	.	ID=3933;Variant_seq=T;Dbxref=dbSNP_129:rs17908071;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400776.1	dbSNP	SNV	1516	1516	.	+	.	ID=3934;Variant_seq=G;Dbxref=dbSNP_129:rs17908107;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400776.1	dbSNP	SNV	1517	1517	.	+	.	ID=3935;Variant_seq=A;Dbxref=dbSNP_129:rs17908116;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400776.1	dbSNP	SNV	1528	1528	.	+	.	ID=3936;Variant_seq=A;Dbxref=dbSNP_129:rs17908125;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400776.1	dbSNP	SNV	1532	1532	.	+	.	ID=3937;Variant_seq=A;Dbxref=dbSNP_129:rs17908134;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400776.1	dbSNP	SNV	1540	1540	.	+	.	ID=3938;Variant_seq=G;Dbxref=dbSNP_129:rs17908152;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400776.1	dbSNP	SNV	1550	1550	.	+	.	ID=3939;Variant_seq=G;Dbxref=dbSNP_129:rs17908170;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400776.1	dbSNP	SNV	1580	1580	.	+	.	ID=3940;Variant_seq=T;Dbxref=dbSNP_129:rs17908188;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400776.1	dbSNP	SNV	1582	1582	.	+	.	ID=3941;Variant_seq=T;Dbxref=dbSNP_129:rs17908197;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400776.1	dbSNP	SNV	1598	1598	.	+	.	ID=3942;Variant_seq=C;Dbxref=dbSNP_129:rs17908206;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400776.1	dbSNP	SNV	1602	1602	.	+	.	ID=3943;Variant_seq=T;Dbxref=dbSNP_129:rs17908215;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400776.1	dbSNP	SNV	1606	1606	.	+	.	ID=3944;Variant_seq=G;Dbxref=dbSNP_129:rs17908224;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400776.1	dbSNP	SNV	1617	1617	.	+	.	ID=3945;Variant_seq=C;Dbxref=dbSNP_129:rs17908233;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400776.1	dbSNP	SNV	1746	1746	.	+	.	ID=3946;Variant_seq=A;Dbxref=dbSNP_129:rs17908296;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400776.1	dbSNP	SNV	1887	1887	.	+	.	ID=3947;Variant_seq=T;Dbxref=dbSNP_129:rs17908350;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400776.1	dbSNP	SNV	1908	1908	.	+	.	ID=3948;Variant_seq=T;Dbxref=dbSNP_129:rs17908359;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400776.1	dbSNP	SNV	1936	1936	.	+	.	ID=3949;Variant_seq=C;Dbxref=dbSNP_129:rs17908368;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400776.1	dbSNP	SNV	1942	1942	.	+	.	ID=3950;Variant_seq=A;Dbxref=dbSNP_129:rs17908377;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400776.1	dbSNP	SNV	1951	1951	.	+	.	ID=3951;Variant_seq=T;Dbxref=dbSNP_129:rs17908386;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400776.1	dbSNP	SNV	1958	1958	.	+	.	ID=3952;Variant_seq=G;Dbxref=dbSNP_129:rs17908395;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400776.1	dbSNP	SNV	2024	2024	.	+	.	ID=3953;Variant_seq=T;Dbxref=dbSNP_129:rs17908413;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400776.1	dbSNP	SNV	2048	2048	.	+	.	ID=3954;Variant_seq=C;Dbxref=dbSNP_129:rs17908422;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400776.1	dbSNP	SNV	2216	2216	.	+	.	ID=3955;Variant_seq=T;Dbxref=dbSNP_129:rs17908593;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400776.1	dbSNP	SNV	2219	2219	.	+	.	ID=3956;Variant_seq=G;Dbxref=dbSNP_129:rs17908602;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400776.1	dbSNP	SNV	2223	2223	.	+	.	ID=3957;Variant_seq=G;Dbxref=dbSNP_129:rs17908620;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400776.1	dbSNP	SNV	2253	2253	.	+	.	ID=3958;Variant_seq=A;Dbxref=dbSNP_129:rs17908629;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400776.1	dbSNP	SNV	2330	2330	.	+	.	ID=3959;Variant_seq=G;Dbxref=dbSNP_129:rs17908656;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400776.1	dbSNP	SNV	2344	2344	.	+	.	ID=3960;Variant_seq=A;Dbxref=dbSNP_129:rs17908665;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400776.1	dbSNP	SNV	2372	2372	.	+	.	ID=3961;Variant_seq=G;Dbxref=dbSNP_129:rs17908683;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400776.1	dbSNP	SNV	2391	2391	.	+	.	ID=3962;Variant_seq=A;Dbxref=dbSNP_129:rs17908701;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400776.1	dbSNP	SNV	2393	2393	.	+	.	ID=3963;Variant_seq=A;Dbxref=dbSNP_129:rs17908710;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400776.1	dbSNP	SNV	2396	2396	.	+	.	ID=3964;Variant_seq=T;Dbxref=dbSNP_129:rs17908719;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036756.1	dbSNP	insertion	1688	1688	.	+	.	ID=3965;Variant_seq=T;Dbxref=dbSNP_129:rs53280636;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02036756.1	dbSNP	SNV	1713	1713	.	+	.	ID=3966;Variant_seq=T;Dbxref=dbSNP_129:rs53510335;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036756.1	dbSNP	SNV	4844	4844	.	+	.	ID=3967;Variant_seq=A;Dbxref=dbSNP_129:rs53160326;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036756.1	dbSNP	SNV	6904	6904	.	+	.	ID=3968;Variant_seq=G;Dbxref=dbSNP_129:rs18218387;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036756.1	dbSNP	SNV	7437	7437	.	+	.	ID=3969;Variant_seq=T;Dbxref=dbSNP_129:rs20279467;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036756.1	dbSNP	SNV	7442	7442	.	+	.	ID=3970;Variant_seq=G;Dbxref=dbSNP_129:rs20279457;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036756.1	dbSNP	SNV	7445	7445	.	+	.	ID=3971;Variant_seq=A;Dbxref=dbSNP_129:rs20279447;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036756.1	dbSNP	SNV	7448	7448	.	+	.	ID=3972;Variant_seq=C;Dbxref=dbSNP_129:rs20279437;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036756.1	dbSNP	SNV	7493	7493	.	+	.	ID=3973;Variant_seq=C;Dbxref=dbSNP_129:rs20279427;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036756.1	dbSNP	SNV	7911	7911	.	+	.	ID=3974;Variant_seq=C;Dbxref=dbSNP_129:rs20279238;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036756.1	dbSNP	SNV	7924	7924	.	+	.	ID=3975;Variant_seq=T;Dbxref=dbSNP_129:rs20279228;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036756.1	dbSNP	SNV	7941	7941	.	+	.	ID=3976;Variant_seq=T;Dbxref=dbSNP_129:rs20279208;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036756.1	dbSNP	SNV	8073	8073	.	+	.	ID=3977;Variant_seq=A;Dbxref=dbSNP_129:rs20279128;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036756.1	dbSNP	SNV	8241	8241	.	+	.	ID=3978;Variant_seq=T;Dbxref=dbSNP_129:rs20278898;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036756.1	dbSNP	SNV	8511	8511	.	+	.	ID=3979;Variant_seq=A;Dbxref=dbSNP_129:rs20278618;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036756.1	dbSNP	SNV	8518	8518	.	+	.	ID=3980;Variant_seq=C;Dbxref=dbSNP_129:rs20278598;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036756.1	dbSNP	SNV	8556	8556	.	+	.	ID=3981;Variant_seq=C;Dbxref=dbSNP_129:rs20278578;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036756.1	dbSNP	SNV	8560	8560	.	+	.	ID=3982;Variant_seq=G;Dbxref=dbSNP_129:rs20278568;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036756.1	dbSNP	SNV	8562	8562	.	+	.	ID=3983;Variant_seq=T;Dbxref=dbSNP_129:rs20278558;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036756.1	dbSNP	SNV	8654	8654	.	+	.	ID=3984;Variant_seq=A;Dbxref=dbSNP_129:rs20278408;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036756.1	dbSNP	SNV	8656	8656	.	+	.	ID=3985;Variant_seq=C;Dbxref=dbSNP_129:rs20278398;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036756.1	dbSNP	SNV	8668	8668	.	+	.	ID=3986;Variant_seq=G;Dbxref=dbSNP_129:rs20278388;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036756.1	dbSNP	SNV	8669	8669	.	+	.	ID=3987;Variant_seq=A;Dbxref=dbSNP_129:rs20278378;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036756.1	dbSNP	SNV	8681	8681	.	+	.	ID=3988;Variant_seq=G;Dbxref=dbSNP_129:rs20278368;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036756.1	dbSNP	SNV	8704	8704	.	+	.	ID=3989;Variant_seq=C;Dbxref=dbSNP_129:rs20278348;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036756.1	dbSNP	SNV	8727	8727	.	+	.	ID=3990;Variant_seq=A;Dbxref=dbSNP_129:rs19973616;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036756.1	dbSNP	SNV	8798	8798	.	+	.	ID=3991;Variant_seq=A;Dbxref=dbSNP_129:rs20278238;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036756.1	dbSNP	SNV	8804	8804	.	+	.	ID=3992;Variant_seq=A;Dbxref=dbSNP_129:rs20278228;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036756.1	dbSNP	SNV	8806	8806	.	+	.	ID=3993;Variant_seq=C;Dbxref=dbSNP_129:rs20278208;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036756.1	dbSNP	SNV	8807	8807	.	+	.	ID=3994;Variant_seq=C;Dbxref=dbSNP_129:rs20278198;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036756.1	dbSNP	SNV	8809	8809	.	+	.	ID=3995;Variant_seq=C;Dbxref=dbSNP_129:rs20278188;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036756.1	dbSNP	SNV	8810	8810	.	+	.	ID=3996;Variant_seq=G;Dbxref=dbSNP_129:rs20278178;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036756.1	dbSNP	SNV	8813	8813	.	+	.	ID=3997;Variant_seq=G;Dbxref=dbSNP_129:rs20278168;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036756.1	dbSNP	SNV	8818	8818	.	+	.	ID=3998;Variant_seq=A;Dbxref=dbSNP_129:rs20278138;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036756.1	dbSNP	SNV	8819	8819	.	+	.	ID=3999;Variant_seq=T;Dbxref=dbSNP_129:rs20278128;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036756.1	dbSNP	SNV	8824	8824	.	+	.	ID=4000;Variant_seq=A;Dbxref=dbSNP_129:rs20278118;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036756.1	dbSNP	SNV	8825	8825	.	+	.	ID=4001;Variant_seq=A;Dbxref=dbSNP_129:rs20278108;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036756.1	dbSNP	SNV	8826	8826	.	+	.	ID=4002;Variant_seq=A;Dbxref=dbSNP_129:rs20278098;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036756.1	dbSNP	SNV	8832	8832	.	+	.	ID=4003;Variant_seq=G;Dbxref=dbSNP_129:rs20278088;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036756.1	dbSNP	SNV	8837	8837	.	+	.	ID=4004;Variant_seq=T;Dbxref=dbSNP_129:rs20278078;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036756.1	dbSNP	SNV	8844	8844	.	+	.	ID=4005;Variant_seq=C;Dbxref=dbSNP_129:rs20278068;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036756.1	dbSNP	SNV	8846	8846	.	+	.	ID=4006;Variant_seq=G;Dbxref=dbSNP_129:rs20278058;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036756.1	dbSNP	SNV	14172	14172	.	+	.	ID=4007;Variant_seq=G;Dbxref=dbSNP_129:rs53162483;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036756.1	dbSNP	SNV	14181	14181	.	+	.	ID=4008;Variant_seq=A;Dbxref=dbSNP_129:rs53923100;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036756.1	dbSNP	SNV	14182	14182	.	+	.	ID=4009;Variant_seq=A;Dbxref=dbSNP_129:rs54141628;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036756.1	dbSNP	deletion	14187	14187	.	+	.	ID=4010;Variant_seq=-;Dbxref=dbSNP_129:rs53791029;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036756.1	dbSNP	SNV	14191	14191	.	+	.	ID=4011;Variant_seq=A;Dbxref=dbSNP_129:rs53767139;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048244.1	dbSNP	SNV	1415	1415	.	+	.	ID=4012;Variant_seq=C;Dbxref=dbSNP_129:rs19121093;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399434.1	dbSNP	SNV	4335	4335	.	+	.	ID=4013;Variant_seq=A;Dbxref=dbSNP_129:rs20170258;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399434.1	dbSNP	SNV	4359	4359	.	+	.	ID=4014;Variant_seq=C;Dbxref=dbSNP_129:rs20170278;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399434.1	dbSNP	SNV	4403	4403	.	+	.	ID=4015;Variant_seq=T;Dbxref=dbSNP_129:rs20170298;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046447.1	dbSNP	deletion	306	306	.	+	.	ID=4016;Variant_seq=-;Dbxref=dbSNP_129:rs53425711;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046447.1	dbSNP	SNV	324	324	.	+	.	ID=4017;Variant_seq=A;Dbxref=dbSNP_129:rs53349243;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046447.1	dbSNP	SNV	344	344	.	+	.	ID=4018;Variant_seq=G;Dbxref=dbSNP_129:rs54378651;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046447.1	dbSNP	SNV	1449	1449	.	+	.	ID=4019;Variant_seq=A;Dbxref=dbSNP_129:rs53516600;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046447.1	dbSNP	SNV	1453	1453	.	+	.	ID=4020;Variant_seq=T;Dbxref=dbSNP_129:rs54309450;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046447.1	dbSNP	SNV	1455	1455	.	+	.	ID=4021;Variant_seq=T;Dbxref=dbSNP_129:rs53873288;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046447.1	dbSNP	SNV	1460	1460	.	+	.	ID=4022;Variant_seq=T;Dbxref=dbSNP_129:rs53778054;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046447.1	dbSNP	SNV	1463	1463	.	+	.	ID=4023;Variant_seq=A;Dbxref=dbSNP_129:rs52877920;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046447.1	dbSNP	SNV	2278	2278	.	+	.	ID=4024;Variant_seq=C;Dbxref=dbSNP_129:rs18894852;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046447.1	dbSNP	SNV	2290	2290	.	+	.	ID=4025;Variant_seq=A;Dbxref=dbSNP_129:rs18894804;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046447.1	dbSNP	SNV	2456	2456	.	+	.	ID=4026;Variant_seq=G;Dbxref=dbSNP_129:rs52994626;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043626.1	dbSNP	SNV	1267	1267	.	+	.	ID=4027;Variant_seq=G;Dbxref=dbSNP_129:rs53110152;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043626.1	dbSNP	SNV	1313	1313	.	+	.	ID=4028;Variant_seq=T;Dbxref=dbSNP_129:rs53740198;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043626.1	dbSNP	SNV	1358	1358	.	+	.	ID=4029;Variant_seq=C;Dbxref=dbSNP_129:rs53158018;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043626.1	dbSNP	SNV	1372	1372	.	+	.	ID=4030;Variant_seq=A;Dbxref=dbSNP_129:rs53189373;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043626.1	dbSNP	SNV	1503	1503	.	+	.	ID=4031;Variant_seq=C;Dbxref=dbSNP_129:rs53830603;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043626.1	dbSNP	SNV	1509	1509	.	+	.	ID=4032;Variant_seq=T;Dbxref=dbSNP_129:rs53979180;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043626.1	dbSNP	SNV	1510	1510	.	+	.	ID=4033;Variant_seq=T;Dbxref=dbSNP_129:rs53383465;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043626.1	dbSNP	SNV	1585	1585	.	+	.	ID=4034;Variant_seq=A;Dbxref=dbSNP_129:rs52866272;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043626.1	dbSNP	SNV	1586	1586	.	+	.	ID=4035;Variant_seq=G;Dbxref=dbSNP_129:rs53227016;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043626.1	dbSNP	SNV	1587	1587	.	+	.	ID=4036;Variant_seq=C;Dbxref=dbSNP_129:rs54143087;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043626.1	dbSNP	SNV	1590	1590	.	+	.	ID=4037;Variant_seq=A,T;Dbxref=dbSNP_129:rs52923478;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043626.1	dbSNP	SNV	1595	1595	.	+	.	ID=4038;Variant_seq=G;Dbxref=dbSNP_129:rs53315050;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043626.1	dbSNP	SNV	1611	1611	.	+	.	ID=4039;Variant_seq=C;Dbxref=dbSNP_129:rs54194198;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043626.1	dbSNP	SNV	1638	1638	.	+	.	ID=4040;Variant_seq=T;Dbxref=dbSNP_129:rs53654832;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035845.1	dbSNP	SNV	87	87	.	+	.	ID=4041;Variant_seq=C;Dbxref=dbSNP_129:rs21230059;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02035845.1	dbSNP	SNV	104	104	.	+	.	ID=4042;Variant_seq=G;Dbxref=dbSNP_129:rs21230049;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02035845.1	dbSNP	SNV	443	443	.	+	.	ID=4043;Variant_seq=G;Dbxref=dbSNP_129:rs21229959;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02035845.1	dbSNP	SNV	478	478	.	+	.	ID=4044;Variant_seq=G;Dbxref=dbSNP_129:rs21229919;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02035845.1	dbSNP	SNV	521	521	.	+	.	ID=4045;Variant_seq=A;Dbxref=dbSNP_129:rs21229859;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02035845.1	dbSNP	SNV	953	953	.	+	.	ID=4046;Variant_seq=C;Dbxref=dbSNP_129:rs21229569;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02035845.1	dbSNP	SNV	968	968	.	+	.	ID=4047;Variant_seq=G;Dbxref=dbSNP_129:rs21633661;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02035845.1	dbSNP	SNV	1122	1122	.	+	.	ID=4048;Variant_seq=T;Dbxref=dbSNP_129:rs17896867;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035845.1	dbSNP	SNV	1372	1372	.	+	.	ID=4049;Variant_seq=A;Dbxref=dbSNP_129:rs21633571;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02035845.1	dbSNP	SNV	5697	5697	.	+	.	ID=4050;Variant_seq=C;Dbxref=dbSNP_129:rs21237547;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02035845.1	dbSNP	SNV	5698	5698	.	+	.	ID=4051;Variant_seq=T;Dbxref=dbSNP_129:rs21237537;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035845.1	dbSNP	SNV	5742	5742	.	+	.	ID=4052;Variant_seq=T;Dbxref=dbSNP_129:rs21237507;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035845.1	dbSNP	SNV	5761	5761	.	+	.	ID=4053;Variant_seq=T;Dbxref=dbSNP_129:rs21237497;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035845.1	dbSNP	SNV	5769	5769	.	+	.	ID=4054;Variant_seq=C;Dbxref=dbSNP_129:rs21237487;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02035845.1	dbSNP	SNV	5811	5811	.	+	.	ID=4055;Variant_seq=C;Dbxref=dbSNP_129:rs21237477;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02035845.1	dbSNP	SNV	5832	5832	.	+	.	ID=4056;Variant_seq=T;Dbxref=dbSNP_129:rs21237467;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035845.1	dbSNP	SNV	5963	5963	.	+	.	ID=4057;Variant_seq=C;Dbxref=dbSNP_129:rs21237417;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02035845.1	dbSNP	SNV	5965	5965	.	+	.	ID=4058;Variant_seq=T;Dbxref=dbSNP_129:rs21237407;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035845.1	dbSNP	SNV	5972	5972	.	+	.	ID=4059;Variant_seq=T;Dbxref=dbSNP_129:rs21237397;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035845.1	dbSNP	SNV	9898	9898	.	+	.	ID=4060;Variant_seq=G;Dbxref=dbSNP_129:rs18444384;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02035845.1	dbSNP	SNV	9949	9949	.	+	.	ID=4061;Variant_seq=A;Dbxref=dbSNP_129:rs18062547;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035845.1	dbSNP	SNV	10048	10048	.	+	.	ID=4062;Variant_seq=T;Dbxref=dbSNP_129:rs20426522;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035845.1	dbSNP	SNV	10169	10169	.	+	.	ID=4063;Variant_seq=G;Dbxref=dbSNP_129:rs20156795;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02035845.1	dbSNP	SNV	10707	10707	.	+	.	ID=4064;Variant_seq=T;Dbxref=dbSNP_129:rs21256029;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035845.1	dbSNP	SNV	11044	11044	.	+	.	ID=4065;Variant_seq=A;Dbxref=dbSNP_129:rs21229479;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035845.1	dbSNP	SNV	11051	11051	.	+	.	ID=4066;Variant_seq=T;Dbxref=dbSNP_129:rs21229469;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02035845.1	dbSNP	SNV	11053	11053	.	+	.	ID=4067;Variant_seq=A;Dbxref=dbSNP_129:rs21229459;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398594.1	dbSNP	SNV	12788	12788	.	+	.	ID=4068;Variant_seq=T;Dbxref=dbSNP_129:rs53126575;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046449.1	dbSNP	SNV	1208	1208	.	+	.	ID=4069;Variant_seq=T;Dbxref=dbSNP_129:rs53081442;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048310.1	dbSNP	SNV	1421	1421	.	+	.	ID=4070;Variant_seq=G;Dbxref=dbSNP_129:rs19810003;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048310.1	dbSNP	SNV	1426	1426	.	+	.	ID=4071;Variant_seq=C;Dbxref=dbSNP_129:rs19810013;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048310.1	dbSNP	SNV	1429	1429	.	+	.	ID=4072;Variant_seq=C;Dbxref=dbSNP_129:rs19810023;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048310.1	dbSNP	SNV	1430	1430	.	+	.	ID=4073;Variant_seq=A;Dbxref=dbSNP_129:rs19810033;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040581.1	dbSNP	SNV	752	752	.	+	.	ID=4074;Variant_seq=C;Dbxref=dbSNP_129:rs54299526;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02040581.1	dbSNP	SNV	3531	3531	.	+	.	ID=4075;Variant_seq=T;Dbxref=dbSNP_129:rs53541661;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040581.1	dbSNP	SNV	3548	3548	.	+	.	ID=4076;Variant_seq=A;Dbxref=dbSNP_129:rs52954158;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047203.1	dbSNP	SNV	234	234	.	+	.	ID=4077;Variant_seq=T;Dbxref=dbSNP_129:rs53398151;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047203.1	dbSNP	SNV	239	239	.	+	.	ID=4078;Variant_seq=C;Dbxref=dbSNP_129:rs53198403;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047203.1	dbSNP	SNV	244	244	.	+	.	ID=4079;Variant_seq=C;Dbxref=dbSNP_129:rs54134953;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047203.1	dbSNP	SNV	245	245	.	+	.	ID=4080;Variant_seq=C;Dbxref=dbSNP_129:rs54123730;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047203.1	dbSNP	SNV	254	254	.	+	.	ID=4081;Variant_seq=C;Dbxref=dbSNP_129:rs53950664;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047203.1	dbSNP	SNV	255	255	.	+	.	ID=4082;Variant_seq=T;Dbxref=dbSNP_129:rs53012738;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047203.1	dbSNP	SNV	268	268	.	+	.	ID=4083;Variant_seq=G;Dbxref=dbSNP_129:rs53252817;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047203.1	dbSNP	SNV	269	269	.	+	.	ID=4084;Variant_seq=G;Dbxref=dbSNP_129:rs53771708;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047203.1	dbSNP	SNV	270	270	.	+	.	ID=4085;Variant_seq=G;Dbxref=dbSNP_129:rs53474849;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047203.1	dbSNP	SNV	292	292	.	+	.	ID=4086;Variant_seq=A;Dbxref=dbSNP_129:rs53978623;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047203.1	dbSNP	SNV	304	304	.	+	.	ID=4087;Variant_seq=C;Dbxref=dbSNP_129:rs53996322;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047203.1	dbSNP	SNV	330	330	.	+	.	ID=4088;Variant_seq=A;Dbxref=dbSNP_129:rs53334838;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047203.1	dbSNP	SNV	339	339	.	+	.	ID=4089;Variant_seq=A;Dbxref=dbSNP_129:rs53230774;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047203.1	dbSNP	SNV	347	347	.	+	.	ID=4090;Variant_seq=A;Dbxref=dbSNP_129:rs53096130;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047203.1	dbSNP	deletion	353	353	.	+	.	ID=4091;Variant_seq=-;Dbxref=dbSNP_129:rs54394226;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047203.1	dbSNP	SNV	354	354	.	+	.	ID=4092;Variant_seq=T;Dbxref=dbSNP_129:rs54211606;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047203.1	dbSNP	SNV	356	356	.	+	.	ID=4093;Variant_seq=C;Dbxref=dbSNP_129:rs53197542;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047203.1	dbSNP	SNV	365	365	.	+	.	ID=4094;Variant_seq=G;Dbxref=dbSNP_129:rs53185340;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047203.1	dbSNP	SNV	368	368	.	+	.	ID=4095;Variant_seq=T;Dbxref=dbSNP_129:rs54306714;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047203.1	dbSNP	SNV	410	410	.	+	.	ID=4096;Variant_seq=G;Dbxref=dbSNP_129:rs53341688;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047203.1	dbSNP	SNV	413	413	.	+	.	ID=4097;Variant_seq=G;Dbxref=dbSNP_129:rs53527250;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047203.1	dbSNP	SNV	415	415	.	+	.	ID=4098;Variant_seq=T;Dbxref=dbSNP_129:rs53841125;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047203.1	dbSNP	SNV	429	429	.	+	.	ID=4099;Variant_seq=C;Dbxref=dbSNP_129:rs54022937;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047203.1	dbSNP	SNV	636	636	.	+	.	ID=4100;Variant_seq=G;Dbxref=dbSNP_129:rs54197339;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047203.1	dbSNP	SNV	646	646	.	+	.	ID=4101;Variant_seq=T;Dbxref=dbSNP_129:rs54276790;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047203.1	dbSNP	SNV	648	648	.	+	.	ID=4102;Variant_seq=C;Dbxref=dbSNP_129:rs53672018;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047203.1	dbSNP	SNV	649	649	.	+	.	ID=4103;Variant_seq=C;Dbxref=dbSNP_129:rs53446823;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047203.1	dbSNP	SNV	654	654	.	+	.	ID=4104;Variant_seq=A;Dbxref=dbSNP_129:rs53589065;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047203.1	dbSNP	SNV	657	657	.	+	.	ID=4105;Variant_seq=G;Dbxref=dbSNP_129:rs53986741;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047203.1	dbSNP	SNV	666	666	.	+	.	ID=4106;Variant_seq=C;Dbxref=dbSNP_129:rs54284582;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047203.1	dbSNP	SNV	705	705	.	+	.	ID=4107;Variant_seq=T;Dbxref=dbSNP_129:rs53217559;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047203.1	dbSNP	SNV	705	705	.	+	.	ID=4108;Variant_seq=A;Dbxref=dbSNP_129:rs52932986;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047203.1	dbSNP	insertion	706	706	.	+	.	ID=4109;Variant_seq=C;Dbxref=dbSNP_129:rs53345991;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02047203.1	dbSNP	SNV	707	707	.	+	.	ID=4110;Variant_seq=G;Dbxref=dbSNP_129:rs54064833;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047203.1	dbSNP	deletion	710	711	.	+	.	ID=4111;Variant_seq=-;Dbxref=dbSNP_129:rs53887233;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=CA
AAAA02047203.1	dbSNP	SNV	716	716	.	+	.	ID=4112;Variant_seq=A;Dbxref=dbSNP_129:rs54165197;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047203.1	dbSNP	deletion	717	717	.	+	.	ID=4113;Variant_seq=-;Dbxref=dbSNP_129:rs53784723;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047203.1	dbSNP	SNV	724	724	.	+	.	ID=4114;Variant_seq=C;Dbxref=dbSNP_129:rs54275321;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047203.1	dbSNP	SNV	725	725	.	+	.	ID=4115;Variant_seq=T;Dbxref=dbSNP_129:rs53469619;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047203.1	dbSNP	SNV	727	727	.	+	.	ID=4116;Variant_seq=C;Dbxref=dbSNP_129:rs53238141;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047203.1	dbSNP	SNV	735	735	.	+	.	ID=4117;Variant_seq=G;Dbxref=dbSNP_129:rs52952412;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047203.1	dbSNP	SNV	738	738	.	+	.	ID=4118;Variant_seq=G;Dbxref=dbSNP_129:rs54368080;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047203.1	dbSNP	SNV	747	747	.	+	.	ID=4119;Variant_seq=G;Dbxref=dbSNP_129:rs52985407;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047203.1	dbSNP	SNV	753	753	.	+	.	ID=4120;Variant_seq=C;Dbxref=dbSNP_129:rs53052035;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047203.1	dbSNP	SNV	1686	1686	.	+	.	ID=4121;Variant_seq=G;Dbxref=dbSNP_129:rs54108164;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038387.1	dbSNP	SNV	1072	1072	.	+	.	ID=4122;Variant_seq=A;Dbxref=dbSNP_129:rs53595606;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038387.1	dbSNP	SNV	1073	1073	.	+	.	ID=4123;Variant_seq=C;Dbxref=dbSNP_129:rs52893306;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038387.1	dbSNP	SNV	1077	1077	.	+	.	ID=4124;Variant_seq=C;Dbxref=dbSNP_129:rs54276096;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038387.1	dbSNP	SNV	2434	2434	.	+	.	ID=4125;Variant_seq=G;Dbxref=dbSNP_129:rs54381920;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038387.1	dbSNP	SNV	2440	2440	.	+	.	ID=4126;Variant_seq=T;Dbxref=dbSNP_129:rs53698349;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038387.1	dbSNP	SNV	2450	2450	.	+	.	ID=4127;Variant_seq=T;Dbxref=dbSNP_129:rs54260610;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038387.1	dbSNP	SNV	2454	2454	.	+	.	ID=4128;Variant_seq=G;Dbxref=dbSNP_129:rs52889775;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038387.1	dbSNP	SNV	2460	2460	.	+	.	ID=4129;Variant_seq=T;Dbxref=dbSNP_129:rs52943512;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038387.1	dbSNP	SNV	2491	2491	.	+	.	ID=4130;Variant_seq=T;Dbxref=dbSNP_129:rs54020248;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038387.1	dbSNP	SNV	2493	2493	.	+	.	ID=4131;Variant_seq=G;Dbxref=dbSNP_129:rs54271014;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038387.1	dbSNP	SNV	2518	2518	.	+	.	ID=4132;Variant_seq=A;Dbxref=dbSNP_129:rs53958632;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038387.1	dbSNP	SNV	2526	2526	.	+	.	ID=4133;Variant_seq=A;Dbxref=dbSNP_129:rs53595606;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038387.1	dbSNP	SNV	2527	2527	.	+	.	ID=4134;Variant_seq=C;Dbxref=dbSNP_129:rs52893306;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038387.1	dbSNP	SNV	2531	2531	.	+	.	ID=4135;Variant_seq=C;Dbxref=dbSNP_129:rs54276096;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038387.1	dbSNP	SNV	5318	5318	.	+	.	ID=4136;Variant_seq=G;Dbxref=dbSNP_129:rs54381920;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038387.1	dbSNP	SNV	5324	5324	.	+	.	ID=4137;Variant_seq=T;Dbxref=dbSNP_129:rs53698349;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038387.1	dbSNP	SNV	5334	5334	.	+	.	ID=4138;Variant_seq=T;Dbxref=dbSNP_129:rs54260610;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038387.1	dbSNP	SNV	5338	5338	.	+	.	ID=4139;Variant_seq=G;Dbxref=dbSNP_129:rs52889775;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038387.1	dbSNP	SNV	5344	5344	.	+	.	ID=4140;Variant_seq=T;Dbxref=dbSNP_129:rs52943512;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038387.1	dbSNP	SNV	5375	5375	.	+	.	ID=4141;Variant_seq=T;Dbxref=dbSNP_129:rs54020248;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02038387.1	dbSNP	SNV	5377	5377	.	+	.	ID=4142;Variant_seq=G;Dbxref=dbSNP_129:rs54271014;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038387.1	dbSNP	SNV	7360	7360	.	+	.	ID=4143;Variant_seq=C;Dbxref=dbSNP_129:rs53272881;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038387.1	dbSNP	SNV	7419	7419	.	+	.	ID=4144;Variant_seq=C;Dbxref=dbSNP_129:rs53561971;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038387.1	dbSNP	SNV	7422	7422	.	+	.	ID=4145;Variant_seq=G;Dbxref=dbSNP_129:rs53222150;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038387.1	dbSNP	SNV	7444	7444	.	+	.	ID=4146;Variant_seq=G;Dbxref=dbSNP_129:rs53805007;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02038387.1	dbSNP	SNV	7467	7467	.	+	.	ID=4147;Variant_seq=T;Dbxref=dbSNP_129:rs19803594;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038387.1	dbSNP	SNV	7523	7523	.	+	.	ID=4148;Variant_seq=A;Dbxref=dbSNP_129:rs53958632;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041594.1	dbSNP	SNV	384	384	.	+	.	ID=4149;Variant_seq=C;Dbxref=dbSNP_129:rs21527968;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041594.1	dbSNP	SNV	397	397	.	+	.	ID=4150;Variant_seq=C;Dbxref=dbSNP_129:rs21527948;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041594.1	dbSNP	SNV	416	416	.	+	.	ID=4151;Variant_seq=A;Dbxref=dbSNP_129:rs21527878;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041594.1	dbSNP	SNV	417	417	.	+	.	ID=4152;Variant_seq=G;Dbxref=dbSNP_129:rs21527868;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043478.1	dbSNP	SNV	1115	1115	.	+	.	ID=4153;Variant_seq=C;Dbxref=dbSNP_129:rs53461651;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043478.1	dbSNP	SNV	1116	1116	.	+	.	ID=4154;Variant_seq=T;Dbxref=dbSNP_129:rs52855115;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046257.1	dbSNP	SNV	137	137	.	+	.	ID=4155;Variant_seq=C;Dbxref=dbSNP_129:rs53162561;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046257.1	dbSNP	SNV	157	157	.	+	.	ID=4156;Variant_seq=T;Dbxref=dbSNP_129:rs53784209;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046257.1	dbSNP	SNV	167	167	.	+	.	ID=4157;Variant_seq=G;Dbxref=dbSNP_129:rs53413996;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046257.1	dbSNP	SNV	170	170	.	+	.	ID=4158;Variant_seq=T;Dbxref=dbSNP_129:rs52944429;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046257.1	dbSNP	SNV	171	171	.	+	.	ID=4159;Variant_seq=G;Dbxref=dbSNP_129:rs54367446;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046257.1	dbSNP	SNV	175	175	.	+	.	ID=4160;Variant_seq=T;Dbxref=dbSNP_129:rs21626283;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046257.1	dbSNP	SNV	176	176	.	+	.	ID=4161;Variant_seq=A;Dbxref=dbSNP_129:rs53624440;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046257.1	dbSNP	SNV	178	178	.	+	.	ID=4162;Variant_seq=G;Dbxref=dbSNP_129:rs53572077;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046257.1	dbSNP	SNV	187	187	.	+	.	ID=4163;Variant_seq=G;Dbxref=dbSNP_129:rs53172532;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046257.1	dbSNP	SNV	189	189	.	+	.	ID=4164;Variant_seq=A;Dbxref=dbSNP_129:rs53261207;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046257.1	dbSNP	SNV	214	214	.	+	.	ID=4165;Variant_seq=A;Dbxref=dbSNP_129:rs53113594;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046257.1	dbSNP	SNV	220	220	.	+	.	ID=4166;Variant_seq=G;Dbxref=dbSNP_129:rs52977763;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046257.1	dbSNP	insertion	232	232	.	+	.	ID=4167;Variant_seq=TT;Dbxref=dbSNP_129:rs53291148;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02046257.1	dbSNP	insertion	238	238	.	+	.	ID=4168;Variant_seq=G;Dbxref=dbSNP_129:rs53118267;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02046257.1	dbSNP	SNV	247	247	.	+	.	ID=4169;Variant_seq=C;Dbxref=dbSNP_129:rs54408727;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046257.1	dbSNP	SNV	248	248	.	+	.	ID=4170;Variant_seq=T;Dbxref=dbSNP_129:rs53962068;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046257.1	dbSNP	SNV	259	259	.	+	.	ID=4171;Variant_seq=G;Dbxref=dbSNP_129:rs53398917;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046257.1	dbSNP	SNV	265	265	.	+	.	ID=4172;Variant_seq=T;Dbxref=dbSNP_129:rs53286897;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046257.1	dbSNP	SNV	266	266	.	+	.	ID=4173;Variant_seq=G;Dbxref=dbSNP_129:rs53822372;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046257.1	dbSNP	SNV	273	273	.	+	.	ID=4174;Variant_seq=G;Dbxref=dbSNP_129:rs54007560;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046257.1	dbSNP	SNV	278	278	.	+	.	ID=4175;Variant_seq=A;Dbxref=dbSNP_129:rs53250335;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046257.1	dbSNP	SNV	285	285	.	+	.	ID=4176;Variant_seq=T;Dbxref=dbSNP_129:rs53528464;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046257.1	dbSNP	SNV	288	288	.	+	.	ID=4177;Variant_seq=C;Dbxref=dbSNP_129:rs54138386;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046257.1	dbSNP	SNV	293	293	.	+	.	ID=4178;Variant_seq=A;Dbxref=dbSNP_129:rs54246589;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046257.1	dbSNP	deletion	313	314	.	+	.	ID=4179;Variant_seq=-;Dbxref=dbSNP_129:rs54044907;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=TA
AAAA02046257.1	dbSNP	SNV	318	318	.	+	.	ID=4180;Variant_seq=A;Dbxref=dbSNP_129:rs54391030;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046257.1	dbSNP	SNV	320	320	.	+	.	ID=4181;Variant_seq=T;Dbxref=dbSNP_129:rs53113674;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046257.1	dbSNP	SNV	321	321	.	+	.	ID=4182;Variant_seq=T;Dbxref=dbSNP_129:rs21626274;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046257.1	dbSNP	SNV	342	342	.	+	.	ID=4183;Variant_seq=T;Dbxref=dbSNP_129:rs53493720;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046257.1	dbSNP	SNV	351	351	.	+	.	ID=4184;Variant_seq=A;Dbxref=dbSNP_129:rs53410219;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046257.1	dbSNP	SNV	354	354	.	+	.	ID=4185;Variant_seq=C;Dbxref=dbSNP_129:rs53866285;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046257.1	dbSNP	SNV	363	363	.	+	.	ID=4186;Variant_seq=C;Dbxref=dbSNP_129:rs53795745;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046257.1	dbSNP	SNV	376	376	.	+	.	ID=4187;Variant_seq=C;Dbxref=dbSNP_129:rs53247161;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046257.1	dbSNP	SNV	400	400	.	+	.	ID=4188;Variant_seq=C;Dbxref=dbSNP_129:rs53381110;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046257.1	dbSNP	SNV	403	403	.	+	.	ID=4189;Variant_seq=C;Dbxref=dbSNP_129:rs53544164;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046257.1	dbSNP	SNV	405	405	.	+	.	ID=4190;Variant_seq=A;Dbxref=dbSNP_129:rs54037452;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046257.1	dbSNP	SNV	410	410	.	+	.	ID=4191;Variant_seq=G;Dbxref=dbSNP_129:rs21626265;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046257.1	dbSNP	SNV	411	411	.	+	.	ID=4192;Variant_seq=A;Dbxref=dbSNP_129:rs53626321;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046257.1	dbSNP	SNV	428	428	.	+	.	ID=4193;Variant_seq=T;Dbxref=dbSNP_129:rs53866315;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046257.1	dbSNP	SNV	437	437	.	+	.	ID=4194;Variant_seq=A;Dbxref=dbSNP_129:rs54144739;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046257.1	dbSNP	SNV	444	444	.	+	.	ID=4195;Variant_seq=C;Dbxref=dbSNP_129:rs53072757;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046257.1	dbSNP	SNV	454	454	.	+	.	ID=4196;Variant_seq=A;Dbxref=dbSNP_129:rs53233985;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046257.1	dbSNP	SNV	472	472	.	+	.	ID=4197;Variant_seq=C;Dbxref=dbSNP_129:rs53115692;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046257.1	dbSNP	SNV	477	477	.	+	.	ID=4198;Variant_seq=T;Dbxref=dbSNP_129:rs52936272;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046257.1	dbSNP	SNV	489	489	.	+	.	ID=4199;Variant_seq=G;Dbxref=dbSNP_129:rs52842739;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046257.1	dbSNP	SNV	490	490	.	+	.	ID=4200;Variant_seq=A;Dbxref=dbSNP_129:rs53932969;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046257.1	dbSNP	SNV	491	491	.	+	.	ID=4201;Variant_seq=C;Dbxref=dbSNP_129:rs21626256;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046257.1	dbSNP	SNV	500	500	.	+	.	ID=4202;Variant_seq=T;Dbxref=dbSNP_129:rs54325438;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046257.1	dbSNP	SNV	523	523	.	+	.	ID=4203;Variant_seq=A;Dbxref=dbSNP_129:rs52890157;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046257.1	dbSNP	SNV	526	526	.	+	.	ID=4204;Variant_seq=C;Dbxref=dbSNP_129:rs21626247;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046257.1	dbSNP	SNV	573	573	.	+	.	ID=4205;Variant_seq=T;Dbxref=dbSNP_129:rs54123281;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046257.1	dbSNP	SNV	823	823	.	+	.	ID=4206;Variant_seq=C;Dbxref=dbSNP_129:rs21626229;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046257.1	dbSNP	SNV	955	955	.	+	.	ID=4207;Variant_seq=A;Dbxref=dbSNP_129:rs54317255;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046257.1	dbSNP	SNV	1119	1119	.	+	.	ID=4208;Variant_seq=C;Dbxref=dbSNP_129:rs21626220;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046257.1	dbSNP	deletion	1126	1126	.	+	.	ID=4209;Variant_seq=-;Dbxref=dbSNP_129:rs53626687;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398386.1	dbSNP	SNV	1014	1014	.	+	.	ID=4210;Variant_seq=T;Dbxref=dbSNP_129:rs52997351;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398386.1	dbSNP	SNV	8340	8340	.	+	.	ID=4211;Variant_seq=T;Dbxref=dbSNP_129:rs20062767;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398386.1	dbSNP	SNV	8342	8342	.	+	.	ID=4212;Variant_seq=G;Dbxref=dbSNP_129:rs20062757;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398386.1	dbSNP	SNV	20050	20050	.	+	.	ID=4213;Variant_seq=G;Dbxref=dbSNP_129:rs20425863;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399818.1	dbSNP	SNV	3929	3929	.	+	.	ID=4214;Variant_seq=A;Dbxref=dbSNP_129:rs20336064;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044276.1	dbSNP	SNV	1729	1729	.	+	.	ID=4215;Variant_seq=C;Dbxref=dbSNP_129:rs20221056;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044276.1	dbSNP	SNV	1748	1748	.	+	.	ID=4216;Variant_seq=T;Dbxref=dbSNP_129:rs20221106;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044276.1	dbSNP	SNV	1753	1753	.	+	.	ID=4217;Variant_seq=G;Dbxref=dbSNP_129:rs20221126;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044276.1	dbSNP	SNV	1757	1757	.	+	.	ID=4218;Variant_seq=C;Dbxref=dbSNP_129:rs20221136;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044276.1	dbSNP	SNV	1765	1765	.	+	.	ID=4219;Variant_seq=A;Dbxref=dbSNP_129:rs20221176;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044276.1	dbSNP	SNV	1766	1766	.	+	.	ID=4220;Variant_seq=G;Dbxref=dbSNP_129:rs20221186;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044276.1	dbSNP	SNV	1788	1788	.	+	.	ID=4221;Variant_seq=C;Dbxref=dbSNP_129:rs20221226;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044276.1	dbSNP	SNV	1814	1814	.	+	.	ID=4222;Variant_seq=A;Dbxref=dbSNP_129:rs20221236;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044276.1	dbSNP	SNV	1815	1815	.	+	.	ID=4223;Variant_seq=T;Dbxref=dbSNP_129:rs20221246;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044276.1	dbSNP	SNV	1816	1816	.	+	.	ID=4224;Variant_seq=G;Dbxref=dbSNP_129:rs20221256;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044276.1	dbSNP	SNV	3029	3029	.	+	.	ID=4225;Variant_seq=T;Dbxref=dbSNP_129:rs53860626;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044276.1	dbSNP	SNV	3070	3070	.	+	.	ID=4226;Variant_seq=T;Dbxref=dbSNP_129:rs54371272;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047079.1	dbSNP	SNV	958	958	.	+	.	ID=4227;Variant_seq=C;Dbxref=dbSNP_129:rs54297065;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047079.1	dbSNP	SNV	2391	2391	.	+	.	ID=4228;Variant_seq=T;Dbxref=dbSNP_129:rs53182982;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047079.1	dbSNP	SNV	2396	2396	.	+	.	ID=4229;Variant_seq=G;Dbxref=dbSNP_129:rs53685714;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02047079.1	dbSNP	SNV	2405	2405	.	+	.	ID=4230;Variant_seq=A;Dbxref=dbSNP_129:rs54037696;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02042533.1	dbSNP	SNV	1338	1338	.	+	.	ID=4231;Variant_seq=A;Dbxref=dbSNP_129:rs54099172;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042533.1	dbSNP	SNV	2336	2336	.	+	.	ID=4232;Variant_seq=C;Dbxref=dbSNP_129:rs21399289;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042533.1	dbSNP	SNV	2337	2337	.	+	.	ID=4233;Variant_seq=A;Dbxref=dbSNP_129:rs21399299;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040897.1	dbSNP	SNV	1508	1508	.	+	.	ID=4234;Variant_seq=A;Dbxref=dbSNP_129:rs54360170;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399053.1	dbSNP	SNV	1028	1028	.	+	.	ID=4235;Variant_seq=A;Dbxref=dbSNP_129:rs19274881;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399053.1	dbSNP	SNV	4208	4208	.	+	.	ID=4236;Variant_seq=G;Dbxref=dbSNP_129:rs53341005;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399053.1	dbSNP	SNV	4233	4233	.	+	.	ID=4237;Variant_seq=C;Dbxref=dbSNP_129:rs53666369;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399053.1	dbSNP	SNV	4307	4307	.	+	.	ID=4238;Variant_seq=G;Dbxref=dbSNP_129:rs53487113;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399053.1	dbSNP	SNV	4477	4477	.	+	.	ID=4239;Variant_seq=T;Dbxref=dbSNP_129:rs19177212;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399053.1	dbSNP	SNV	5333	5333	.	+	.	ID=4240;Variant_seq=A;Dbxref=dbSNP_129:rs53400626;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399053.1	dbSNP	SNV	5352	5352	.	+	.	ID=4241;Variant_seq=T;Dbxref=dbSNP_129:rs53416615;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398278.1	dbSNP	SNV	20625	20625	.	+	.	ID=4242;Variant_seq=A;Dbxref=dbSNP_129:rs52952383;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398278.1	dbSNP	deletion	20626	20626	.	+	.	ID=4243;Variant_seq=-;Dbxref=dbSNP_129:rs54352056;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398278.1	dbSNP	deletion	20631	20632	.	+	.	ID=4244;Variant_seq=-;Dbxref=dbSNP_129:rs53319637;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=AG
CH398278.1	dbSNP	deletion	20638	20639	.	+	.	ID=4245;Variant_seq=-;Dbxref=dbSNP_129:rs54302641;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=TG
CH398278.1	dbSNP	deletion	20643	20643	.	+	.	ID=4246;Variant_seq=-;Dbxref=dbSNP_129:rs53391510;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398278.1	dbSNP	SNV	20646	20646	.	+	.	ID=4247;Variant_seq=C;Dbxref=dbSNP_129:rs53571701;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398278.1	dbSNP	SNV	20649	20649	.	+	.	ID=4248;Variant_seq=A;Dbxref=dbSNP_129:rs53146737;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398278.1	dbSNP	SNV	20956	20956	.	+	.	ID=4249;Variant_seq=A;Dbxref=dbSNP_129:rs54305597;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398278.1	dbSNP	SNV	21058	21058	.	+	.	ID=4250;Variant_seq=G;Dbxref=dbSNP_129:rs53188077;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398278.1	dbSNP	SNV	21958	21958	.	+	.	ID=4251;Variant_seq=C;Dbxref=dbSNP_129:rs53873322;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398278.1	dbSNP	SNV	23794	23794	.	+	.	ID=4252;Variant_seq=T;Dbxref=dbSNP_129:rs19637643;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041041.1	dbSNP	SNV	1210	1210	.	+	.	ID=4253;Variant_seq=C;Dbxref=dbSNP_129:rs53522777;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041041.1	dbSNP	SNV	2186	2186	.	+	.	ID=4254;Variant_seq=T;Dbxref=dbSNP_129:rs54198547;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041041.1	dbSNP	SNV	2187	2187	.	+	.	ID=4255;Variant_seq=T;Dbxref=dbSNP_129:rs53805162;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041041.1	dbSNP	SNV	2192	2192	.	+	.	ID=4256;Variant_seq=T;Dbxref=dbSNP_129:rs54309836;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041041.1	dbSNP	SNV	2218	2218	.	+	.	ID=4257;Variant_seq=T;Dbxref=dbSNP_129:rs52933067;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041041.1	dbSNP	SNV	2234	2234	.	+	.	ID=4258;Variant_seq=T;Dbxref=dbSNP_129:rs54259680;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041041.1	dbSNP	SNV	4201	4201	.	+	.	ID=4259;Variant_seq=C;Dbxref=dbSNP_129:rs18172159;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400541.1	dbSNP	SNV	1730	1730	.	+	.	ID=4260;Variant_seq=T;Dbxref=dbSNP_129:rs18081098;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400541.1	dbSNP	SNV	1977	1977	.	+	.	ID=4261;Variant_seq=T;Dbxref=dbSNP_129:rs18081134;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040803.1	dbSNP	SNV	419	419	.	+	.	ID=4262;Variant_seq=T;Dbxref=dbSNP_129:rs52869073;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049686.1	dbSNP	SNV	248	248	.	+	.	ID=4263;Variant_seq=A;Dbxref=dbSNP_129:rs20304814;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02049686.1	dbSNP	SNV	1534	1534	.	+	.	ID=4264;Variant_seq=T;Dbxref=dbSNP_129:rs53895167;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049686.1	dbSNP	insertion	1594	1594	.	+	.	ID=4265;Variant_seq=AACAAAAATA;Dbxref=dbSNP_129:rs53414297;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02049686.1	dbSNP	SNV	1895	1895	.	+	.	ID=4266;Variant_seq=T;Dbxref=dbSNP_129:rs54350458;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040512.1	dbSNP	SNV	974	974	.	+	.	ID=4267;Variant_seq=A;Dbxref=dbSNP_129:rs20899288;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040512.1	dbSNP	SNV	4768	4768	.	+	.	ID=4268;Variant_seq=G;Dbxref=dbSNP_129:rs19533559;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036079.1	dbSNP	SNV	9396	9396	.	+	.	ID=4269;Variant_seq=A;Dbxref=dbSNP_129:rs20351080;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036079.1	dbSNP	SNV	10955	10955	.	+	.	ID=4270;Variant_seq=A;Dbxref=dbSNP_129:rs53117933;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036079.1	dbSNP	SNV	10957	10957	.	+	.	ID=4271;Variant_seq=A;Dbxref=dbSNP_129:rs53374161;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036079.1	dbSNP	SNV	10966	10966	.	+	.	ID=4272;Variant_seq=G;Dbxref=dbSNP_129:rs53512188;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036079.1	dbSNP	SNV	11357	11357	.	+	.	ID=4273;Variant_seq=T;Dbxref=dbSNP_129:rs19269035;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036079.1	dbSNP	SNV	14316	14316	.	+	.	ID=4274;Variant_seq=A;Dbxref=dbSNP_129:rs21003297;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036079.1	dbSNP	SNV	14327	14327	.	+	.	ID=4275;Variant_seq=A;Dbxref=dbSNP_129:rs21003286;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036079.1	dbSNP	SNV	15756	15756	.	+	.	ID=4276;Variant_seq=T;Dbxref=dbSNP_129:rs53240623;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036079.1	dbSNP	SNV	18276	18276	.	+	.	ID=4277;Variant_seq=G;Dbxref=dbSNP_129:rs17983290;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036079.1	dbSNP	SNV	18277	18277	.	+	.	ID=4278;Variant_seq=T;Dbxref=dbSNP_129:rs17983281;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036079.1	dbSNP	SNV	18308	18308	.	+	.	ID=4279;Variant_seq=T;Dbxref=dbSNP_129:rs19745562;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036079.1	dbSNP	SNV	20427	20427	.	+	.	ID=4280;Variant_seq=A;Dbxref=dbSNP_129:rs52963081;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036079.1	dbSNP	SNV	20859	20859	.	+	.	ID=4281;Variant_seq=A;Dbxref=dbSNP_129:rs53526156;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036079.1	dbSNP	SNV	20929	20929	.	+	.	ID=4282;Variant_seq=T;Dbxref=dbSNP_129:rs53505693;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398313.1	dbSNP	SNV	841	841	.	+	.	ID=4283;Variant_seq=A;Dbxref=dbSNP_129:rs53205088;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398313.1	dbSNP	insertion	851	851	.	+	.	ID=4284;Variant_seq=C;Dbxref=dbSNP_129:rs54233925;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398313.1	dbSNP	SNV	852	852	.	+	.	ID=4285;Variant_seq=C;Dbxref=dbSNP_129:rs52874693;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398313.1	dbSNP	SNV	855	855	.	+	.	ID=4286;Variant_seq=A;Dbxref=dbSNP_129:rs53879349;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398313.1	dbSNP	SNV	1337	1337	.	+	.	ID=4287;Variant_seq=G;Dbxref=dbSNP_129:rs52924086;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398313.1	dbSNP	SNV	7085	7085	.	+	.	ID=4288;Variant_seq=T;Dbxref=dbSNP_129:rs53592864;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398313.1	dbSNP	SNV	7086	7086	.	+	.	ID=4289;Variant_seq=T;Dbxref=dbSNP_129:rs53438298;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398313.1	dbSNP	SNV	7150	7150	.	+	.	ID=4290;Variant_seq=T;Dbxref=dbSNP_129:rs54227416;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398313.1	dbSNP	SNV	9588	9588	.	+	.	ID=4291;Variant_seq=A;Dbxref=dbSNP_129:rs19803567;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398313.1	dbSNP	SNV	16525	16525	.	+	.	ID=4292;Variant_seq=A;Dbxref=dbSNP_129:rs20342847;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398313.1	dbSNP	SNV	16580	16580	.	+	.	ID=4293;Variant_seq=A;Dbxref=dbSNP_129:rs52892757;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398313.1	dbSNP	SNV	16589	16589	.	+	.	ID=4294;Variant_seq=A;Dbxref=dbSNP_129:rs53410957;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398313.1	dbSNP	SNV	16599	16599	.	+	.	ID=4295;Variant_seq=A;Dbxref=dbSNP_129:rs54212262;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398313.1	dbSNP	SNV	16673	16673	.	+	.	ID=4296;Variant_seq=C;Dbxref=dbSNP_129:rs53583143;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398313.1	dbSNP	deletion	16677	16677	.	+	.	ID=4297;Variant_seq=-;Dbxref=dbSNP_129:rs54020202;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398313.1	dbSNP	SNV	16686	16686	.	+	.	ID=4298;Variant_seq=T;Dbxref=dbSNP_129:rs53854762;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398313.1	dbSNP	deletion	16721	16721	.	+	.	ID=4299;Variant_seq=-;Dbxref=dbSNP_129:rs53904048;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398313.1	dbSNP	SNV	16761	16761	.	+	.	ID=4300;Variant_seq=G;Dbxref=dbSNP_129:rs53319787;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398313.1	dbSNP	SNV	25501	25501	.	+	.	ID=4301;Variant_seq=T;Dbxref=dbSNP_129:rs54078565;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398313.1	dbSNP	SNV	25503	25503	.	+	.	ID=4302;Variant_seq=G;Dbxref=dbSNP_129:rs52971551;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398313.1	dbSNP	SNV	25866	25866	.	+	.	ID=4303;Variant_seq=C;Dbxref=dbSNP_129:rs52958949;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398313.1	dbSNP	SNV	26285	26285	.	+	.	ID=4304;Variant_seq=T;Dbxref=dbSNP_129:rs54078565;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398313.1	dbSNP	SNV	26287	26287	.	+	.	ID=4305;Variant_seq=G;Dbxref=dbSNP_129:rs52971551;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398313.1	dbSNP	SNV	26301	26301	.	+	.	ID=4306;Variant_seq=G;Dbxref=dbSNP_129:rs53797661;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398313.1	dbSNP	SNV	26325	26325	.	+	.	ID=4307;Variant_seq=G;Dbxref=dbSNP_129:rs53792747;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400598.1	dbSNP	SNV	769	769	.	+	.	ID=4308;Variant_seq=T;Dbxref=dbSNP_129:rs19751145;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400598.1	dbSNP	SNV	1047	1047	.	+	.	ID=4309;Variant_seq=G;Dbxref=dbSNP_129:rs19751185;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400598.1	dbSNP	SNV	1082	1082	.	+	.	ID=4310;Variant_seq=G;Dbxref=dbSNP_129:rs19751195;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400598.1	dbSNP	SNV	1093	1093	.	+	.	ID=4311;Variant_seq=G;Dbxref=dbSNP_129:rs19751205;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400598.1	dbSNP	SNV	1449	1449	.	+	.	ID=4312;Variant_seq=G;Dbxref=dbSNP_129:rs19751364;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400598.1	dbSNP	SNV	1546	1546	.	+	.	ID=4313;Variant_seq=T;Dbxref=dbSNP_129:rs19751404;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040249.1	dbSNP	SNV	2183	2183	.	+	.	ID=4314;Variant_seq=T;Dbxref=dbSNP_129:rs20578486;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040249.1	dbSNP	SNV	2186	2186	.	+	.	ID=4315;Variant_seq=A;Dbxref=dbSNP_129:rs20578476;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040249.1	dbSNP	SNV	2193	2193	.	+	.	ID=4316;Variant_seq=A;Dbxref=dbSNP_129:rs20578456;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045398.1	dbSNP	SNV	574	574	.	+	.	ID=4317;Variant_seq=C;Dbxref=dbSNP_129:rs19871866;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045398.1	dbSNP	SNV	578	578	.	+	.	ID=4318;Variant_seq=C;Dbxref=dbSNP_129:rs19871846;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045398.1	dbSNP	SNV	581	581	.	+	.	ID=4319;Variant_seq=C;Dbxref=dbSNP_129:rs19871836;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045398.1	dbSNP	SNV	584	584	.	+	.	ID=4320;Variant_seq=C;Dbxref=dbSNP_129:rs19871826;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045398.1	dbSNP	SNV	585	585	.	+	.	ID=4321;Variant_seq=T;Dbxref=dbSNP_129:rs19871816;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045398.1	dbSNP	SNV	590	590	.	+	.	ID=4322;Variant_seq=G;Dbxref=dbSNP_129:rs19871806;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045398.1	dbSNP	SNV	632	632	.	+	.	ID=4323;Variant_seq=G;Dbxref=dbSNP_129:rs19871786;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045398.1	dbSNP	SNV	633	633	.	+	.	ID=4324;Variant_seq=C;Dbxref=dbSNP_129:rs19871776;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398720.1	dbSNP	SNV	2623	2623	.	+	.	ID=4325;Variant_seq=T;Dbxref=dbSNP_129:rs53764592;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398720.1	dbSNP	SNV	2625	2625	.	+	.	ID=4326;Variant_seq=C;Dbxref=dbSNP_129:rs54381805;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398720.1	dbSNP	insertion	2628	2628	.	+	.	ID=4327;Variant_seq=G;Dbxref=dbSNP_129:rs52845950;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398720.1	dbSNP	deletion	2631	2631	.	+	.	ID=4328;Variant_seq=-;Dbxref=dbSNP_129:rs53615704;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398720.1	dbSNP	SNV	2632	2632	.	+	.	ID=4329;Variant_seq=G;Dbxref=dbSNP_129:rs54130395;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398720.1	dbSNP	SNV	2638	2638	.	+	.	ID=4330;Variant_seq=G;Dbxref=dbSNP_129:rs54069349;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398720.1	dbSNP	SNV	2641	2641	.	+	.	ID=4331;Variant_seq=G;Dbxref=dbSNP_129:rs53310956;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398720.1	dbSNP	SNV	2644	2644	.	+	.	ID=4332;Variant_seq=A;Dbxref=dbSNP_129:rs53374904;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398720.1	dbSNP	deletion	2645	2646	.	+	.	ID=4333;Variant_seq=-;Dbxref=dbSNP_129:rs54095399;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=AG
CH398720.1	dbSNP	deletion	2649	2649	.	+	.	ID=4334;Variant_seq=-;Dbxref=dbSNP_129:rs52845234;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043052.1	dbSNP	SNV	77	77	.	+	.	ID=4335;Variant_seq=C;Dbxref=dbSNP_129:rs19284288;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043052.1	dbSNP	SNV	87	87	.	+	.	ID=4336;Variant_seq=G;Dbxref=dbSNP_129:rs19284298;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043052.1	dbSNP	SNV	176	176	.	+	.	ID=4337;Variant_seq=A;Dbxref=dbSNP_129:rs19284378;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043052.1	dbSNP	SNV	189	189	.	+	.	ID=4338;Variant_seq=G;Dbxref=dbSNP_129:rs19284388;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043052.1	dbSNP	SNV	190	190	.	+	.	ID=4339;Variant_seq=T;Dbxref=dbSNP_129:rs19284398;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043052.1	dbSNP	SNV	191	191	.	+	.	ID=4340;Variant_seq=T;Dbxref=dbSNP_129:rs19284408;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043052.1	dbSNP	SNV	208	208	.	+	.	ID=4341;Variant_seq=T;Dbxref=dbSNP_129:rs19284428;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043052.1	dbSNP	SNV	209	209	.	+	.	ID=4342;Variant_seq=T;Dbxref=dbSNP_129:rs19284438;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043052.1	dbSNP	SNV	228	228	.	+	.	ID=4343;Variant_seq=C;Dbxref=dbSNP_129:rs19284458;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043052.1	dbSNP	SNV	233	233	.	+	.	ID=4344;Variant_seq=C;Dbxref=dbSNP_129:rs19284468;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043052.1	dbSNP	SNV	401	401	.	+	.	ID=4345;Variant_seq=T;Dbxref=dbSNP_129:rs19284718;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043052.1	dbSNP	SNV	490	490	.	+	.	ID=4346;Variant_seq=G;Dbxref=dbSNP_129:rs19284848;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043052.1	dbSNP	SNV	1188	1188	.	+	.	ID=4347;Variant_seq=C;Dbxref=dbSNP_129:rs19285787;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043052.1	dbSNP	SNV	1190	1190	.	+	.	ID=4348;Variant_seq=G;Dbxref=dbSNP_129:rs19285797;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043052.1	dbSNP	SNV	1196	1196	.	+	.	ID=4349;Variant_seq=A;Dbxref=dbSNP_129:rs19285807;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043052.1	dbSNP	SNV	1198	1198	.	+	.	ID=4350;Variant_seq=T;Dbxref=dbSNP_129:rs19285817;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043052.1	dbSNP	SNV	1205	1205	.	+	.	ID=4351;Variant_seq=G;Dbxref=dbSNP_129:rs19285827;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043052.1	dbSNP	SNV	1250	1250	.	+	.	ID=4352;Variant_seq=C;Dbxref=dbSNP_129:rs19285897;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043052.1	dbSNP	SNV	2037	2037	.	+	.	ID=4353;Variant_seq=G;Dbxref=dbSNP_129:rs19285997;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043052.1	dbSNP	SNV	2145	2145	.	+	.	ID=4354;Variant_seq=C;Dbxref=dbSNP_129:rs19286206;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043052.1	dbSNP	SNV	2170	2170	.	+	.	ID=4355;Variant_seq=G;Dbxref=dbSNP_129:rs19286226;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043052.1	dbSNP	SNV	2765	2765	.	+	.	ID=4356;Variant_seq=A;Dbxref=dbSNP_129:rs19286496;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043052.1	dbSNP	SNV	2813	2813	.	+	.	ID=4357;Variant_seq=C;Dbxref=dbSNP_129:rs19286536;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043052.1	dbSNP	SNV	3351	3351	.	+	.	ID=4358;Variant_seq=T;Dbxref=dbSNP_129:rs52985936;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043052.1	dbSNP	SNV	3362	3362	.	+	.	ID=4359;Variant_seq=A;Dbxref=dbSNP_129:rs53155418;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043052.1	dbSNP	SNV	3402	3402	.	+	.	ID=4360;Variant_seq=A;Dbxref=dbSNP_129:rs53197304;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043052.1	dbSNP	SNV	3431	3431	.	+	.	ID=4361;Variant_seq=A;Dbxref=dbSNP_129:rs54062827;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400336.1	dbSNP	SNV	2324	2324	.	+	.	ID=4362;Variant_seq=T;Dbxref=dbSNP_129:rs19164277;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02042393.1	dbSNP	SNV	1560	1560	.	+	.	ID=4363;Variant_seq=A;Dbxref=dbSNP_129:rs21758124;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042393.1	dbSNP	SNV	1564	1564	.	+	.	ID=4364;Variant_seq=A;Dbxref=dbSNP_129:rs21758115;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042393.1	dbSNP	SNV	1565	1565	.	+	.	ID=4365;Variant_seq=A;Dbxref=dbSNP_129:rs21758106;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042393.1	dbSNP	SNV	2064	2064	.	+	.	ID=4366;Variant_seq=A;Dbxref=dbSNP_129:rs20818438;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400790.1	dbSNP	SNV	1794	1794	.	+	.	ID=4367;Variant_seq=T;Dbxref=dbSNP_129:rs19606570;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036283.1	dbSNP	SNV	14040	14040	.	+	.	ID=4368;Variant_seq=G;Dbxref=dbSNP_129:rs53941252;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036283.1	dbSNP	SNV	18769	18769	.	+	.	ID=4369;Variant_seq=A;Dbxref=dbSNP_129:rs19415151;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048166.1	dbSNP	SNV	1046	1046	.	+	.	ID=4370;Variant_seq=C;Dbxref=dbSNP_129:rs19428507;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048166.1	dbSNP	SNV	1051	1051	.	+	.	ID=4371;Variant_seq=T;Dbxref=dbSNP_129:rs19428517;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048166.1	dbSNP	SNV	1052	1052	.	+	.	ID=4372;Variant_seq=A;Dbxref=dbSNP_129:rs19428527;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048166.1	dbSNP	SNV	1059	1059	.	+	.	ID=4373;Variant_seq=A;Dbxref=dbSNP_129:rs19428537;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048166.1	dbSNP	SNV	1090	1090	.	+	.	ID=4374;Variant_seq=T;Dbxref=dbSNP_129:rs19428547;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048166.1	dbSNP	SNV	1157	1157	.	+	.	ID=4375;Variant_seq=A;Dbxref=dbSNP_129:rs19428577;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048166.1	dbSNP	SNV	1186	1186	.	+	.	ID=4376;Variant_seq=T;Dbxref=dbSNP_129:rs19428597;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399417.1	dbSNP	SNV	2401	2401	.	+	.	ID=4377;Variant_seq=T;Dbxref=dbSNP_129:rs21058256;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036935.1	dbSNP	SNV	9910	9910	.	+	.	ID=4378;Variant_seq=A;Dbxref=dbSNP_129:rs54383380;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036935.1	dbSNP	SNV	10786	10786	.	+	.	ID=4379;Variant_seq=C;Dbxref=dbSNP_129:rs21742483;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036935.1	dbSNP	SNV	10905	10905	.	+	.	ID=4380;Variant_seq=G;Dbxref=dbSNP_129:rs21742465;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036935.1	dbSNP	SNV	10906	10906	.	+	.	ID=4381;Variant_seq=A;Dbxref=dbSNP_129:rs21742456;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036935.1	dbSNP	SNV	10909	10909	.	+	.	ID=4382;Variant_seq=A;Dbxref=dbSNP_129:rs21742447;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036935.1	dbSNP	SNV	10916	10916	.	+	.	ID=4383;Variant_seq=C;Dbxref=dbSNP_129:rs21742438;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036935.1	dbSNP	SNV	10919	10919	.	+	.	ID=4384;Variant_seq=A;Dbxref=dbSNP_129:rs21742429;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036935.1	dbSNP	SNV	10961	10961	.	+	.	ID=4385;Variant_seq=G;Dbxref=dbSNP_129:rs21742411;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036935.1	dbSNP	SNV	10981	10981	.	+	.	ID=4386;Variant_seq=T;Dbxref=dbSNP_129:rs21742402;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036935.1	dbSNP	SNV	10988	10988	.	+	.	ID=4387;Variant_seq=C;Dbxref=dbSNP_129:rs21742393;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036935.1	dbSNP	SNV	12604	12604	.	+	.	ID=4388;Variant_seq=C;Dbxref=dbSNP_129:rs21742384;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036935.1	dbSNP	SNV	12616	12616	.	+	.	ID=4389;Variant_seq=A;Dbxref=dbSNP_129:rs21742375;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02036935.1	dbSNP	SNV	12620	12620	.	+	.	ID=4390;Variant_seq=C;Dbxref=dbSNP_129:rs21742366;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036935.1	dbSNP	SNV	12622	12622	.	+	.	ID=4391;Variant_seq=C;Dbxref=dbSNP_129:rs21742357;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036935.1	dbSNP	SNV	12795	12795	.	+	.	ID=4392;Variant_seq=G;Dbxref=dbSNP_129:rs21742330;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036935.1	dbSNP	SNV	12821	12821	.	+	.	ID=4393;Variant_seq=G;Dbxref=dbSNP_129:rs21742312;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02036935.1	dbSNP	SNV	12822	12822	.	+	.	ID=4394;Variant_seq=G;Dbxref=dbSNP_129:rs21742303;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02036935.1	dbSNP	SNV	12841	12841	.	+	.	ID=4395;Variant_seq=G;Dbxref=dbSNP_129:rs21742285;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400146.1	dbSNP	SNV	2117	2117	.	+	.	ID=4396;Variant_seq=A;Dbxref=dbSNP_129:rs19538401;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400146.1	dbSNP	SNV	2119	2119	.	+	.	ID=4397;Variant_seq=A;Dbxref=dbSNP_129:rs19538411;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400146.1	dbSNP	SNV	3144	3144	.	+	.	ID=4398;Variant_seq=G;Dbxref=dbSNP_129:rs20913880;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048057.1	dbSNP	SNV	197	197	.	+	.	ID=4399;Variant_seq=G;Dbxref=dbSNP_129:rs18342583;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048057.1	dbSNP	SNV	405	405	.	+	.	ID=4400;Variant_seq=A;Dbxref=dbSNP_129:rs18342637;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048057.1	dbSNP	deletion	436	436	.	+	.	ID=4401;Variant_seq=-;Dbxref=dbSNP_129:rs53961159;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048057.1	dbSNP	SNV	437	437	.	+	.	ID=4402;Variant_seq=A;Dbxref=dbSNP_129:rs53409303;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048057.1	dbSNP	SNV	443	443	.	+	.	ID=4403;Variant_seq=A;Dbxref=dbSNP_129:rs53375684;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048057.1	dbSNP	SNV	456	456	.	+	.	ID=4404;Variant_seq=A;Dbxref=dbSNP_129:rs53709952;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048057.1	dbSNP	SNV	464	464	.	+	.	ID=4405;Variant_seq=T;Dbxref=dbSNP_129:rs52931561;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048057.1	dbSNP	SNV	482	482	.	+	.	ID=4406;Variant_seq=T;Dbxref=dbSNP_129:rs53324004;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048057.1	dbSNP	insertion	483	483	.	+	.	ID=4407;Variant_seq=G;Dbxref=dbSNP_129:rs53816212;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02048057.1	dbSNP	SNV	489	489	.	+	.	ID=4408;Variant_seq=T;Dbxref=dbSNP_129:rs53946488;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048057.1	dbSNP	SNV	503	503	.	+	.	ID=4409;Variant_seq=T;Dbxref=dbSNP_129:rs18342655;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048057.1	dbSNP	SNV	505	505	.	+	.	ID=4410;Variant_seq=A;Dbxref=dbSNP_129:rs53134748;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048057.1	dbSNP	SNV	506	506	.	+	.	ID=4411;Variant_seq=A;Dbxref=dbSNP_129:rs53283225;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048057.1	dbSNP	SNV	543	543	.	+	.	ID=4412;Variant_seq=A;Dbxref=dbSNP_129:rs52888947;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048099.1	dbSNP	SNV	112	112	.	+	.	ID=4413;Variant_seq=A;Dbxref=dbSNP_129:rs20000042;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048099.1	dbSNP	SNV	113	113	.	+	.	ID=4414;Variant_seq=C;Dbxref=dbSNP_129:rs20000050;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048099.1	dbSNP	SNV	1025	1025	.	+	.	ID=4415;Variant_seq=C;Dbxref=dbSNP_129:rs53027896;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048099.1	dbSNP	SNV	1964	1964	.	+	.	ID=4416;Variant_seq=T;Dbxref=dbSNP_129:rs20000208;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046803.1	dbSNP	SNV	1285	1285	.	+	.	ID=4417;Variant_seq=C;Dbxref=dbSNP_129:rs53601943;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046803.1	dbSNP	SNV	1311	1311	.	+	.	ID=4418;Variant_seq=G;Dbxref=dbSNP_129:rs53214760;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048030.1	dbSNP	SNV	149	149	.	+	.	ID=4419;Variant_seq=A;Dbxref=dbSNP_129:rs20291212;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048030.1	dbSNP	SNV	161	161	.	+	.	ID=4420;Variant_seq=C;Dbxref=dbSNP_129:rs20291172;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048030.1	dbSNP	SNV	190	190	.	+	.	ID=4421;Variant_seq=C;Dbxref=dbSNP_129:rs20291132;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048030.1	dbSNP	SNV	195	195	.	+	.	ID=4422;Variant_seq=G;Dbxref=dbSNP_129:rs20291112;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048030.1	dbSNP	SNV	197	197	.	+	.	ID=4423;Variant_seq=C;Dbxref=dbSNP_129:rs20291102;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048030.1	dbSNP	SNV	201	201	.	+	.	ID=4424;Variant_seq=A;Dbxref=dbSNP_129:rs20291082;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048030.1	dbSNP	SNV	1604	1604	.	+	.	ID=4425;Variant_seq=A;Dbxref=dbSNP_129:rs53030727;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399749.1	dbSNP	SNV	2102	2102	.	+	.	ID=4426;Variant_seq=A;Dbxref=dbSNP_129:rs18928944;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399749.1	dbSNP	SNV	4187	4187	.	+	.	ID=4427;Variant_seq=C;Dbxref=dbSNP_129:rs21435553;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399749.1	dbSNP	SNV	4205	4205	.	+	.	ID=4428;Variant_seq=T;Dbxref=dbSNP_129:rs21435533;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398381.1	dbSNP	SNV	102	102	.	+	.	ID=4429;Variant_seq=T;Dbxref=dbSNP_129:rs53984985;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398381.1	dbSNP	SNV	109	109	.	+	.	ID=4430;Variant_seq=A;Dbxref=dbSNP_129:rs53353461;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398381.1	dbSNP	SNV	115	115	.	+	.	ID=4431;Variant_seq=T;Dbxref=dbSNP_129:rs54080739;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398381.1	dbSNP	SNV	119	119	.	+	.	ID=4432;Variant_seq=A;Dbxref=dbSNP_129:rs53259882;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398381.1	dbSNP	SNV	531	531	.	+	.	ID=4433;Variant_seq=T;Dbxref=dbSNP_129:rs21755792;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398381.1	dbSNP	SNV	1108	1108	.	+	.	ID=4434;Variant_seq=C;Dbxref=dbSNP_129:rs21128541;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398381.1	dbSNP	SNV	1804	1804	.	+	.	ID=4435;Variant_seq=A;Dbxref=dbSNP_129:rs21128311;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398381.1	dbSNP	SNV	1811	1811	.	+	.	ID=4436;Variant_seq=G;Dbxref=dbSNP_129:rs21128301;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398381.1	dbSNP	SNV	1847	1847	.	+	.	ID=4437;Variant_seq=T;Dbxref=dbSNP_129:rs21128291;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398381.1	dbSNP	SNV	1923	1923	.	+	.	ID=4438;Variant_seq=C;Dbxref=dbSNP_129:rs21128281;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398381.1	dbSNP	SNV	1936	1936	.	+	.	ID=4439;Variant_seq=T;Dbxref=dbSNP_129:rs21128271;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398381.1	dbSNP	SNV	1943	1943	.	+	.	ID=4440;Variant_seq=T;Dbxref=dbSNP_129:rs21128261;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398381.1	dbSNP	SNV	1949	1949	.	+	.	ID=4441;Variant_seq=G;Dbxref=dbSNP_129:rs54087161;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398381.1	dbSNP	SNV	1952	1952	.	+	.	ID=4442;Variant_seq=T;Dbxref=dbSNP_129:rs54093119;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398381.1	dbSNP	SNV	1960	1960	.	+	.	ID=4443;Variant_seq=A;Dbxref=dbSNP_129:rs53127964;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398381.1	dbSNP	SNV	1963	1963	.	+	.	ID=4444;Variant_seq=G;Dbxref=dbSNP_129:rs54343894;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398381.1	dbSNP	SNV	1978	1978	.	+	.	ID=4445;Variant_seq=A;Dbxref=dbSNP_129:rs21128251;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398381.1	dbSNP	SNV	2027	2027	.	+	.	ID=4446;Variant_seq=T;Dbxref=dbSNP_129:rs21128241;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398381.1	dbSNP	SNV	2050	2050	.	+	.	ID=4447;Variant_seq=C;Dbxref=dbSNP_129:rs21128231;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398381.1	dbSNP	SNV	2320	2320	.	+	.	ID=4448;Variant_seq=T;Dbxref=dbSNP_129:rs21128191;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398381.1	dbSNP	SNV	2501	2501	.	+	.	ID=4449;Variant_seq=G;Dbxref=dbSNP_129:rs21128131;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398381.1	dbSNP	SNV	11078	11078	.	+	.	ID=4450;Variant_seq=G;Dbxref=dbSNP_129:rs21125960;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398381.1	dbSNP	SNV	11293	11293	.	+	.	ID=4451;Variant_seq=G;Dbxref=dbSNP_129:rs21125911;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398381.1	dbSNP	SNV	11829	11829	.	+	.	ID=4452;Variant_seq=G;Dbxref=dbSNP_129:rs21125881;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398381.1	dbSNP	SNV	11879	11879	.	+	.	ID=4453;Variant_seq=G;Dbxref=dbSNP_129:rs21125871;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398381.1	dbSNP	SNV	12091	12091	.	+	.	ID=4454;Variant_seq=T;Dbxref=dbSNP_129:rs21125801;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398381.1	dbSNP	SNV	16465	16465	.	+	.	ID=4455;Variant_seq=C;Dbxref=dbSNP_129:rs53103741;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398381.1	dbSNP	SNV	16497	16497	.	+	.	ID=4456;Variant_seq=T;Dbxref=dbSNP_129:rs53659864;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398381.1	dbSNP	SNV	17531	17531	.	+	.	ID=4457;Variant_seq=A;Dbxref=dbSNP_129:rs54096591;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398381.1	dbSNP	SNV	17705	17705	.	+	.	ID=4458;Variant_seq=C;Dbxref=dbSNP_129:rs54285159;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398381.1	dbSNP	SNV	18489	18489	.	+	.	ID=4459;Variant_seq=A;Dbxref=dbSNP_129:rs19275437;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047764.1	dbSNP	SNV	374	374	.	+	.	ID=4460;Variant_seq=A;Dbxref=dbSNP_129:rs21202258;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047764.1	dbSNP	SNV	432	432	.	+	.	ID=4461;Variant_seq=G;Dbxref=dbSNP_129:rs21202268;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039399.1	dbSNP	deletion	6031	6031	.	+	.	ID=4462;Variant_seq=-;Dbxref=dbSNP_129:rs53107937;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039399.1	dbSNP	deletion	6047	6047	.	+	.	ID=4463;Variant_seq=-;Dbxref=dbSNP_129:rs53542998;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045940.1	dbSNP	SNV	2217	2217	.	+	.	ID=4464;Variant_seq=T;Dbxref=dbSNP_129:rs21392312;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041796.1	dbSNP	SNV	1016	1016	.	+	.	ID=4465;Variant_seq=A;Dbxref=dbSNP_129:rs18715942;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041796.1	dbSNP	SNV	1020	1020	.	+	.	ID=4466;Variant_seq=C;Dbxref=dbSNP_129:rs18715933;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041796.1	dbSNP	SNV	1030	1030	.	+	.	ID=4467;Variant_seq=T;Dbxref=dbSNP_129:rs18715924;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041796.1	dbSNP	SNV	1031	1031	.	+	.	ID=4468;Variant_seq=G;Dbxref=dbSNP_129:rs18715915;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041796.1	dbSNP	SNV	1032	1032	.	+	.	ID=4469;Variant_seq=G;Dbxref=dbSNP_129:rs18715906;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041796.1	dbSNP	SNV	1041	1041	.	+	.	ID=4470;Variant_seq=C;Dbxref=dbSNP_129:rs18715888;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041796.1	dbSNP	SNV	1042	1042	.	+	.	ID=4471;Variant_seq=C;Dbxref=dbSNP_129:rs18715879;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041796.1	dbSNP	SNV	1044	1044	.	+	.	ID=4472;Variant_seq=T;Dbxref=dbSNP_129:rs18715870;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041796.1	dbSNP	SNV	1093	1093	.	+	.	ID=4473;Variant_seq=T;Dbxref=dbSNP_129:rs18715834;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041796.1	dbSNP	SNV	1475	1475	.	+	.	ID=4474;Variant_seq=C;Dbxref=dbSNP_129:rs18715735;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041796.1	dbSNP	SNV	1551	1551	.	+	.	ID=4475;Variant_seq=T;Dbxref=dbSNP_129:rs18715699;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045728.1	dbSNP	SNV	1935	1935	.	+	.	ID=4476;Variant_seq=G;Dbxref=dbSNP_129:rs21016951;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046756.1	dbSNP	SNV	992	992	.	+	.	ID=4477;Variant_seq=A;Dbxref=dbSNP_129:rs18952428;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH401024.1	dbSNP	SNV	47	47	.	+	.	ID=4478;Variant_seq=C;Dbxref=dbSNP_129:rs21615962;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH401024.1	dbSNP	SNV	50	50	.	+	.	ID=4479;Variant_seq=T;Dbxref=dbSNP_129:rs21615953;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400287.1	dbSNP	SNV	447	447	.	+	.	ID=4480;Variant_seq=T;Dbxref=dbSNP_129:rs19043620;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400287.1	dbSNP	SNV	448	448	.	+	.	ID=4481;Variant_seq=A;Dbxref=dbSNP_129:rs19043610;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400287.1	dbSNP	SNV	2422	2422	.	+	.	ID=4482;Variant_seq=T;Dbxref=dbSNP_129:rs18972243;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399406.1	dbSNP	SNV	3131	3131	.	+	.	ID=4483;Variant_seq=T;Dbxref=dbSNP_129:rs20852568;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399406.1	dbSNP	SNV	3133	3133	.	+	.	ID=4484;Variant_seq=G;Dbxref=dbSNP_129:rs20852558;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399406.1	dbSNP	SNV	4782	4782	.	+	.	ID=4485;Variant_seq=G;Dbxref=dbSNP_129:rs54403744;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044162.1	dbSNP	SNV	2528	2528	.	+	.	ID=4486;Variant_seq=C;Dbxref=dbSNP_129:rs53063050;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044162.1	dbSNP	SNV	2541	2541	.	+	.	ID=4487;Variant_seq=G;Dbxref=dbSNP_129:rs54348185;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044162.1	dbSNP	deletion	2636	2644	.	+	.	ID=4488;Variant_seq=-;Dbxref=dbSNP_129:rs53758457;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=GTGAGGGGC
AAAA02041632.1	dbSNP	SNV	1257	1257	.	+	.	ID=4489;Variant_seq=T;Dbxref=dbSNP_129:rs18281087;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041632.1	dbSNP	SNV	1259	1259	.	+	.	ID=4490;Variant_seq=C;Dbxref=dbSNP_129:rs18281078;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041632.1	dbSNP	SNV	1261	1261	.	+	.	ID=4491;Variant_seq=C;Dbxref=dbSNP_129:rs18281069;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041632.1	dbSNP	SNV	1271	1271	.	+	.	ID=4492;Variant_seq=C;Dbxref=dbSNP_129:rs18281060;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041632.1	dbSNP	SNV	1276	1276	.	+	.	ID=4493;Variant_seq=A;Dbxref=dbSNP_129:rs18281051;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041632.1	dbSNP	SNV	1277	1277	.	+	.	ID=4494;Variant_seq=T;Dbxref=dbSNP_129:rs18281042;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041632.1	dbSNP	SNV	1279	1279	.	+	.	ID=4495;Variant_seq=T;Dbxref=dbSNP_129:rs18281033;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041632.1	dbSNP	SNV	1472	1472	.	+	.	ID=4496;Variant_seq=C;Dbxref=dbSNP_129:rs18280637;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041632.1	dbSNP	SNV	1479	1479	.	+	.	ID=4497;Variant_seq=C;Dbxref=dbSNP_129:rs18280610;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041632.1	dbSNP	SNV	1480	1480	.	+	.	ID=4498;Variant_seq=C;Dbxref=dbSNP_129:rs18280601;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041632.1	dbSNP	SNV	1481	1481	.	+	.	ID=4499;Variant_seq=T;Dbxref=dbSNP_129:rs18280592;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041632.1	dbSNP	SNV	1501	1501	.	+	.	ID=4500;Variant_seq=T;Dbxref=dbSNP_129:rs18280583;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041632.1	dbSNP	SNV	1504	1504	.	+	.	ID=4501;Variant_seq=G;Dbxref=dbSNP_129:rs18280574;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041632.1	dbSNP	SNV	1511	1511	.	+	.	ID=4502;Variant_seq=G;Dbxref=dbSNP_129:rs18280565;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041632.1	dbSNP	SNV	1514	1514	.	+	.	ID=4503;Variant_seq=A;Dbxref=dbSNP_129:rs18280556;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041632.1	dbSNP	SNV	1515	1515	.	+	.	ID=4504;Variant_seq=C;Dbxref=dbSNP_129:rs18280547;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041632.1	dbSNP	SNV	1517	1517	.	+	.	ID=4505;Variant_seq=A;Dbxref=dbSNP_129:rs18280538;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041632.1	dbSNP	SNV	1522	1522	.	+	.	ID=4506;Variant_seq=A;Dbxref=dbSNP_129:rs18280511;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041632.1	dbSNP	SNV	1523	1523	.	+	.	ID=4507;Variant_seq=G;Dbxref=dbSNP_129:rs18280502;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041632.1	dbSNP	SNV	1524	1524	.	+	.	ID=4508;Variant_seq=C;Dbxref=dbSNP_129:rs18280493;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041632.1	dbSNP	SNV	1525	1525	.	+	.	ID=4509;Variant_seq=A;Dbxref=dbSNP_129:rs18280484;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041632.1	dbSNP	SNV	1529	1529	.	+	.	ID=4510;Variant_seq=T;Dbxref=dbSNP_129:rs18280475;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041632.1	dbSNP	SNV	1531	1531	.	+	.	ID=4511;Variant_seq=T;Dbxref=dbSNP_129:rs18280457;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041632.1	dbSNP	SNV	1551	1551	.	+	.	ID=4512;Variant_seq=C;Dbxref=dbSNP_129:rs18280439;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041632.1	dbSNP	SNV	1564	1564	.	+	.	ID=4513;Variant_seq=A;Dbxref=dbSNP_129:rs18280421;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041632.1	dbSNP	SNV	1565	1565	.	+	.	ID=4514;Variant_seq=T;Dbxref=dbSNP_129:rs18280412;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041632.1	dbSNP	SNV	1595	1595	.	+	.	ID=4515;Variant_seq=G;Dbxref=dbSNP_129:rs18280403;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041632.1	dbSNP	SNV	1599	1599	.	+	.	ID=4516;Variant_seq=G;Dbxref=dbSNP_129:rs18280394;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041632.1	dbSNP	SNV	1600	1600	.	+	.	ID=4517;Variant_seq=C;Dbxref=dbSNP_129:rs18280385;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041632.1	dbSNP	SNV	1601	1601	.	+	.	ID=4518;Variant_seq=C;Dbxref=dbSNP_129:rs18280376;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041632.1	dbSNP	SNV	1630	1630	.	+	.	ID=4519;Variant_seq=C;Dbxref=dbSNP_129:rs18280322;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041632.1	dbSNP	SNV	1633	1633	.	+	.	ID=4520;Variant_seq=C;Dbxref=dbSNP_129:rs18280313;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041632.1	dbSNP	SNV	1673	1673	.	+	.	ID=4521;Variant_seq=T;Dbxref=dbSNP_129:rs18280232;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041632.1	dbSNP	SNV	2068	2068	.	+	.	ID=4522;Variant_seq=A;Dbxref=dbSNP_129:rs18280088;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041632.1	dbSNP	SNV	2069	2069	.	+	.	ID=4523;Variant_seq=A;Dbxref=dbSNP_129:rs18280079;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041632.1	dbSNP	SNV	2072	2072	.	+	.	ID=4524;Variant_seq=A;Dbxref=dbSNP_129:rs18280070;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041632.1	dbSNP	SNV	2080	2080	.	+	.	ID=4525;Variant_seq=C;Dbxref=dbSNP_129:rs18280061;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041632.1	dbSNP	SNV	2081	2081	.	+	.	ID=4526;Variant_seq=C;Dbxref=dbSNP_129:rs18280052;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02036315.1	dbSNP	SNV	14605	14605	.	+	.	ID=4527;Variant_seq=C;Dbxref=dbSNP_129:rs21158731;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040735.1	dbSNP	SNV	817	817	.	+	.	ID=4528;Variant_seq=G;Dbxref=dbSNP_129:rs53209220;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040735.1	dbSNP	SNV	1372	1372	.	+	.	ID=4529;Variant_seq=C;Dbxref=dbSNP_129:rs18006251;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02040735.1	dbSNP	SNV	1420	1420	.	+	.	ID=4530;Variant_seq=C;Dbxref=dbSNP_129:rs18006036;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398960.1	dbSNP	SNV	1413	1413	.	+	.	ID=4531;Variant_seq=T;Dbxref=dbSNP_129:rs53333060;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398960.1	dbSNP	SNV	1413	1413	.	+	.	ID=4532;Variant_seq=A;Dbxref=dbSNP_129:rs54110693;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398960.1	dbSNP	SNV	1423	1423	.	+	.	ID=4533;Variant_seq=A;Dbxref=dbSNP_129:rs54246196;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398960.1	dbSNP	SNV	1423	1423	.	+	.	ID=4534;Variant_seq=A;Dbxref=dbSNP_129:rs54406288;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398960.1	dbSNP	SNV	1431	1431	.	+	.	ID=4535;Variant_seq=C;Dbxref=dbSNP_129:rs54254049;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398960.1	dbSNP	SNV	1432	1432	.	+	.	ID=4536;Variant_seq=C;Dbxref=dbSNP_129:rs53910097;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398960.1	dbSNP	SNV	1435	1435	.	+	.	ID=4537;Variant_seq=A;Dbxref=dbSNP_129:rs53579800;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398960.1	dbSNP	deletion	1435	1440	.	+	.	ID=4538;Variant_seq=-;Dbxref=dbSNP_129:rs53201092;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=GAGCAG
CH398960.1	dbSNP	deletion	1435	1440	.	+	.	ID=4539;Variant_seq=-;Dbxref=dbSNP_129:rs53047588;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=GAGCAG
CH398960.1	dbSNP	SNV	1437	1437	.	+	.	ID=4540;Variant_seq=A;Dbxref=dbSNP_129:rs53127175;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398960.1	dbSNP	SNV	1437	1437	.	+	.	ID=4541;Variant_seq=T;Dbxref=dbSNP_129:rs52864059;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398960.1	dbSNP	SNV	1439	1439	.	+	.	ID=4542;Variant_seq=G;Dbxref=dbSNP_129:rs53956293;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398960.1	dbSNP	deletion	1443	1446	.	+	.	ID=4543;Variant_seq=-;Dbxref=dbSNP_129:rs54019453;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=CAAA
CH398960.1	dbSNP	deletion	1443	1446	.	+	.	ID=4544;Variant_seq=-;Dbxref=dbSNP_129:rs53003657;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=CAAA
CH398960.1	dbSNP	SNV	1444	1444	.	+	.	ID=4545;Variant_seq=G;Dbxref=dbSNP_129:rs53026508;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398960.1	dbSNP	SNV	1444	1444	.	+	.	ID=4546;Variant_seq=C;Dbxref=dbSNP_129:rs53893021;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398960.1	dbSNP	deletion	1448	1449	.	+	.	ID=4547;Variant_seq=-;Dbxref=dbSNP_129:rs53128798;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=AA
CH398960.1	dbSNP	deletion	1451	1459	.	+	.	ID=4548;Variant_seq=-;Dbxref=dbSNP_129:rs52948076;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=ATCTCTCCA
CH398960.1	dbSNP	SNV	5577	5577	.	+	.	ID=4549;Variant_seq=A;Dbxref=dbSNP_129:rs21356971;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398960.1	dbSNP	SNV	7360	7360	.	+	.	ID=4550;Variant_seq=A;Dbxref=dbSNP_129:rs54131748;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398960.1	dbSNP	SNV	7362	7362	.	+	.	ID=4551;Variant_seq=A;Dbxref=dbSNP_129:rs52866282;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398960.1	dbSNP	SNV	7363	7363	.	+	.	ID=4552;Variant_seq=T;Dbxref=dbSNP_129:rs54221906;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398960.1	dbSNP	SNV	7368	7368	.	+	.	ID=4553;Variant_seq=T;Dbxref=dbSNP_129:rs53331442;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398960.1	dbSNP	SNV	7420	7420	.	+	.	ID=4554;Variant_seq=A;Dbxref=dbSNP_129:rs53590031;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398960.1	dbSNP	SNV	7444	7444	.	+	.	ID=4555;Variant_seq=T;Dbxref=dbSNP_129:rs53369923;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398960.1	dbSNP	SNV	7500	7500	.	+	.	ID=4556;Variant_seq=T;Dbxref=dbSNP_129:rs53626011;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398960.1	dbSNP	SNV	7501	7501	.	+	.	ID=4557;Variant_seq=A;Dbxref=dbSNP_129:rs53791376;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398960.1	dbSNP	SNV	7503	7503	.	+	.	ID=4558;Variant_seq=C;Dbxref=dbSNP_129:rs52845578;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398960.1	dbSNP	SNV	7511	7511	.	+	.	ID=4559;Variant_seq=A;Dbxref=dbSNP_129:rs52939541;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045397.1	dbSNP	SNV	133	133	.	+	.	ID=4560;Variant_seq=T;Dbxref=dbSNP_129:rs21720245;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045397.1	dbSNP	SNV	180	180	.	+	.	ID=4561;Variant_seq=A;Dbxref=dbSNP_129:rs21720254;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045397.1	dbSNP	SNV	246	246	.	+	.	ID=4562;Variant_seq=T;Dbxref=dbSNP_129:rs21720263;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045397.1	dbSNP	SNV	332	332	.	+	.	ID=4563;Variant_seq=T;Dbxref=dbSNP_129:rs21720272;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045397.1	dbSNP	SNV	360	360	.	+	.	ID=4564;Variant_seq=G;Dbxref=dbSNP_129:rs21720281;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045397.1	dbSNP	SNV	2841	2841	.	+	.	ID=4565;Variant_seq=G;Dbxref=dbSNP_129:rs20592182;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398545.1	dbSNP	SNV	3231	3231	.	+	.	ID=4566;Variant_seq=G;Dbxref=dbSNP_129:rs20067522;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398545.1	dbSNP	SNV	3620	3620	.	+	.	ID=4567;Variant_seq=T;Dbxref=dbSNP_129:rs52896842;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398545.1	dbSNP	SNV	3730	3730	.	+	.	ID=4568;Variant_seq=T;Dbxref=dbSNP_129:rs20843894;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398545.1	dbSNP	SNV	8805	8805	.	+	.	ID=4569;Variant_seq=A;Dbxref=dbSNP_129:rs18767678;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398545.1	dbSNP	SNV	8808	8808	.	+	.	ID=4570;Variant_seq=G;Dbxref=dbSNP_129:rs18767687;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398545.1	dbSNP	SNV	8812	8812	.	+	.	ID=4571;Variant_seq=T;Dbxref=dbSNP_129:rs18767696;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398545.1	dbSNP	SNV	9370	9370	.	+	.	ID=4572;Variant_seq=A;Dbxref=dbSNP_129:rs20370719;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398545.1	dbSNP	SNV	10544	10544	.	+	.	ID=4573;Variant_seq=C;Dbxref=dbSNP_129:rs19135853;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398628.1	dbSNP	SNV	1979	1979	.	+	.	ID=4574;Variant_seq=A;Dbxref=dbSNP_129:rs52977420;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398628.1	dbSNP	SNV	1999	1999	.	+	.	ID=4575;Variant_seq=C;Dbxref=dbSNP_129:rs54201904;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398628.1	dbSNP	SNV	2004	2004	.	+	.	ID=4576;Variant_seq=C;Dbxref=dbSNP_129:rs54103483;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398628.1	dbSNP	SNV	2012	2012	.	+	.	ID=4577;Variant_seq=G;Dbxref=dbSNP_129:rs53243205;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398628.1	dbSNP	SNV	2026	2026	.	+	.	ID=4578;Variant_seq=T;Dbxref=dbSNP_129:rs53940395;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398628.1	dbSNP	SNV	2310	2310	.	+	.	ID=4579;Variant_seq=T;Dbxref=dbSNP_129:rs54229126;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398628.1	dbSNP	SNV	3296	3296	.	+	.	ID=4580;Variant_seq=G;Dbxref=dbSNP_129:rs18262740;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398628.1	dbSNP	SNV	5489	5489	.	+	.	ID=4581;Variant_seq=T;Dbxref=dbSNP_129:rs53059139;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398628.1	dbSNP	SNV	5498	5498	.	+	.	ID=4582;Variant_seq=A;Dbxref=dbSNP_129:rs54131748;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398628.1	dbSNP	SNV	5500	5500	.	+	.	ID=4583;Variant_seq=A;Dbxref=dbSNP_129:rs52866282;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398628.1	dbSNP	SNV	5501	5501	.	+	.	ID=4584;Variant_seq=T;Dbxref=dbSNP_129:rs54221906;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398628.1	dbSNP	SNV	5506	5506	.	+	.	ID=4585;Variant_seq=T;Dbxref=dbSNP_129:rs53331442;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398628.1	dbSNP	SNV	5528	5528	.	+	.	ID=4586;Variant_seq=G;Dbxref=dbSNP_129:rs54340881;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398628.1	dbSNP	SNV	5530	5530	.	+	.	ID=4587;Variant_seq=T;Dbxref=dbSNP_129:rs53517520;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398628.1	dbSNP	SNV	5531	5531	.	+	.	ID=4588;Variant_seq=A;Dbxref=dbSNP_129:rs52944793;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398628.1	dbSNP	SNV	5532	5532	.	+	.	ID=4589;Variant_seq=T;Dbxref=dbSNP_129:rs54111828;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398628.1	dbSNP	SNV	5599	5599	.	+	.	ID=4590;Variant_seq=A;Dbxref=dbSNP_129:rs54324464;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398628.1	dbSNP	SNV	5603	5603	.	+	.	ID=4591;Variant_seq=A;Dbxref=dbSNP_129:rs54226945;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398628.1	dbSNP	SNV	5604	5604	.	+	.	ID=4592;Variant_seq=C;Dbxref=dbSNP_129:rs52890275;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398628.1	dbSNP	SNV	6053	6053	.	+	.	ID=4593;Variant_seq=T;Dbxref=dbSNP_129:rs20720030;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398628.1	dbSNP	SNV	9371	9371	.	+	.	ID=4594;Variant_seq=A;Dbxref=dbSNP_129:rs21459879;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398628.1	dbSNP	SNV	9375	9375	.	+	.	ID=4595;Variant_seq=A;Dbxref=dbSNP_129:rs21459869;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398628.1	dbSNP	SNV	9697	9697	.	+	.	ID=4596;Variant_seq=C;Dbxref=dbSNP_129:rs53753515;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399891.1	dbSNP	SNV	920	920	.	+	.	ID=4597;Variant_seq=T;Dbxref=dbSNP_129:rs19093147;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399891.1	dbSNP	SNV	1016	1016	.	+	.	ID=4598;Variant_seq=T;Dbxref=dbSNP_129:rs20362554;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399891.1	dbSNP	SNV	1273	1273	.	+	.	ID=4599;Variant_seq=G;Dbxref=dbSNP_129:rs19092827;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399891.1	dbSNP	SNV	1276	1276	.	+	.	ID=4600;Variant_seq=T;Dbxref=dbSNP_129:rs19092817;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399891.1	dbSNP	SNV	1309	1309	.	+	.	ID=4601;Variant_seq=T;Dbxref=dbSNP_129:rs19092777;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399891.1	dbSNP	SNV	1314	1314	.	+	.	ID=4602;Variant_seq=A;Dbxref=dbSNP_129:rs19092767;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048738.1	dbSNP	SNV	196	196	.	+	.	ID=4603;Variant_seq=T;Dbxref=dbSNP_129:rs53450417;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048738.1	dbSNP	SNV	278	278	.	+	.	ID=4604;Variant_seq=A;Dbxref=dbSNP_129:rs53767965;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048738.1	dbSNP	SNV	309	309	.	+	.	ID=4605;Variant_seq=C;Dbxref=dbSNP_129:rs53111689;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048738.1	dbSNP	SNV	337	337	.	+	.	ID=4606;Variant_seq=C;Dbxref=dbSNP_129:rs54094205;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048738.1	dbSNP	SNV	353	353	.	+	.	ID=4607;Variant_seq=T;Dbxref=dbSNP_129:rs53173065;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048738.1	dbSNP	SNV	734	734	.	+	.	ID=4608;Variant_seq=A;Dbxref=dbSNP_129:rs53403219;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048738.1	dbSNP	SNV	744	744	.	+	.	ID=4609;Variant_seq=A;Dbxref=dbSNP_129:rs53569650;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048738.1	dbSNP	SNV	754	754	.	+	.	ID=4610;Variant_seq=T;Dbxref=dbSNP_129:rs54103969;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048738.1	dbSNP	SNV	761	761	.	+	.	ID=4611;Variant_seq=G;Dbxref=dbSNP_129:rs54320802;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048738.1	dbSNP	SNV	771	771	.	+	.	ID=4612;Variant_seq=C;Dbxref=dbSNP_129:rs53445584;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048738.1	dbSNP	SNV	801	801	.	+	.	ID=4613;Variant_seq=T;Dbxref=dbSNP_129:rs54306309;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048738.1	dbSNP	SNV	819	819	.	+	.	ID=4614;Variant_seq=T;Dbxref=dbSNP_129:rs53027050;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048738.1	dbSNP	SNV	822	822	.	+	.	ID=4615;Variant_seq=G;Dbxref=dbSNP_129:rs53125427;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048738.1	dbSNP	SNV	829	829	.	+	.	ID=4616;Variant_seq=T;Dbxref=dbSNP_129:rs53351843;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048738.1	dbSNP	deletion	833	833	.	+	.	ID=4617;Variant_seq=-;Dbxref=dbSNP_129:rs53479625;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048738.1	dbSNP	SNV	834	834	.	+	.	ID=4618;Variant_seq=A;Dbxref=dbSNP_129:rs53898134;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048738.1	dbSNP	SNV	835	835	.	+	.	ID=4619;Variant_seq=C;Dbxref=dbSNP_129:rs53818543;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048738.1	dbSNP	SNV	1113	1113	.	+	.	ID=4620;Variant_seq=G;Dbxref=dbSNP_129:rs53029041;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048738.1	dbSNP	SNV	1130	1130	.	+	.	ID=4621;Variant_seq=A;Dbxref=dbSNP_129:rs53832096;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048738.1	dbSNP	SNV	1132	1132	.	+	.	ID=4622;Variant_seq=G;Dbxref=dbSNP_129:rs53147704;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048738.1	dbSNP	SNV	1135	1135	.	+	.	ID=4623;Variant_seq=A;Dbxref=dbSNP_129:rs54401053;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048738.1	dbSNP	SNV	1202	1202	.	+	.	ID=4624;Variant_seq=A;Dbxref=dbSNP_129:rs54287821;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048738.1	dbSNP	SNV	1227	1227	.	+	.	ID=4625;Variant_seq=A;Dbxref=dbSNP_129:rs53121685;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046354.1	dbSNP	SNV	372	372	.	+	.	ID=4626;Variant_seq=G;Dbxref=dbSNP_129:rs53011105;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045165.1	dbSNP	SNV	2122	2122	.	+	.	ID=4627;Variant_seq=G;Dbxref=dbSNP_129:rs53038538;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045165.1	dbSNP	SNV	2187	2187	.	+	.	ID=4628;Variant_seq=A;Dbxref=dbSNP_129:rs53204681;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045165.1	dbSNP	SNV	2196	2196	.	+	.	ID=4629;Variant_seq=A;Dbxref=dbSNP_129:rs54052960;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045165.1	dbSNP	SNV	2206	2206	.	+	.	ID=4630;Variant_seq=A;Dbxref=dbSNP_129:rs53207932;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046743.1	dbSNP	SNV	496	496	.	+	.	ID=4631;Variant_seq=A;Dbxref=dbSNP_129:rs21302367;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046743.1	dbSNP	SNV	544	544	.	+	.	ID=4632;Variant_seq=C;Dbxref=dbSNP_129:rs21302417;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047120.1	dbSNP	SNV	819	819	.	+	.	ID=4633;Variant_seq=T;Dbxref=dbSNP_129:rs53991062;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047120.1	dbSNP	SNV	1194	1194	.	+	.	ID=4634;Variant_seq=A;Dbxref=dbSNP_129:rs54073211;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399383.1	dbSNP	SNV	47	47	.	+	.	ID=4635;Variant_seq=T;Dbxref=dbSNP_129:rs20120290;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399383.1	dbSNP	SNV	128	128	.	+	.	ID=4636;Variant_seq=T;Dbxref=dbSNP_129:rs20120210;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399383.1	dbSNP	SNV	129	129	.	+	.	ID=4637;Variant_seq=G;Dbxref=dbSNP_129:rs20120200;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399383.1	dbSNP	SNV	130	130	.	+	.	ID=4638;Variant_seq=G;Dbxref=dbSNP_129:rs20120190;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399383.1	dbSNP	SNV	132	132	.	+	.	ID=4639;Variant_seq=G;Dbxref=dbSNP_129:rs20120180;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399383.1	dbSNP	SNV	133	133	.	+	.	ID=4640;Variant_seq=C;Dbxref=dbSNP_129:rs20120170;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399383.1	dbSNP	SNV	177	177	.	+	.	ID=4641;Variant_seq=A;Dbxref=dbSNP_129:rs20120090;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399383.1	dbSNP	SNV	307	307	.	+	.	ID=4642;Variant_seq=T;Dbxref=dbSNP_129:rs20120050;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399383.1	dbSNP	SNV	333	333	.	+	.	ID=4643;Variant_seq=G;Dbxref=dbSNP_129:rs20120030;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399383.1	dbSNP	SNV	347	347	.	+	.	ID=4644;Variant_seq=T;Dbxref=dbSNP_129:rs20120020;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399383.1	dbSNP	SNV	365	365	.	+	.	ID=4645;Variant_seq=T;Dbxref=dbSNP_129:rs20120000;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399383.1	dbSNP	SNV	367	367	.	+	.	ID=4646;Variant_seq=T;Dbxref=dbSNP_129:rs20119990;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399383.1	dbSNP	SNV	502	502	.	+	.	ID=4647;Variant_seq=A;Dbxref=dbSNP_129:rs20119890;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399383.1	dbSNP	SNV	514	514	.	+	.	ID=4648;Variant_seq=C;Dbxref=dbSNP_129:rs20119880;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399383.1	dbSNP	SNV	515	515	.	+	.	ID=4649;Variant_seq=T;Dbxref=dbSNP_129:rs20119870;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399383.1	dbSNP	SNV	517	517	.	+	.	ID=4650;Variant_seq=T;Dbxref=dbSNP_129:rs20119860;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399383.1	dbSNP	SNV	519	519	.	+	.	ID=4651;Variant_seq=A;Dbxref=dbSNP_129:rs20119850;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399383.1	dbSNP	SNV	539	539	.	+	.	ID=4652;Variant_seq=T;Dbxref=dbSNP_129:rs20119840;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399383.1	dbSNP	SNV	542	542	.	+	.	ID=4653;Variant_seq=A;Dbxref=dbSNP_129:rs20119830;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399383.1	dbSNP	SNV	545	545	.	+	.	ID=4654;Variant_seq=T;Dbxref=dbSNP_129:rs20119810;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399383.1	dbSNP	SNV	562	562	.	+	.	ID=4655;Variant_seq=C;Dbxref=dbSNP_129:rs20119800;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399383.1	dbSNP	SNV	563	563	.	+	.	ID=4656;Variant_seq=C;Dbxref=dbSNP_129:rs20119790;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399383.1	dbSNP	SNV	564	564	.	+	.	ID=4657;Variant_seq=C;Dbxref=dbSNP_129:rs20119780;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399383.1	dbSNP	SNV	1740	1740	.	+	.	ID=4658;Variant_seq=A;Dbxref=dbSNP_129:rs20858360;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399383.1	dbSNP	SNV	2116	2116	.	+	.	ID=4659;Variant_seq=G;Dbxref=dbSNP_129:rs21585142;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399383.1	dbSNP	SNV	4111	4111	.	+	.	ID=4660;Variant_seq=A;Dbxref=dbSNP_129:rs53091311;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399383.1	dbSNP	SNV	4114	4114	.	+	.	ID=4661;Variant_seq=C;Dbxref=dbSNP_129:rs53695112;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399383.1	dbSNP	SNV	4138	4138	.	+	.	ID=4662;Variant_seq=T;Dbxref=dbSNP_129:rs53784018;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399383.1	dbSNP	SNV	4152	4152	.	+	.	ID=4663;Variant_seq=T;Dbxref=dbSNP_129:rs54291151;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399383.1	dbSNP	SNV	4166	4166	.	+	.	ID=4664;Variant_seq=A;Dbxref=dbSNP_129:rs54028108;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399383.1	dbSNP	SNV	4196	4196	.	+	.	ID=4665;Variant_seq=T;Dbxref=dbSNP_129:rs53525541;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399383.1	dbSNP	SNV	4670	4670	.	+	.	ID=4666;Variant_seq=A;Dbxref=dbSNP_129:rs54100796;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399842.1	dbSNP	SNV	1747	1747	.	+	.	ID=4667;Variant_seq=A;Dbxref=dbSNP_129:rs54058651;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399842.1	dbSNP	SNV	3552	3552	.	+	.	ID=4668;Variant_seq=T;Dbxref=dbSNP_129:rs54176537;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044569.1	dbSNP	SNV	118	118	.	+	.	ID=4669;Variant_seq=T;Dbxref=dbSNP_129:rs18862530;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044569.1	dbSNP	SNV	121	121	.	+	.	ID=4670;Variant_seq=T;Dbxref=dbSNP_129:rs18862540;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044569.1	dbSNP	SNV	145	145	.	+	.	ID=4671;Variant_seq=G;Dbxref=dbSNP_129:rs18862570;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044569.1	dbSNP	SNV	151	151	.	+	.	ID=4672;Variant_seq=T;Dbxref=dbSNP_129:rs18862580;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044569.1	dbSNP	SNV	194	194	.	+	.	ID=4673;Variant_seq=C;Dbxref=dbSNP_129:rs18862590;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044569.1	dbSNP	SNV	202	202	.	+	.	ID=4674;Variant_seq=A;Dbxref=dbSNP_129:rs18862610;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044569.1	dbSNP	SNV	205	205	.	+	.	ID=4675;Variant_seq=A;Dbxref=dbSNP_129:rs18862620;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044569.1	dbSNP	SNV	214	214	.	+	.	ID=4676;Variant_seq=T;Dbxref=dbSNP_129:rs18862630;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044569.1	dbSNP	SNV	368	368	.	+	.	ID=4677;Variant_seq=A;Dbxref=dbSNP_129:rs18862700;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044569.1	dbSNP	SNV	385	385	.	+	.	ID=4678;Variant_seq=T;Dbxref=dbSNP_129:rs18862710;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044569.1	dbSNP	SNV	388	388	.	+	.	ID=4679;Variant_seq=T;Dbxref=dbSNP_129:rs18862720;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044569.1	dbSNP	SNV	520	520	.	+	.	ID=4680;Variant_seq=T;Dbxref=dbSNP_129:rs18862760;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044569.1	dbSNP	SNV	524	524	.	+	.	ID=4681;Variant_seq=T;Dbxref=dbSNP_129:rs18862769;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044569.1	dbSNP	SNV	532	532	.	+	.	ID=4682;Variant_seq=T;Dbxref=dbSNP_129:rs18862778;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044569.1	dbSNP	SNV	554	554	.	+	.	ID=4683;Variant_seq=A;Dbxref=dbSNP_129:rs18862788;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044569.1	dbSNP	SNV	652	652	.	+	.	ID=4684;Variant_seq=T;Dbxref=dbSNP_129:rs18862798;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044569.1	dbSNP	SNV	660	660	.	+	.	ID=4685;Variant_seq=C;Dbxref=dbSNP_129:rs18862808;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044569.1	dbSNP	SNV	672	672	.	+	.	ID=4686;Variant_seq=T;Dbxref=dbSNP_129:rs18862828;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044569.1	dbSNP	SNV	673	673	.	+	.	ID=4687;Variant_seq=C;Dbxref=dbSNP_129:rs18862838;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044569.1	dbSNP	SNV	682	682	.	+	.	ID=4688;Variant_seq=C;Dbxref=dbSNP_129:rs18862848;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044569.1	dbSNP	SNV	696	696	.	+	.	ID=4689;Variant_seq=C;Dbxref=dbSNP_129:rs18862858;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044569.1	dbSNP	SNV	716	716	.	+	.	ID=4690;Variant_seq=T;Dbxref=dbSNP_129:rs18862868;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044569.1	dbSNP	SNV	733	733	.	+	.	ID=4691;Variant_seq=T;Dbxref=dbSNP_129:rs18862878;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044569.1	dbSNP	SNV	2451	2451	.	+	.	ID=4692;Variant_seq=A;Dbxref=dbSNP_129:rs18863478;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044569.1	dbSNP	SNV	2764	2764	.	+	.	ID=4693;Variant_seq=A;Dbxref=dbSNP_129:rs18863928;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044569.1	dbSNP	SNV	2880	2880	.	+	.	ID=4694;Variant_seq=T;Dbxref=dbSNP_129:rs21065843;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044569.1	dbSNP	SNV	2881	2881	.	+	.	ID=4695;Variant_seq=A;Dbxref=dbSNP_129:rs21065833;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044569.1	dbSNP	SNV	2882	2882	.	+	.	ID=4696;Variant_seq=A;Dbxref=dbSNP_129:rs21065823;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398334.1	dbSNP	SNV	467	467	.	+	.	ID=4697;Variant_seq=A;Dbxref=dbSNP_129:rs18980461;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398334.1	dbSNP	SNV	17488	17488	.	+	.	ID=4698;Variant_seq=G;Dbxref=dbSNP_129:rs19842575;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398334.1	dbSNP	SNV	17536	17536	.	+	.	ID=4699;Variant_seq=T;Dbxref=dbSNP_129:rs19842604;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398334.1	dbSNP	SNV	20170	20170	.	+	.	ID=4700;Variant_seq=T;Dbxref=dbSNP_129:rs20273419;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398334.1	dbSNP	SNV	20171	20171	.	+	.	ID=4701;Variant_seq=G;Dbxref=dbSNP_129:rs20273429;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398334.1	dbSNP	SNV	20173	20173	.	+	.	ID=4702;Variant_seq=T;Dbxref=dbSNP_129:rs20273449;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398334.1	dbSNP	SNV	20176	20176	.	+	.	ID=4703;Variant_seq=C;Dbxref=dbSNP_129:rs20273459;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398334.1	dbSNP	SNV	21625	21625	.	+	.	ID=4704;Variant_seq=T;Dbxref=dbSNP_129:rs21347605;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043649.1	dbSNP	SNV	1268	1268	.	+	.	ID=4705;Variant_seq=T;Dbxref=dbSNP_129:rs21399519;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043649.1	dbSNP	insertion	2062	2062	.	+	.	ID=4706;Variant_seq=TT;Dbxref=dbSNP_129:rs53010902;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02043649.1	dbSNP	SNV	2063	2063	.	+	.	ID=4707;Variant_seq=T;Dbxref=dbSNP_129:rs54005014;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043649.1	dbSNP	SNV	2066	2066	.	+	.	ID=4708;Variant_seq=T;Dbxref=dbSNP_129:rs53349443;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043649.1	dbSNP	SNV	2071	2071	.	+	.	ID=4709;Variant_seq=T;Dbxref=dbSNP_129:rs53634523;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044048.1	dbSNP	SNV	3300	3300	.	+	.	ID=4710;Variant_seq=A;Dbxref=dbSNP_129:rs18209888;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398964.1	dbSNP	SNV	2632	2632	.	+	.	ID=4711;Variant_seq=G;Dbxref=dbSNP_129:rs18280133;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398964.1	dbSNP	SNV	3254	3254	.	+	.	ID=4712;Variant_seq=T;Dbxref=dbSNP_129:rs20948176;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398964.1	dbSNP	SNV	3286	3286	.	+	.	ID=4713;Variant_seq=A;Dbxref=dbSNP_129:rs20948196;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398964.1	dbSNP	SNV	3495	3495	.	+	.	ID=4714;Variant_seq=A;Dbxref=dbSNP_129:rs20948226;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398964.1	dbSNP	SNV	3503	3503	.	+	.	ID=4715;Variant_seq=A;Dbxref=dbSNP_129:rs20948236;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398964.1	dbSNP	SNV	3516	3516	.	+	.	ID=4716;Variant_seq=T;Dbxref=dbSNP_129:rs20948246;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398964.1	dbSNP	SNV	3630	3630	.	+	.	ID=4717;Variant_seq=T;Dbxref=dbSNP_129:rs20948326;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398679.1	dbSNP	SNV	6889	6889	.	+	.	ID=4718;Variant_seq=T;Dbxref=dbSNP_129:rs19104023;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398679.1	dbSNP	SNV	9193	9193	.	+	.	ID=4719;Variant_seq=G;Dbxref=dbSNP_129:rs19427637;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398679.1	dbSNP	SNV	10383	10383	.	+	.	ID=4720;Variant_seq=G;Dbxref=dbSNP_129:rs21621154;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398679.1	dbSNP	SNV	10404	10404	.	+	.	ID=4721;Variant_seq=T;Dbxref=dbSNP_129:rs21621136;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398686.1	dbSNP	SNV	1861	1861	.	+	.	ID=4722;Variant_seq=A;Dbxref=dbSNP_129:rs53538335;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398686.1	dbSNP	SNV	4255	4255	.	+	.	ID=4723;Variant_seq=C;Dbxref=dbSNP_129:rs54072342;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398686.1	dbSNP	SNV	4334	4334	.	+	.	ID=4724;Variant_seq=G;Dbxref=dbSNP_129:rs54034789;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398686.1	dbSNP	SNV	4368	4368	.	+	.	ID=4725;Variant_seq=T;Dbxref=dbSNP_129:rs53237367;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398686.1	dbSNP	SNV	5195	5195	.	+	.	ID=4726;Variant_seq=A;Dbxref=dbSNP_129:rs20880900;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398686.1	dbSNP	SNV	6082	6082	.	+	.	ID=4727;Variant_seq=A;Dbxref=dbSNP_129:rs18279125;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398686.1	dbSNP	SNV	9240	9240	.	+	.	ID=4728;Variant_seq=T;Dbxref=dbSNP_129:rs20300881;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047133.1	dbSNP	SNV	956	956	.	+	.	ID=4729;Variant_seq=A;Dbxref=dbSNP_129:rs20030154;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047133.1	dbSNP	SNV	987	987	.	+	.	ID=4730;Variant_seq=A;Dbxref=dbSNP_129:rs20030144;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047133.1	dbSNP	SNV	1028	1028	.	+	.	ID=4731;Variant_seq=T;Dbxref=dbSNP_129:rs20030134;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047133.1	dbSNP	SNV	1139	1139	.	+	.	ID=4732;Variant_seq=C;Dbxref=dbSNP_129:rs18969435;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02047133.1	dbSNP	SNV	1161	1161	.	+	.	ID=4733;Variant_seq=A;Dbxref=dbSNP_129:rs18146901;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047133.1	dbSNP	SNV	1423	1423	.	+	.	ID=4734;Variant_seq=T;Dbxref=dbSNP_129:rs20030084;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02047133.1	dbSNP	SNV	2098	2098	.	+	.	ID=4735;Variant_seq=A;Dbxref=dbSNP_129:rs20029974;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047133.1	dbSNP	SNV	2115	2115	.	+	.	ID=4736;Variant_seq=A;Dbxref=dbSNP_129:rs20029964;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047133.1	dbSNP	SNV	2120	2120	.	+	.	ID=4737;Variant_seq=A;Dbxref=dbSNP_129:rs20029954;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02047133.1	dbSNP	SNV	2356	2356	.	+	.	ID=4738;Variant_seq=A;Dbxref=dbSNP_129:rs20029914;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400795.1	dbSNP	SNV	626	626	.	+	.	ID=4739;Variant_seq=C;Dbxref=dbSNP_129:rs21014711;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400795.1	dbSNP	SNV	1388	1388	.	+	.	ID=4740;Variant_seq=C;Dbxref=dbSNP_129:rs21015051;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398233.1	dbSNP	SNV	4679	4679	.	+	.	ID=4741;Variant_seq=A;Dbxref=dbSNP_129:rs19060274;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02049797.1	dbSNP	SNV	164	164	.	+	.	ID=4742;Variant_seq=G;Dbxref=dbSNP_129:rs20107816;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02049797.1	dbSNP	SNV	231	231	.	+	.	ID=4743;Variant_seq=T;Dbxref=dbSNP_129:rs20107826;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399367.1	dbSNP	SNV	705	705	.	+	.	ID=4744;Variant_seq=T;Dbxref=dbSNP_129:rs21760129;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399367.1	dbSNP	SNV	2188	2188	.	+	.	ID=4745;Variant_seq=C;Dbxref=dbSNP_129:rs53261827;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399367.1	dbSNP	SNV	3958	3958	.	+	.	ID=4746;Variant_seq=C;Dbxref=dbSNP_129:rs19969941;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039345.1	dbSNP	SNV	805	805	.	+	.	ID=4747;Variant_seq=A;Dbxref=dbSNP_129:rs18953556;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039345.1	dbSNP	SNV	4031	4031	.	+	.	ID=4748;Variant_seq=T;Dbxref=dbSNP_129:rs21469984;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039345.1	dbSNP	SNV	4087	4087	.	+	.	ID=4749;Variant_seq=T;Dbxref=dbSNP_129:rs53515014;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039345.1	dbSNP	SNV	5741	5741	.	+	.	ID=4750;Variant_seq=T;Dbxref=dbSNP_129:rs52895289;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041714.1	dbSNP	SNV	2174	2174	.	+	.	ID=4751;Variant_seq=G;Dbxref=dbSNP_129:rs19038031;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041217.1	dbSNP	SNV	347	347	.	+	.	ID=4752;Variant_seq=C;Dbxref=dbSNP_129:rs21123457;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041217.1	dbSNP	SNV	411	411	.	+	.	ID=4753;Variant_seq=G;Dbxref=dbSNP_129:rs21123447;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041217.1	dbSNP	SNV	466	466	.	+	.	ID=4754;Variant_seq=A;Dbxref=dbSNP_129:rs21123437;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041217.1	dbSNP	SNV	495	495	.	+	.	ID=4755;Variant_seq=G;Dbxref=dbSNP_129:rs21123427;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02041217.1	dbSNP	SNV	527	527	.	+	.	ID=4756;Variant_seq=G;Dbxref=dbSNP_129:rs21123417;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041217.1	dbSNP	SNV	562	562	.	+	.	ID=4757;Variant_seq=T;Dbxref=dbSNP_129:rs53331813;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041217.1	dbSNP	SNV	766	766	.	+	.	ID=4758;Variant_seq=G;Dbxref=dbSNP_129:rs21123407;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041217.1	dbSNP	SNV	905	905	.	+	.	ID=4759;Variant_seq=T;Dbxref=dbSNP_129:rs52840539;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02041217.1	dbSNP	SNV	948	948	.	+	.	ID=4760;Variant_seq=G;Dbxref=dbSNP_129:rs21123387;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02041217.1	dbSNP	insertion	1239	1239	.	+	.	ID=4761;Variant_seq=TGT;Dbxref=dbSNP_129:rs54039858;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02041217.1	dbSNP	insertion	1242	1242	.	+	.	ID=4762;Variant_seq=A;Dbxref=dbSNP_129:rs53033694;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02041217.1	dbSNP	SNV	1243	1243	.	+	.	ID=4763;Variant_seq=A;Dbxref=dbSNP_129:rs52874405;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399369.1	dbSNP	SNV	4441	4441	.	+	.	ID=4764;Variant_seq=G;Dbxref=dbSNP_129:rs18935439;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043285.1	dbSNP	SNV	318	318	.	+	.	ID=4765;Variant_seq=T;Dbxref=dbSNP_129:rs52888880;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043285.1	dbSNP	SNV	339	339	.	+	.	ID=4766;Variant_seq=T;Dbxref=dbSNP_129:rs52909525;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043285.1	dbSNP	SNV	368	368	.	+	.	ID=4767;Variant_seq=T;Dbxref=dbSNP_129:rs53965188;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043285.1	dbSNP	SNV	396	396	.	+	.	ID=4768;Variant_seq=C;Dbxref=dbSNP_129:rs52993811;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043285.1	dbSNP	SNV	399	399	.	+	.	ID=4769;Variant_seq=G;Dbxref=dbSNP_129:rs54270898;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043285.1	dbSNP	SNV	1715	1715	.	+	.	ID=4770;Variant_seq=T;Dbxref=dbSNP_129:rs53780113;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043285.1	dbSNP	SNV	1715	1715	.	+	.	ID=4771;Variant_seq=A;Dbxref=dbSNP_129:rs53699391;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043285.1	dbSNP	SNV	1717	1717	.	+	.	ID=4772;Variant_seq=T;Dbxref=dbSNP_129:rs54084679;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043285.1	dbSNP	SNV	1718	1718	.	+	.	ID=4773;Variant_seq=G;Dbxref=dbSNP_129:rs53572236;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043285.1	dbSNP	SNV	1721	1721	.	+	.	ID=4774;Variant_seq=C;Dbxref=dbSNP_129:rs53122401;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043285.1	dbSNP	SNV	1724	1724	.	+	.	ID=4775;Variant_seq=T;Dbxref=dbSNP_129:rs54404253;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043285.1	dbSNP	SNV	1733	1733	.	+	.	ID=4776;Variant_seq=A;Dbxref=dbSNP_129:rs53677566;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043285.1	dbSNP	SNV	1745	1745	.	+	.	ID=4777;Variant_seq=A;Dbxref=dbSNP_129:rs54349990;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043000.1	dbSNP	SNV	1733	1733	.	+	.	ID=4778;Variant_seq=C;Dbxref=dbSNP_129:rs20273339;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	44	44	.	+	.	ID=4779;Variant_seq=T;Dbxref=dbSNP_129:rs21416531;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039988.1	dbSNP	SNV	45	45	.	+	.	ID=4780;Variant_seq=A;Dbxref=dbSNP_129:rs21416521;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039988.1	dbSNP	SNV	49	49	.	+	.	ID=4781;Variant_seq=C;Dbxref=dbSNP_129:rs21416511;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039988.1	dbSNP	SNV	50	50	.	+	.	ID=4782;Variant_seq=T;Dbxref=dbSNP_129:rs21416501;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039988.1	dbSNP	SNV	51	51	.	+	.	ID=4783;Variant_seq=A;Dbxref=dbSNP_129:rs21416491;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039988.1	dbSNP	SNV	577	577	.	+	.	ID=4784;Variant_seq=A;Dbxref=dbSNP_129:rs21416151;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039988.1	dbSNP	SNV	578	578	.	+	.	ID=4785;Variant_seq=T;Dbxref=dbSNP_129:rs21416141;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039988.1	dbSNP	SNV	588	588	.	+	.	ID=4786;Variant_seq=A;Dbxref=dbSNP_129:rs21416111;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039988.1	dbSNP	SNV	600	600	.	+	.	ID=4787;Variant_seq=A;Dbxref=dbSNP_129:rs21416101;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	603	603	.	+	.	ID=4788;Variant_seq=G;Dbxref=dbSNP_129:rs21416081;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039988.1	dbSNP	SNV	604	604	.	+	.	ID=4789;Variant_seq=G;Dbxref=dbSNP_129:rs21416071;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	611	611	.	+	.	ID=4790;Variant_seq=C;Dbxref=dbSNP_129:rs21416061;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	613	613	.	+	.	ID=4791;Variant_seq=T;Dbxref=dbSNP_129:rs21416051;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	615	615	.	+	.	ID=4792;Variant_seq=A;Dbxref=dbSNP_129:rs21416041;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039988.1	dbSNP	SNV	617	617	.	+	.	ID=4793;Variant_seq=T;Dbxref=dbSNP_129:rs21416031;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	621	621	.	+	.	ID=4794;Variant_seq=A;Dbxref=dbSNP_129:rs21416011;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	623	623	.	+	.	ID=4795;Variant_seq=G;Dbxref=dbSNP_129:rs21416001;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039988.1	dbSNP	SNV	624	624	.	+	.	ID=4796;Variant_seq=A;Dbxref=dbSNP_129:rs21415991;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	625	625	.	+	.	ID=4797;Variant_seq=A;Dbxref=dbSNP_129:rs21415981;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	628	628	.	+	.	ID=4798;Variant_seq=G;Dbxref=dbSNP_129:rs21415971;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	636	636	.	+	.	ID=4799;Variant_seq=G;Dbxref=dbSNP_129:rs21415961;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	640	640	.	+	.	ID=4800;Variant_seq=C;Dbxref=dbSNP_129:rs21415951;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	644	644	.	+	.	ID=4801;Variant_seq=C;Dbxref=dbSNP_129:rs21415931;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	659	659	.	+	.	ID=4802;Variant_seq=C;Dbxref=dbSNP_129:rs21415921;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	661	661	.	+	.	ID=4803;Variant_seq=G;Dbxref=dbSNP_129:rs21415911;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	664	664	.	+	.	ID=4804;Variant_seq=C;Dbxref=dbSNP_129:rs21415891;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039988.1	dbSNP	SNV	665	665	.	+	.	ID=4805;Variant_seq=A;Dbxref=dbSNP_129:rs21415881;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039988.1	dbSNP	SNV	688	688	.	+	.	ID=4806;Variant_seq=C;Dbxref=dbSNP_129:rs21415770;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	689	689	.	+	.	ID=4807;Variant_seq=T;Dbxref=dbSNP_129:rs21415760;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039988.1	dbSNP	SNV	692	692	.	+	.	ID=4808;Variant_seq=G;Dbxref=dbSNP_129:rs21415740;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	697	697	.	+	.	ID=4809;Variant_seq=G;Dbxref=dbSNP_129:rs21415730;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	700	700	.	+	.	ID=4810;Variant_seq=C;Dbxref=dbSNP_129:rs21415710;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	704	704	.	+	.	ID=4811;Variant_seq=T;Dbxref=dbSNP_129:rs21415697;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	707	707	.	+	.	ID=4812;Variant_seq=C;Dbxref=dbSNP_129:rs21415687;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	708	708	.	+	.	ID=4813;Variant_seq=C;Dbxref=dbSNP_129:rs21415677;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	712	712	.	+	.	ID=4814;Variant_seq=C;Dbxref=dbSNP_129:rs21415657;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	718	718	.	+	.	ID=4815;Variant_seq=C;Dbxref=dbSNP_129:rs21415637;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039988.1	dbSNP	SNV	723	723	.	+	.	ID=4816;Variant_seq=T;Dbxref=dbSNP_129:rs21415627;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039988.1	dbSNP	SNV	724	724	.	+	.	ID=4817;Variant_seq=C;Dbxref=dbSNP_129:rs21415617;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	730	730	.	+	.	ID=4818;Variant_seq=T;Dbxref=dbSNP_129:rs21415597;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039988.1	dbSNP	SNV	732	732	.	+	.	ID=4819;Variant_seq=C;Dbxref=dbSNP_129:rs21415587;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	733	733	.	+	.	ID=4820;Variant_seq=C;Dbxref=dbSNP_129:rs21415577;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	740	740	.	+	.	ID=4821;Variant_seq=C;Dbxref=dbSNP_129:rs21415547;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	744	744	.	+	.	ID=4822;Variant_seq=T;Dbxref=dbSNP_129:rs21415537;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039988.1	dbSNP	SNV	745	745	.	+	.	ID=4823;Variant_seq=G;Dbxref=dbSNP_129:rs21415527;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	749	749	.	+	.	ID=4824;Variant_seq=G;Dbxref=dbSNP_129:rs21415507;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	751	751	.	+	.	ID=4825;Variant_seq=T;Dbxref=dbSNP_129:rs21415497;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039988.1	dbSNP	SNV	757	757	.	+	.	ID=4826;Variant_seq=C;Dbxref=dbSNP_129:rs21415487;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	764	764	.	+	.	ID=4827;Variant_seq=G;Dbxref=dbSNP_129:rs21415467;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	765	765	.	+	.	ID=4828;Variant_seq=C;Dbxref=dbSNP_129:rs21415457;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	911	911	.	+	.	ID=4829;Variant_seq=G;Dbxref=dbSNP_129:rs21414977;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	918	918	.	+	.	ID=4830;Variant_seq=A;Dbxref=dbSNP_129:rs21414967;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039988.1	dbSNP	SNV	936	936	.	+	.	ID=4831;Variant_seq=C;Dbxref=dbSNP_129:rs21414937;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039988.1	dbSNP	SNV	938	938	.	+	.	ID=4832;Variant_seq=G;Dbxref=dbSNP_129:rs21414927;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039988.1	dbSNP	SNV	947	947	.	+	.	ID=4833;Variant_seq=C;Dbxref=dbSNP_129:rs21414917;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	977	977	.	+	.	ID=4834;Variant_seq=C;Dbxref=dbSNP_129:rs21414837;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	989	989	.	+	.	ID=4835;Variant_seq=G;Dbxref=dbSNP_129:rs21414827;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039988.1	dbSNP	SNV	1543	1543	.	+	.	ID=4836;Variant_seq=T;Dbxref=dbSNP_129:rs21413657;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039988.1	dbSNP	SNV	1544	1544	.	+	.	ID=4837;Variant_seq=G;Dbxref=dbSNP_129:rs21413647;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	1545	1545	.	+	.	ID=4838;Variant_seq=G;Dbxref=dbSNP_129:rs21413637;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039988.1	dbSNP	SNV	1546	1546	.	+	.	ID=4839;Variant_seq=G;Dbxref=dbSNP_129:rs21413627;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039988.1	dbSNP	SNV	1547	1547	.	+	.	ID=4840;Variant_seq=G;Dbxref=dbSNP_129:rs21413617;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	1549	1549	.	+	.	ID=4841;Variant_seq=G;Dbxref=dbSNP_129:rs21413607;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	4269	4269	.	+	.	ID=4842;Variant_seq=C;Dbxref=dbSNP_129:rs19527661;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	4324	4324	.	+	.	ID=4843;Variant_seq=A;Dbxref=dbSNP_129:rs53180839;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	SNV	4328	4328	.	+	.	ID=4844;Variant_seq=A;Dbxref=dbSNP_129:rs53048860;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039988.1	dbSNP	insertion	4329	4329	.	+	.	ID=4845;Variant_seq=A;Dbxref=dbSNP_129:rs53230029;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02039988.1	dbSNP	SNV	4337	4337	.	+	.	ID=4846;Variant_seq=T;Dbxref=dbSNP_129:rs53110443;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	4561	4561	.	+	.	ID=4847;Variant_seq=G;Dbxref=dbSNP_129:rs21417102;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	5516	5516	.	+	.	ID=4848;Variant_seq=C;Dbxref=dbSNP_129:rs21417082;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039988.1	dbSNP	SNV	5518	5518	.	+	.	ID=4849;Variant_seq=A;Dbxref=dbSNP_129:rs21417072;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039988.1	dbSNP	SNV	5548	5548	.	+	.	ID=4850;Variant_seq=A;Dbxref=dbSNP_129:rs21417001;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02042939.1	dbSNP	SNV	320	320	.	+	.	ID=4851;Variant_seq=C;Dbxref=dbSNP_129:rs20214588;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02042939.1	dbSNP	SNV	1933	1933	.	+	.	ID=4852;Variant_seq=A;Dbxref=dbSNP_129:rs19092288;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044534.1	dbSNP	SNV	2430	2430	.	+	.	ID=4853;Variant_seq=A;Dbxref=dbSNP_129:rs19954048;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044534.1	dbSNP	SNV	2432	2432	.	+	.	ID=4854;Variant_seq=G;Dbxref=dbSNP_129:rs19954058;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02044534.1	dbSNP	SNV	2439	2439	.	+	.	ID=4855;Variant_seq=C;Dbxref=dbSNP_129:rs19954068;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044534.1	dbSNP	SNV	2445	2445	.	+	.	ID=4856;Variant_seq=T;Dbxref=dbSNP_129:rs19954078;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399017.1	dbSNP	SNV	1777	1777	.	+	.	ID=4857;Variant_seq=A;Dbxref=dbSNP_129:rs20890896;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399017.1	dbSNP	SNV	3118	3118	.	+	.	ID=4858;Variant_seq=A;Dbxref=dbSNP_129:rs53428414;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399017.1	dbSNP	SNV	4741	4741	.	+	.	ID=4859;Variant_seq=T;Dbxref=dbSNP_129:rs53347464;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399017.1	dbSNP	SNV	4756	4756	.	+	.	ID=4860;Variant_seq=A;Dbxref=dbSNP_129:rs54273749;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399017.1	dbSNP	SNV	4805	4805	.	+	.	ID=4861;Variant_seq=T;Dbxref=dbSNP_129:rs53863997;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399017.1	dbSNP	SNV	4814	4814	.	+	.	ID=4862;Variant_seq=T;Dbxref=dbSNP_129:rs53625945;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399017.1	dbSNP	SNV	4818	4818	.	+	.	ID=4863;Variant_seq=A;Dbxref=dbSNP_129:rs52897195;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399017.1	dbSNP	SNV	4819	4819	.	+	.	ID=4864;Variant_seq=G;Dbxref=dbSNP_129:rs53289025;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399017.1	dbSNP	SNV	4828	4828	.	+	.	ID=4865;Variant_seq=T;Dbxref=dbSNP_129:rs53410980;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399017.1	dbSNP	SNV	4831	4831	.	+	.	ID=4866;Variant_seq=A;Dbxref=dbSNP_129:rs52944232;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399017.1	dbSNP	SNV	4832	4832	.	+	.	ID=4867;Variant_seq=T;Dbxref=dbSNP_129:rs53259215;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399017.1	dbSNP	SNV	4833	4833	.	+	.	ID=4868;Variant_seq=T;Dbxref=dbSNP_129:rs53406831;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399017.1	dbSNP	SNV	4833	4833	.	+	.	ID=4869;Variant_seq=T;Dbxref=dbSNP_129:rs53511960;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399017.1	dbSNP	deletion	4839	4839	.	+	.	ID=4870;Variant_seq=-;Dbxref=dbSNP_129:rs54353110;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399017.1	dbSNP	SNV	4840	4840	.	+	.	ID=4871;Variant_seq=C;Dbxref=dbSNP_129:rs53463857;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399017.1	dbSNP	SNV	4841	4841	.	+	.	ID=4872;Variant_seq=C;Dbxref=dbSNP_129:rs53471079;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399017.1	dbSNP	SNV	4841	4841	.	+	.	ID=4873;Variant_seq=C;Dbxref=dbSNP_129:rs53634191;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399017.1	dbSNP	SNV	4843	4843	.	+	.	ID=4874;Variant_seq=T;Dbxref=dbSNP_129:rs54069956;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399017.1	dbSNP	SNV	4844	4844	.	+	.	ID=4875;Variant_seq=G;Dbxref=dbSNP_129:rs54409803;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399017.1	dbSNP	SNV	4844	4844	.	+	.	ID=4876;Variant_seq=G;Dbxref=dbSNP_129:rs54001281;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399017.1	dbSNP	SNV	4855	4855	.	+	.	ID=4877;Variant_seq=A;Dbxref=dbSNP_129:rs53650322;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399017.1	dbSNP	SNV	4858	4858	.	+	.	ID=4878;Variant_seq=C;Dbxref=dbSNP_129:rs53268086;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399017.1	dbSNP	SNV	4864	4864	.	+	.	ID=4879;Variant_seq=G;Dbxref=dbSNP_129:rs52929424;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399017.1	dbSNP	SNV	4869	4869	.	+	.	ID=4880;Variant_seq=G;Dbxref=dbSNP_129:rs54167724;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02041196.1	dbSNP	SNV	4606	4606	.	+	.	ID=4881;Variant_seq=G;Dbxref=dbSNP_129:rs21086388;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398424.1	dbSNP	SNV	1033	1033	.	+	.	ID=4882;Variant_seq=G;Dbxref=dbSNP_129:rs19697538;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398424.1	dbSNP	SNV	1368	1368	.	+	.	ID=4883;Variant_seq=T;Dbxref=dbSNP_129:rs53570510;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398424.1	dbSNP	SNV	1421	1421	.	+	.	ID=4884;Variant_seq=C;Dbxref=dbSNP_129:rs53526667;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398424.1	dbSNP	SNV	4857	4857	.	+	.	ID=4885;Variant_seq=T;Dbxref=dbSNP_129:rs53619892;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398424.1	dbSNP	SNV	4870	4870	.	+	.	ID=4886;Variant_seq=A;Dbxref=dbSNP_129:rs53941671;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398424.1	dbSNP	SNV	4871	4871	.	+	.	ID=4887;Variant_seq=G;Dbxref=dbSNP_129:rs53727521;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398424.1	dbSNP	SNV	4878	4878	.	+	.	ID=4888;Variant_seq=A;Dbxref=dbSNP_129:rs53946889;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398424.1	dbSNP	SNV	4884	4884	.	+	.	ID=4889;Variant_seq=T;Dbxref=dbSNP_129:rs52926392;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398424.1	dbSNP	SNV	4887	4887	.	+	.	ID=4890;Variant_seq=G;Dbxref=dbSNP_129:rs53652508;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398424.1	dbSNP	SNV	4911	4911	.	+	.	ID=4891;Variant_seq=C;Dbxref=dbSNP_129:rs53917080;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398424.1	dbSNP	SNV	4917	4917	.	+	.	ID=4892;Variant_seq=C;Dbxref=dbSNP_129:rs54325048;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398424.1	dbSNP	SNV	4920	4920	.	+	.	ID=4893;Variant_seq=A;Dbxref=dbSNP_129:rs53724574;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398424.1	dbSNP	SNV	4926	4926	.	+	.	ID=4894;Variant_seq=A;Dbxref=dbSNP_129:rs54055591;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398424.1	dbSNP	SNV	4983	4983	.	+	.	ID=4895;Variant_seq=G;Dbxref=dbSNP_129:rs53464986;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398424.1	dbSNP	SNV	4986	4986	.	+	.	ID=4896;Variant_seq=G;Dbxref=dbSNP_129:rs53698152;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398424.1	dbSNP	SNV	4989	4989	.	+	.	ID=4897;Variant_seq=G;Dbxref=dbSNP_129:rs54259406;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398424.1	dbSNP	SNV	4990	4990	.	+	.	ID=4898;Variant_seq=T;Dbxref=dbSNP_129:rs53587991;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398424.1	dbSNP	SNV	5033	5033	.	+	.	ID=4899;Variant_seq=G;Dbxref=dbSNP_129:rs53112180;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398424.1	dbSNP	SNV	5034	5034	.	+	.	ID=4900;Variant_seq=T;Dbxref=dbSNP_129:rs52948888;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398424.1	dbSNP	SNV	5277	5277	.	+	.	ID=4901;Variant_seq=T;Dbxref=dbSNP_129:rs19260427;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398424.1	dbSNP	SNV	10595	10595	.	+	.	ID=4902;Variant_seq=G;Dbxref=dbSNP_129:rs19697538;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398424.1	dbSNP	SNV	10930	10930	.	+	.	ID=4903;Variant_seq=T;Dbxref=dbSNP_129:rs53570510;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398424.1	dbSNP	SNV	10983	10983	.	+	.	ID=4904;Variant_seq=C;Dbxref=dbSNP_129:rs53526667;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045973.1	dbSNP	SNV	1214	1214	.	+	.	ID=4905;Variant_seq=C;Dbxref=dbSNP_129:rs19405962;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399051.1	dbSNP	SNV	1121	1121	.	+	.	ID=4906;Variant_seq=G;Dbxref=dbSNP_129:rs20297590;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399051.1	dbSNP	SNV	1131	1131	.	+	.	ID=4907;Variant_seq=T;Dbxref=dbSNP_129:rs20297580;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399051.1	dbSNP	SNV	1138	1138	.	+	.	ID=4908;Variant_seq=T;Dbxref=dbSNP_129:rs20297570;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399051.1	dbSNP	SNV	1140	1140	.	+	.	ID=4909;Variant_seq=T;Dbxref=dbSNP_129:rs20297560;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399051.1	dbSNP	SNV	1155	1155	.	+	.	ID=4910;Variant_seq=C;Dbxref=dbSNP_129:rs20297540;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399051.1	dbSNP	SNV	1173	1173	.	+	.	ID=4911;Variant_seq=A;Dbxref=dbSNP_129:rs20297520;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399051.1	dbSNP	SNV	1174	1174	.	+	.	ID=4912;Variant_seq=A;Dbxref=dbSNP_129:rs20297510;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399051.1	dbSNP	SNV	1179	1179	.	+	.	ID=4913;Variant_seq=A;Dbxref=dbSNP_129:rs20297490;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399051.1	dbSNP	SNV	1180	1180	.	+	.	ID=4914;Variant_seq=G;Dbxref=dbSNP_129:rs20297480;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399051.1	dbSNP	SNV	1197	1197	.	+	.	ID=4915;Variant_seq=T;Dbxref=dbSNP_129:rs20297470;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399051.1	dbSNP	SNV	1201	1201	.	+	.	ID=4916;Variant_seq=T;Dbxref=dbSNP_129:rs20297460;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399051.1	dbSNP	SNV	1203	1203	.	+	.	ID=4917;Variant_seq=C;Dbxref=dbSNP_129:rs20297450;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399051.1	dbSNP	SNV	1205	1205	.	+	.	ID=4918;Variant_seq=T;Dbxref=dbSNP_129:rs20297440;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399051.1	dbSNP	SNV	3104	3104	.	+	.	ID=4919;Variant_seq=A;Dbxref=dbSNP_129:rs18868461;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399051.1	dbSNP	SNV	3106	3106	.	+	.	ID=4920;Variant_seq=C;Dbxref=dbSNP_129:rs18868471;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043727.1	dbSNP	SNV	2798	2798	.	+	.	ID=4921;Variant_seq=T;Dbxref=dbSNP_129:rs52958482;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400467.1	dbSNP	SNV	2201	2201	.	+	.	ID=4922;Variant_seq=C;Dbxref=dbSNP_129:rs21397216;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399756.1	dbSNP	SNV	310	310	.	+	.	ID=4923;Variant_seq=C;Dbxref=dbSNP_129:rs54147604;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH399756.1	dbSNP	SNV	313	313	.	+	.	ID=4924;Variant_seq=C;Dbxref=dbSNP_129:rs52983524;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH399756.1	dbSNP	SNV	314	314	.	+	.	ID=4925;Variant_seq=T;Dbxref=dbSNP_129:rs53580659;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399756.1	dbSNP	SNV	329	329	.	+	.	ID=4926;Variant_seq=T;Dbxref=dbSNP_129:rs52917546;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399756.1	dbSNP	SNV	331	331	.	+	.	ID=4927;Variant_seq=T;Dbxref=dbSNP_129:rs53843301;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399756.1	dbSNP	SNV	871	871	.	+	.	ID=4928;Variant_seq=G;Dbxref=dbSNP_129:rs53554764;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399756.1	dbSNP	SNV	894	894	.	+	.	ID=4929;Variant_seq=T;Dbxref=dbSNP_129:rs54364091;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH399756.1	dbSNP	SNV	3172	3172	.	+	.	ID=4930;Variant_seq=T;Dbxref=dbSNP_129:rs53589526;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043998.1	dbSNP	SNV	834	834	.	+	.	ID=4931;Variant_seq=A;Dbxref=dbSNP_129:rs54071838;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043998.1	dbSNP	SNV	900	900	.	+	.	ID=4932;Variant_seq=T;Dbxref=dbSNP_129:rs52913997;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02040987.1	dbSNP	SNV	1964	1964	.	+	.	ID=4933;Variant_seq=T;Dbxref=dbSNP_129:rs21771413;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040987.1	dbSNP	SNV	3598	3598	.	+	.	ID=4934;Variant_seq=C;Dbxref=dbSNP_129:rs19046099;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02037909.1	dbSNP	SNV	2320	2320	.	+	.	ID=4935;Variant_seq=C;Dbxref=dbSNP_129:rs53499916;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02037909.1	dbSNP	SNV	3287	3287	.	+	.	ID=4936;Variant_seq=C;Dbxref=dbSNP_129:rs54265821;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037909.1	dbSNP	SNV	3382	3382	.	+	.	ID=4937;Variant_seq=T;Dbxref=dbSNP_129:rs54041504;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398995.1	dbSNP	SNV	1394	1394	.	+	.	ID=4938;Variant_seq=T;Dbxref=dbSNP_129:rs18570956;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398995.1	dbSNP	SNV	1415	1415	.	+	.	ID=4939;Variant_seq=G;Dbxref=dbSNP_129:rs18570965;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043846.1	dbSNP	SNV	505	505	.	+	.	ID=4940;Variant_seq=A;Dbxref=dbSNP_129:rs20055709;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037713.1	dbSNP	SNV	1156	1156	.	+	.	ID=4941;Variant_seq=T;Dbxref=dbSNP_129:rs21019728;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037713.1	dbSNP	SNV	1273	1273	.	+	.	ID=4942;Variant_seq=A;Dbxref=dbSNP_129:rs21019678;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037713.1	dbSNP	SNV	1285	1285	.	+	.	ID=4943;Variant_seq=T;Dbxref=dbSNP_129:rs17890005;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02037713.1	dbSNP	SNV	1307	1307	.	+	.	ID=4944;Variant_seq=A;Dbxref=dbSNP_129:rs21019668;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037713.1	dbSNP	SNV	1319	1319	.	+	.	ID=4945;Variant_seq=T;Dbxref=dbSNP_129:rs21019658;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037713.1	dbSNP	SNV	1346	1346	.	+	.	ID=4946;Variant_seq=A;Dbxref=dbSNP_129:rs21019648;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02037713.1	dbSNP	SNV	2580	2580	.	+	.	ID=4947;Variant_seq=G;Dbxref=dbSNP_129:rs21037195;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02037713.1	dbSNP	SNV	2584	2584	.	+	.	ID=4948;Variant_seq=T;Dbxref=dbSNP_129:rs21037205;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02037713.1	dbSNP	SNV	2594	2594	.	+	.	ID=4949;Variant_seq=A;Dbxref=dbSNP_129:rs21037225;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037713.1	dbSNP	SNV	6320	6320	.	+	.	ID=4950;Variant_seq=C;Dbxref=dbSNP_129:rs20856353;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02037713.1	dbSNP	SNV	9130	9130	.	+	.	ID=4951;Variant_seq=T;Dbxref=dbSNP_129:rs53804870;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046933.1	dbSNP	SNV	153	153	.	+	.	ID=4952;Variant_seq=G;Dbxref=dbSNP_129:rs21506922;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046933.1	dbSNP	SNV	154	154	.	+	.	ID=4953;Variant_seq=T;Dbxref=dbSNP_129:rs21506912;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046933.1	dbSNP	SNV	159	159	.	+	.	ID=4954;Variant_seq=T;Dbxref=dbSNP_129:rs21506902;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046933.1	dbSNP	SNV	167	167	.	+	.	ID=4955;Variant_seq=G;Dbxref=dbSNP_129:rs21506892;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398839.1	dbSNP	SNV	351	351	.	+	.	ID=4956;Variant_seq=C;Dbxref=dbSNP_129:rs18153740;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398839.1	dbSNP	SNV	376	376	.	+	.	ID=4957;Variant_seq=A;Dbxref=dbSNP_129:rs18153695;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398839.1	dbSNP	SNV	447	447	.	+	.	ID=4958;Variant_seq=T;Dbxref=dbSNP_129:rs18153539;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398839.1	dbSNP	SNV	2433	2433	.	+	.	ID=4959;Variant_seq=A;Dbxref=dbSNP_129:rs20886832;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398839.1	dbSNP	SNV	2469	2469	.	+	.	ID=4960;Variant_seq=C;Dbxref=dbSNP_129:rs20886862;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398839.1	dbSNP	SNV	4224	4224	.	+	.	ID=4961;Variant_seq=C;Dbxref=dbSNP_129:rs19094849;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398367.1	dbSNP	SNV	3279	3279	.	+	.	ID=4962;Variant_seq=T;Dbxref=dbSNP_129:rs19616625;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398367.1	dbSNP	SNV	4885	4885	.	+	.	ID=4963;Variant_seq=C;Dbxref=dbSNP_129:rs18999166;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	5068	5068	.	+	.	ID=4964;Variant_seq=A;Dbxref=dbSNP_129:rs18998846;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398367.1	dbSNP	SNV	5294	5294	.	+	.	ID=4965;Variant_seq=C;Dbxref=dbSNP_129:rs18998189;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5295	5295	.	+	.	ID=4966;Variant_seq=C;Dbxref=dbSNP_129:rs18998179;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5300	5300	.	+	.	ID=4967;Variant_seq=C;Dbxref=dbSNP_129:rs18998149;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5301	5301	.	+	.	ID=4968;Variant_seq=T;Dbxref=dbSNP_129:rs18998139;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5303	5303	.	+	.	ID=4969;Variant_seq=T;Dbxref=dbSNP_129:rs18998129;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5304	5304	.	+	.	ID=4970;Variant_seq=A;Dbxref=dbSNP_129:rs18998119;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398367.1	dbSNP	SNV	5307	5307	.	+	.	ID=4971;Variant_seq=A;Dbxref=dbSNP_129:rs18998109;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398367.1	dbSNP	SNV	5310	5310	.	+	.	ID=4972;Variant_seq=G;Dbxref=dbSNP_129:rs18998089;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398367.1	dbSNP	SNV	5314	5314	.	+	.	ID=4973;Variant_seq=A;Dbxref=dbSNP_129:rs18998069;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398367.1	dbSNP	SNV	5315	5315	.	+	.	ID=4974;Variant_seq=C;Dbxref=dbSNP_129:rs18998059;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5317	5317	.	+	.	ID=4975;Variant_seq=C;Dbxref=dbSNP_129:rs18998049;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5319	5319	.	+	.	ID=4976;Variant_seq=G;Dbxref=dbSNP_129:rs18998039;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398367.1	dbSNP	SNV	5324	5324	.	+	.	ID=4977;Variant_seq=T;Dbxref=dbSNP_129:rs18998029;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398367.1	dbSNP	SNV	5325	5325	.	+	.	ID=4978;Variant_seq=C;Dbxref=dbSNP_129:rs18998019;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5329	5329	.	+	.	ID=4979;Variant_seq=G;Dbxref=dbSNP_129:rs18998009;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398367.1	dbSNP	SNV	5332	5332	.	+	.	ID=4980;Variant_seq=G;Dbxref=dbSNP_129:rs18997999;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	5350	5350	.	+	.	ID=4981;Variant_seq=T;Dbxref=dbSNP_129:rs18997979;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	5351	5351	.	+	.	ID=4982;Variant_seq=G;Dbxref=dbSNP_129:rs18997969;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	5352	5352	.	+	.	ID=4983;Variant_seq=T;Dbxref=dbSNP_129:rs18997959;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	5356	5356	.	+	.	ID=4984;Variant_seq=A;Dbxref=dbSNP_129:rs18997949;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398367.1	dbSNP	SNV	5361	5361	.	+	.	ID=4985;Variant_seq=C;Dbxref=dbSNP_129:rs18997929;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5366	5366	.	+	.	ID=4986;Variant_seq=C;Dbxref=dbSNP_129:rs18997919;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5368	5368	.	+	.	ID=4987;Variant_seq=A;Dbxref=dbSNP_129:rs18997909;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398367.1	dbSNP	SNV	5385	5385	.	+	.	ID=4988;Variant_seq=C;Dbxref=dbSNP_129:rs18997829;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5386	5386	.	+	.	ID=4989;Variant_seq=C;Dbxref=dbSNP_129:rs18997819;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5387	5387	.	+	.	ID=4990;Variant_seq=T;Dbxref=dbSNP_129:rs18997809;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	5388	5388	.	+	.	ID=4991;Variant_seq=T;Dbxref=dbSNP_129:rs18997799;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398367.1	dbSNP	SNV	5390	5390	.	+	.	ID=4992;Variant_seq=T;Dbxref=dbSNP_129:rs18997789;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398367.1	dbSNP	SNV	5392	5392	.	+	.	ID=4993;Variant_seq=G;Dbxref=dbSNP_129:rs18997779;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	5399	5399	.	+	.	ID=4994;Variant_seq=C;Dbxref=dbSNP_129:rs18997759;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	5410	5410	.	+	.	ID=4995;Variant_seq=C;Dbxref=dbSNP_129:rs18997749;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5411	5411	.	+	.	ID=4996;Variant_seq=T;Dbxref=dbSNP_129:rs18997739;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5412	5412	.	+	.	ID=4997;Variant_seq=C;Dbxref=dbSNP_129:rs18997729;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5414	5414	.	+	.	ID=4998;Variant_seq=C;Dbxref=dbSNP_129:rs18997719;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	5421	5421	.	+	.	ID=4999;Variant_seq=A;Dbxref=dbSNP_129:rs18997699;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5422	5422	.	+	.	ID=5000;Variant_seq=G;Dbxref=dbSNP_129:rs18997689;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398367.1	dbSNP	SNV	5425	5425	.	+	.	ID=5001;Variant_seq=C;Dbxref=dbSNP_129:rs18997679;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	5429	5429	.	+	.	ID=5002;Variant_seq=G;Dbxref=dbSNP_129:rs18997669;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398367.1	dbSNP	SNV	5432	5432	.	+	.	ID=5003;Variant_seq=C;Dbxref=dbSNP_129:rs18997659;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5434	5434	.	+	.	ID=5004;Variant_seq=C;Dbxref=dbSNP_129:rs18997649;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398367.1	dbSNP	SNV	5440	5440	.	+	.	ID=5005;Variant_seq=G;Dbxref=dbSNP_129:rs18997639;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398367.1	dbSNP	SNV	5441	5441	.	+	.	ID=5006;Variant_seq=A;Dbxref=dbSNP_129:rs18997629;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398367.1	dbSNP	SNV	5453	5453	.	+	.	ID=5007;Variant_seq=C;Dbxref=dbSNP_129:rs18997609;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5463	5463	.	+	.	ID=5008;Variant_seq=C;Dbxref=dbSNP_129:rs18997559;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398367.1	dbSNP	SNV	5465	5465	.	+	.	ID=5009;Variant_seq=G;Dbxref=dbSNP_129:rs18997549;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398367.1	dbSNP	SNV	5482	5482	.	+	.	ID=5010;Variant_seq=G;Dbxref=dbSNP_129:rs18997479;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398367.1	dbSNP	SNV	5483	5483	.	+	.	ID=5011;Variant_seq=G;Dbxref=dbSNP_129:rs18997469;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398367.1	dbSNP	SNV	5771	5771	.	+	.	ID=5012;Variant_seq=T;Dbxref=dbSNP_129:rs18996550;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	5774	5774	.	+	.	ID=5013;Variant_seq=T;Dbxref=dbSNP_129:rs18996540;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5780	5780	.	+	.	ID=5014;Variant_seq=C;Dbxref=dbSNP_129:rs18996500;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	5781	5781	.	+	.	ID=5015;Variant_seq=C;Dbxref=dbSNP_129:rs18996490;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	5782	5782	.	+	.	ID=5016;Variant_seq=T;Dbxref=dbSNP_129:rs18996480;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	5785	5785	.	+	.	ID=5017;Variant_seq=T;Dbxref=dbSNP_129:rs18996470;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	5793	5793	.	+	.	ID=5018;Variant_seq=C;Dbxref=dbSNP_129:rs18996450;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398367.1	dbSNP	SNV	5795	5795	.	+	.	ID=5019;Variant_seq=C;Dbxref=dbSNP_129:rs18996440;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398367.1	dbSNP	SNV	5797	5797	.	+	.	ID=5020;Variant_seq=T;Dbxref=dbSNP_129:rs18996430;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398367.1	dbSNP	SNV	5799	5799	.	+	.	ID=5021;Variant_seq=T;Dbxref=dbSNP_129:rs18996420;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	5804	5804	.	+	.	ID=5022;Variant_seq=C;Dbxref=dbSNP_129:rs18996400;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	5805	5805	.	+	.	ID=5023;Variant_seq=C;Dbxref=dbSNP_129:rs18996390;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398367.1	dbSNP	SNV	5813	5813	.	+	.	ID=5024;Variant_seq=T;Dbxref=dbSNP_129:rs18996330;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	15644	15644	.	+	.	ID=5025;Variant_seq=A;Dbxref=dbSNP_129:rs21466739;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	15681	15681	.	+	.	ID=5026;Variant_seq=A;Dbxref=dbSNP_129:rs18902507;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	15684	15684	.	+	.	ID=5027;Variant_seq=T;Dbxref=dbSNP_129:rs18902517;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	16018	16018	.	+	.	ID=5028;Variant_seq=T;Dbxref=dbSNP_129:rs21466799;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398367.1	dbSNP	SNV	20937	20937	.	+	.	ID=5029;Variant_seq=T;Dbxref=dbSNP_129:rs52942652;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	20942	20942	.	+	.	ID=5030;Variant_seq=A;Dbxref=dbSNP_129:rs53150562;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	20951	20951	.	+	.	ID=5031;Variant_seq=G;Dbxref=dbSNP_129:rs53937556;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398367.1	dbSNP	deletion	20962	20962	.	+	.	ID=5032;Variant_seq=-;Dbxref=dbSNP_129:rs53564764;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398367.1	dbSNP	SNV	20979	20979	.	+	.	ID=5033;Variant_seq=A;Dbxref=dbSNP_129:rs52851712;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398367.1	dbSNP	SNV	20980	20980	.	+	.	ID=5034;Variant_seq=A;Dbxref=dbSNP_129:rs54357255;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398367.1	dbSNP	SNV	20981	20981	.	+	.	ID=5035;Variant_seq=T;Dbxref=dbSNP_129:rs53011099;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398367.1	dbSNP	SNV	20992	20992	.	+	.	ID=5036;Variant_seq=C;Dbxref=dbSNP_129:rs53947679;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044219.1	dbSNP	SNV	722	722	.	+	.	ID=5037;Variant_seq=A;Dbxref=dbSNP_129:rs21474604;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400981.1	dbSNP	SNV	2031	2031	.	+	.	ID=5038;Variant_seq=A;Dbxref=dbSNP_129:rs19344153;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400981.1	dbSNP	SNV	2033	2033	.	+	.	ID=5039;Variant_seq=A;Dbxref=dbSNP_129:rs19344163;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400981.1	dbSNP	SNV	2091	2091	.	+	.	ID=5040;Variant_seq=G;Dbxref=dbSNP_129:rs19344303;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400254.1	dbSNP	SNV	1593	1593	.	+	.	ID=5041;Variant_seq=G;Dbxref=dbSNP_129:rs19849153;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400254.1	dbSNP	SNV	3040	3040	.	+	.	ID=5042;Variant_seq=T;Dbxref=dbSNP_129:rs20079746;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400254.1	dbSNP	SNV	3051	3051	.	+	.	ID=5043;Variant_seq=A;Dbxref=dbSNP_129:rs20079736;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400254.1	dbSNP	SNV	3056	3056	.	+	.	ID=5044;Variant_seq=C;Dbxref=dbSNP_129:rs20079726;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400254.1	dbSNP	SNV	3064	3064	.	+	.	ID=5045;Variant_seq=G;Dbxref=dbSNP_129:rs20079716;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400254.1	dbSNP	SNV	3071	3071	.	+	.	ID=5046;Variant_seq=T;Dbxref=dbSNP_129:rs20079696;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400254.1	dbSNP	SNV	3073	3073	.	+	.	ID=5047;Variant_seq=G;Dbxref=dbSNP_129:rs20079686;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400254.1	dbSNP	SNV	3074	3074	.	+	.	ID=5048;Variant_seq=T;Dbxref=dbSNP_129:rs20079676;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400254.1	dbSNP	SNV	3155	3155	.	+	.	ID=5049;Variant_seq=T;Dbxref=dbSNP_129:rs20079606;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400254.1	dbSNP	SNV	3158	3158	.	+	.	ID=5050;Variant_seq=T;Dbxref=dbSNP_129:rs20079596;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400254.1	dbSNP	SNV	3165	3165	.	+	.	ID=5051;Variant_seq=A;Dbxref=dbSNP_129:rs20079576;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400254.1	dbSNP	SNV	3170	3170	.	+	.	ID=5052;Variant_seq=C;Dbxref=dbSNP_129:rs20079566;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400254.1	dbSNP	SNV	3180	3180	.	+	.	ID=5053;Variant_seq=A;Dbxref=dbSNP_129:rs20079556;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400254.1	dbSNP	SNV	3183	3183	.	+	.	ID=5054;Variant_seq=C;Dbxref=dbSNP_129:rs20079546;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400254.1	dbSNP	SNV	3184	3184	.	+	.	ID=5055;Variant_seq=T;Dbxref=dbSNP_129:rs17888282;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400254.1	dbSNP	SNV	3186	3186	.	+	.	ID=5056;Variant_seq=T;Dbxref=dbSNP_129:rs20079536;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400254.1	dbSNP	SNV	3192	3192	.	+	.	ID=5057;Variant_seq=T;Dbxref=dbSNP_129:rs20079526;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400254.1	dbSNP	SNV	3194	3194	.	+	.	ID=5058;Variant_seq=T;Dbxref=dbSNP_129:rs20079516;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400254.1	dbSNP	SNV	3211	3211	.	+	.	ID=5059;Variant_seq=T;Dbxref=dbSNP_129:rs20079506;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400254.1	dbSNP	SNV	3216	3216	.	+	.	ID=5060;Variant_seq=G;Dbxref=dbSNP_129:rs20079496;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400254.1	dbSNP	SNV	3229	3229	.	+	.	ID=5061;Variant_seq=A;Dbxref=dbSNP_129:rs20079486;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400254.1	dbSNP	SNV	3236	3236	.	+	.	ID=5062;Variant_seq=G;Dbxref=dbSNP_129:rs20079476;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400254.1	dbSNP	SNV	3250	3250	.	+	.	ID=5063;Variant_seq=C;Dbxref=dbSNP_129:rs20079456;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400254.1	dbSNP	SNV	3297	3297	.	+	.	ID=5064;Variant_seq=C;Dbxref=dbSNP_129:rs20079436;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400254.1	dbSNP	SNV	3299	3299	.	+	.	ID=5065;Variant_seq=T;Dbxref=dbSNP_129:rs20079426;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400254.1	dbSNP	SNV	3300	3300	.	+	.	ID=5066;Variant_seq=C;Dbxref=dbSNP_129:rs20079416;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400254.1	dbSNP	SNV	3304	3304	.	+	.	ID=5067;Variant_seq=C;Dbxref=dbSNP_129:rs20079406;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400254.1	dbSNP	SNV	3309	3309	.	+	.	ID=5068;Variant_seq=T;Dbxref=dbSNP_129:rs20079386;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH400254.1	dbSNP	SNV	3319	3319	.	+	.	ID=5069;Variant_seq=T;Dbxref=dbSNP_129:rs20079366;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400254.1	dbSNP	SNV	3324	3324	.	+	.	ID=5070;Variant_seq=G;Dbxref=dbSNP_129:rs20079356;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400254.1	dbSNP	SNV	3325	3325	.	+	.	ID=5071;Variant_seq=A;Dbxref=dbSNP_129:rs20079346;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH400254.1	dbSNP	SNV	3336	3336	.	+	.	ID=5072;Variant_seq=A;Dbxref=dbSNP_129:rs20079326;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400254.1	dbSNP	SNV	3342	3342	.	+	.	ID=5073;Variant_seq=A;Dbxref=dbSNP_129:rs20079306;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400254.1	dbSNP	SNV	3346	3346	.	+	.	ID=5074;Variant_seq=T;Dbxref=dbSNP_129:rs20079286;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH400254.1	dbSNP	SNV	3347	3347	.	+	.	ID=5075;Variant_seq=T;Dbxref=dbSNP_129:rs20079276;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400254.1	dbSNP	SNV	3348	3348	.	+	.	ID=5076;Variant_seq=T;Dbxref=dbSNP_129:rs20079266;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398916.1	dbSNP	SNV	5280	5280	.	+	.	ID=5077;Variant_seq=T;Dbxref=dbSNP_129:rs21759887;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398916.1	dbSNP	SNV	5289	5289	.	+	.	ID=5078;Variant_seq=A;Dbxref=dbSNP_129:rs21759869;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398916.1	dbSNP	SNV	8338	8338	.	+	.	ID=5079;Variant_seq=A;Dbxref=dbSNP_129:rs19054751;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398916.1	dbSNP	SNV	8368	8368	.	+	.	ID=5080;Variant_seq=G;Dbxref=dbSNP_129:rs19054731;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043798.1	dbSNP	SNV	116	116	.	+	.	ID=5081;Variant_seq=T;Dbxref=dbSNP_129:rs20976109;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043798.1	dbSNP	SNV	140	140	.	+	.	ID=5082;Variant_seq=C;Dbxref=dbSNP_129:rs20976099;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043798.1	dbSNP	SNV	167	167	.	+	.	ID=5083;Variant_seq=A;Dbxref=dbSNP_129:rs20976089;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043798.1	dbSNP	SNV	268	268	.	+	.	ID=5084;Variant_seq=A;Dbxref=dbSNP_129:rs20976059;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043798.1	dbSNP	SNV	308	308	.	+	.	ID=5085;Variant_seq=T;Dbxref=dbSNP_129:rs20976039;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043798.1	dbSNP	SNV	1224	1224	.	+	.	ID=5086;Variant_seq=C;Dbxref=dbSNP_129:rs21356395;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043798.1	dbSNP	SNV	1746	1746	.	+	.	ID=5087;Variant_seq=T;Dbxref=dbSNP_129:rs53157794;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02043798.1	dbSNP	SNV	1750	1750	.	+	.	ID=5088;Variant_seq=C;Dbxref=dbSNP_129:rs53385918;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043798.1	dbSNP	SNV	1757	1757	.	+	.	ID=5089;Variant_seq=T;Dbxref=dbSNP_129:rs54332404;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043798.1	dbSNP	SNV	1759	1759	.	+	.	ID=5090;Variant_seq=A;Dbxref=dbSNP_129:rs53597141;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043798.1	dbSNP	deletion	1764	1764	.	+	.	ID=5091;Variant_seq=-;Dbxref=dbSNP_129:rs53063592;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043798.1	dbSNP	deletion	1790	1790	.	+	.	ID=5092;Variant_seq=-;Dbxref=dbSNP_129:rs53222136;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043798.1	dbSNP	SNV	1795	1795	.	+	.	ID=5093;Variant_seq=T;Dbxref=dbSNP_129:rs54204549;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043798.1	dbSNP	SNV	1796	1796	.	+	.	ID=5094;Variant_seq=G;Dbxref=dbSNP_129:rs53278722;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043798.1	dbSNP	deletion	1826	1826	.	+	.	ID=5095;Variant_seq=-;Dbxref=dbSNP_129:rs53319676;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02043798.1	dbSNP	SNV	1830	1830	.	+	.	ID=5096;Variant_seq=A;Dbxref=dbSNP_129:rs54003108;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02043798.1	dbSNP	insertion	1834	1834	.	+	.	ID=5097;Variant_seq=C;Dbxref=dbSNP_129:rs53459325;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02043798.1	dbSNP	SNV	1836	1836	.	+	.	ID=5098;Variant_seq=T;Dbxref=dbSNP_129:rs54180998;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398453.1	dbSNP	SNV	3058	3058	.	+	.	ID=5099;Variant_seq=C;Dbxref=dbSNP_129:rs53423647;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398453.1	dbSNP	SNV	3076	3076	.	+	.	ID=5100;Variant_seq=A;Dbxref=dbSNP_129:rs53558260;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398453.1	dbSNP	SNV	3082	3082	.	+	.	ID=5101;Variant_seq=C;Dbxref=dbSNP_129:rs18767354;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398453.1	dbSNP	SNV	3122	3122	.	+	.	ID=5102;Variant_seq=A;Dbxref=dbSNP_129:rs53294799;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398453.1	dbSNP	SNV	3155	3155	.	+	.	ID=5103;Variant_seq=T;Dbxref=dbSNP_129:rs54071141;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH398453.1	dbSNP	SNV	3587	3587	.	+	.	ID=5104;Variant_seq=T;Dbxref=dbSNP_129:rs53042454;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398453.1	dbSNP	SNV	6131	6131	.	+	.	ID=5105;Variant_seq=T;Dbxref=dbSNP_129:rs19137930;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398453.1	dbSNP	SNV	6697	6697	.	+	.	ID=5106;Variant_seq=C;Dbxref=dbSNP_129:rs18271897;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398453.1	dbSNP	SNV	13374	13374	.	+	.	ID=5107;Variant_seq=A;Dbxref=dbSNP_129:rs53887307;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
CH398453.1	dbSNP	SNV	13430	13430	.	+	.	ID=5108;Variant_seq=T;Dbxref=dbSNP_129:rs53678743;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
CH398453.1	dbSNP	SNV	13485	13485	.	+	.	ID=5109;Variant_seq=C;Dbxref=dbSNP_129:rs53091887;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045069.1	dbSNP	SNV	2697	2697	.	+	.	ID=5110;Variant_seq=C;Dbxref=dbSNP_129:rs54054090;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045069.1	dbSNP	SNV	2712	2712	.	+	.	ID=5111;Variant_seq=T;Dbxref=dbSNP_129:rs18076106;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045069.1	dbSNP	SNV	2725	2725	.	+	.	ID=5112;Variant_seq=C;Dbxref=dbSNP_129:rs53589887;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045069.1	dbSNP	deletion	2744	2744	.	+	.	ID=5113;Variant_seq=-;Dbxref=dbSNP_129:rs54130434;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045069.1	dbSNP	deletion	2751	2755	.	+	.	ID=5114;Variant_seq=-;Dbxref=dbSNP_129:rs54232190;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=TTTTG
AAAA02045069.1	dbSNP	deletion	2761	2762	.	+	.	ID=5115;Variant_seq=-;Dbxref=dbSNP_129:rs52982289;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=GT
AAAA02045069.1	dbSNP	SNV	2770	2770	.	+	.	ID=5116;Variant_seq=T;Dbxref=dbSNP_129:rs54341796;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045069.1	dbSNP	SNV	2776	2776	.	+	.	ID=5117;Variant_seq=A;Dbxref=dbSNP_129:rs53666800;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045069.1	dbSNP	SNV	2779	2779	.	+	.	ID=5118;Variant_seq=A;Dbxref=dbSNP_129:rs53722155;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045069.1	dbSNP	insertion	2784	2784	.	+	.	ID=5119;Variant_seq=A;Dbxref=dbSNP_129:rs53545127;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
AAAA02045069.1	dbSNP	SNV	2790	2790	.	+	.	ID=5120;Variant_seq=A;Dbxref=dbSNP_129:rs54175705;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02045069.1	dbSNP	SNV	2805	2805	.	+	.	ID=5121;Variant_seq=T;Dbxref=dbSNP_129:rs53056883;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045069.1	dbSNP	SNV	2884	2884	.	+	.	ID=5122;Variant_seq=G;Dbxref=dbSNP_129:rs53830073;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045069.1	dbSNP	SNV	2906	2906	.	+	.	ID=5123;Variant_seq=G;Dbxref=dbSNP_129:rs53671030;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045069.1	dbSNP	SNV	2925	2925	.	+	.	ID=5124;Variant_seq=A;Dbxref=dbSNP_129:rs54269598;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045069.1	dbSNP	SNV	2930	2930	.	+	.	ID=5125;Variant_seq=C;Dbxref=dbSNP_129:rs52884968;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045069.1	dbSNP	SNV	2931	2931	.	+	.	ID=5126;Variant_seq=C;Dbxref=dbSNP_129:rs53610189;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02045069.1	dbSNP	SNV	2934	2934	.	+	.	ID=5127;Variant_seq=A;Dbxref=dbSNP_129:rs53898684;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040015.1	dbSNP	SNV	4620	4620	.	+	.	ID=5128;Variant_seq=C;Dbxref=dbSNP_129:rs21599758;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
CH398390.1	dbSNP	insertion	15901	15901	.	+	.	ID=5129;Variant_seq=CAG;Dbxref=dbSNP_129:rs54299094;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=-
CH398390.1	dbSNP	SNV	15969	15969	.	+	.	ID=5130;Variant_seq=C;Dbxref=dbSNP_129:rs53939911;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02045415.1	dbSNP	SNV	1672	1672	.	+	.	ID=5131;Variant_seq=A;Dbxref=dbSNP_129:rs21392536;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045415.1	dbSNP	SNV	2176	2176	.	+	.	ID=5132;Variant_seq=A;Dbxref=dbSNP_129:rs21392196;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02045415.1	dbSNP	SNV	2187	2187	.	+	.	ID=5133;Variant_seq=A;Dbxref=dbSNP_129:rs21392186;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH399233.1	dbSNP	SNV	3275	3275	.	+	.	ID=5134;Variant_seq=A,C;Dbxref=dbSNP_129:rs17892400;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038701.1	dbSNP	SNV	1587	1587	.	+	.	ID=5135;Variant_seq=A;Dbxref=dbSNP_129:rs20710482;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038701.1	dbSNP	SNV	2103	2103	.	+	.	ID=5136;Variant_seq=A;Dbxref=dbSNP_129:rs21393960;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038701.1	dbSNP	SNV	3589	3589	.	+	.	ID=5137;Variant_seq=T;Dbxref=dbSNP_129:rs18569004;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038701.1	dbSNP	SNV	4486	4486	.	+	.	ID=5138;Variant_seq=T;Dbxref=dbSNP_129:rs21393210;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02038701.1	dbSNP	SNV	4505	4505	.	+	.	ID=5139;Variant_seq=C;Dbxref=dbSNP_129:rs21393190;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02038701.1	dbSNP	SNV	6579	6579	.	+	.	ID=5140;Variant_seq=A;Dbxref=dbSNP_129:rs21392180;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039679.1	dbSNP	SNV	460	460	.	+	.	ID=5141;Variant_seq=T;Dbxref=dbSNP_129:rs21588410;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039679.1	dbSNP	SNV	2966	2966	.	+	.	ID=5142;Variant_seq=A;Dbxref=dbSNP_129:rs20320352;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02044715.1	dbSNP	SNV	872	872	.	+	.	ID=5143;Variant_seq=T;Dbxref=dbSNP_129:rs20333106;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039266.1	dbSNP	SNV	325	325	.	+	.	ID=5144;Variant_seq=G;Dbxref=dbSNP_129:rs20142639;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039266.1	dbSNP	SNV	442	442	.	+	.	ID=5145;Variant_seq=A;Dbxref=dbSNP_129:rs20142629;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039266.1	dbSNP	SNV	584	584	.	+	.	ID=5146;Variant_seq=A;Dbxref=dbSNP_129:rs20142599;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039266.1	dbSNP	SNV	670	670	.	+	.	ID=5147;Variant_seq=A;Dbxref=dbSNP_129:rs20142569;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039266.1	dbSNP	SNV	1515	1515	.	+	.	ID=5148;Variant_seq=C;Dbxref=dbSNP_129:rs20142540;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039266.1	dbSNP	SNV	1629	1629	.	+	.	ID=5149;Variant_seq=C;Dbxref=dbSNP_129:rs20142501;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039266.1	dbSNP	SNV	2161	2161	.	+	.	ID=5150;Variant_seq=C;Dbxref=dbSNP_129:rs20142461;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039266.1	dbSNP	SNV	2364	2364	.	+	.	ID=5151;Variant_seq=A;Dbxref=dbSNP_129:rs20142441;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039266.1	dbSNP	SNV	2378	2378	.	+	.	ID=5152;Variant_seq=A;Dbxref=dbSNP_129:rs20142431;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039266.1	dbSNP	SNV	2609	2609	.	+	.	ID=5153;Variant_seq=A;Dbxref=dbSNP_129:rs20133265;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039266.1	dbSNP	SNV	2686	2686	.	+	.	ID=5154;Variant_seq=G;Dbxref=dbSNP_129:rs20142391;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039266.1	dbSNP	SNV	2690	2690	.	+	.	ID=5155;Variant_seq=A;Dbxref=dbSNP_129:rs20142381;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039266.1	dbSNP	SNV	2904	2904	.	+	.	ID=5156;Variant_seq=C;Dbxref=dbSNP_129:rs20142351;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039266.1	dbSNP	SNV	2917	2917	.	+	.	ID=5157;Variant_seq=G;Dbxref=dbSNP_129:rs20142341;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039266.1	dbSNP	SNV	2966	2966	.	+	.	ID=5158;Variant_seq=T;Dbxref=dbSNP_129:rs20142321;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039266.1	dbSNP	SNV	3097	3097	.	+	.	ID=5159;Variant_seq=C;Dbxref=dbSNP_129:rs20142301;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039266.1	dbSNP	SNV	3236	3236	.	+	.	ID=5160;Variant_seq=T;Dbxref=dbSNP_129:rs20142291;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039266.1	dbSNP	SNV	3763	3763	.	+	.	ID=5161;Variant_seq=T;Dbxref=dbSNP_129:rs20133005;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039266.1	dbSNP	SNV	3833	3833	.	+	.	ID=5162;Variant_seq=A;Dbxref=dbSNP_129:rs20132995;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039266.1	dbSNP	SNV	3864	3864	.	+	.	ID=5163;Variant_seq=C;Dbxref=dbSNP_129:rs20132985;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039266.1	dbSNP	SNV	4608	4608	.	+	.	ID=5164;Variant_seq=A;Dbxref=dbSNP_129:rs20134684;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039266.1	dbSNP	SNV	4608	4608	.	+	.	ID=5165;Variant_seq=A;Dbxref=dbSNP_129:rs20142111;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039266.1	dbSNP	SNV	4831	4831	.	+	.	ID=5166;Variant_seq=T;Dbxref=dbSNP_129:rs20142101;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039266.1	dbSNP	SNV	4953	4953	.	+	.	ID=5167;Variant_seq=G;Dbxref=dbSNP_129:rs20142091;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039266.1	dbSNP	SNV	5216	5216	.	+	.	ID=5168;Variant_seq=C;Dbxref=dbSNP_129:rs20142012;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039266.1	dbSNP	SNV	5316	5316	.	+	.	ID=5169;Variant_seq=A;Dbxref=dbSNP_129:rs20141982;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039266.1	dbSNP	SNV	5393	5393	.	+	.	ID=5170;Variant_seq=C;Dbxref=dbSNP_129:rs20141972;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039266.1	dbSNP	SNV	5406	5406	.	+	.	ID=5171;Variant_seq=T;Dbxref=dbSNP_129:rs20141962;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039266.1	dbSNP	SNV	5510	5510	.	+	.	ID=5172;Variant_seq=T;Dbxref=dbSNP_129:rs20141952;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039266.1	dbSNP	SNV	5625	5625	.	+	.	ID=5173;Variant_seq=G;Dbxref=dbSNP_129:rs20141912;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039266.1	dbSNP	SNV	5700	5700	.	+	.	ID=5174;Variant_seq=G;Dbxref=dbSNP_129:rs20141892;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039266.1	dbSNP	SNV	5701	5701	.	+	.	ID=5175;Variant_seq=G;Dbxref=dbSNP_129:rs20141882;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039266.1	dbSNP	SNV	5767	5767	.	+	.	ID=5176;Variant_seq=T;Dbxref=dbSNP_129:rs20141872;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039266.1	dbSNP	SNV	5805	5805	.	+	.	ID=5177;Variant_seq=T;Dbxref=dbSNP_129:rs20141852;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039266.1	dbSNP	SNV	5835	5835	.	+	.	ID=5178;Variant_seq=A;Dbxref=dbSNP_129:rs20141842;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039266.1	dbSNP	SNV	6038	6038	.	+	.	ID=5179;Variant_seq=A;Dbxref=dbSNP_129:rs20141822;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039266.1	dbSNP	SNV	6060	6060	.	+	.	ID=5180;Variant_seq=G;Dbxref=dbSNP_129:rs20141802;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039266.1	dbSNP	SNV	6157	6157	.	+	.	ID=5181;Variant_seq=T;Dbxref=dbSNP_129:rs20141772;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02039266.1	dbSNP	SNV	6215	6215	.	+	.	ID=5182;Variant_seq=G;Dbxref=dbSNP_129:rs20141762;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039266.1	dbSNP	SNV	6254	6254	.	+	.	ID=5183;Variant_seq=A;Dbxref=dbSNP_129:rs20141752;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02039266.1	dbSNP	SNV	6261	6261	.	+	.	ID=5184;Variant_seq=T;Dbxref=dbSNP_129:rs20141742;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02039266.1	dbSNP	SNV	6262	6262	.	+	.	ID=5185;Variant_seq=T;Dbxref=dbSNP_129:rs20141732;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02039266.1	dbSNP	SNV	6446	6446	.	+	.	ID=5186;Variant_seq=C;Dbxref=dbSNP_129:rs20141503;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02040859.1	dbSNP	SNV	1887	1887	.	+	.	ID=5187;Variant_seq=G;Dbxref=dbSNP_129:rs20907464;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02040859.1	dbSNP	SNV	2295	2295	.	+	.	ID=5188;Variant_seq=C;Dbxref=dbSNP_129:rs21570900;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02040859.1	dbSNP	SNV	2308	2308	.	+	.	ID=5189;Variant_seq=A;Dbxref=dbSNP_129:rs21570910;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02040859.1	dbSNP	SNV	4467	4467	.	+	.	ID=5190;Variant_seq=T;Dbxref=dbSNP_129:rs19433413;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044348.1	dbSNP	SNV	1030	1030	.	+	.	ID=5191;Variant_seq=C;Dbxref=dbSNP_129:rs19408917;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02044348.1	dbSNP	SNV	1715	1715	.	+	.	ID=5192;Variant_seq=A;Dbxref=dbSNP_129:rs20686795;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02044348.1	dbSNP	SNV	1716	1716	.	+	.	ID=5193;Variant_seq=T;Dbxref=dbSNP_129:rs20686805;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048484.1	dbSNP	SNV	910	910	.	+	.	ID=5194;Variant_seq=T;Dbxref=dbSNP_129:rs19705202;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02048484.1	dbSNP	SNV	1946	1946	.	+	.	ID=5195;Variant_seq=T;Dbxref=dbSNP_129:rs19388796;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02048484.1	dbSNP	SNV	2102	2102	.	+	.	ID=5196;Variant_seq=T;Dbxref=dbSNP_129:rs19388786;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043819.1	dbSNP	SNV	927	927	.	+	.	ID=5197;Variant_seq=A;Dbxref=dbSNP_129:rs18973964;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02043819.1	dbSNP	SNV	1507	1507	.	+	.	ID=5198;Variant_seq=G;Dbxref=dbSNP_129:rs18783256;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048498.1	dbSNP	SNV	1275	1275	.	+	.	ID=5199;Variant_seq=T;Dbxref=dbSNP_129:rs19087673;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048498.1	dbSNP	SNV	1311	1311	.	+	.	ID=5200;Variant_seq=T;Dbxref=dbSNP_129:rs18895744;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02048498.1	dbSNP	SNV	1324	1324	.	+	.	ID=5201;Variant_seq=A;Dbxref=dbSNP_129:rs18895754;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02048498.1	dbSNP	SNV	1373	1373	.	+	.	ID=5202;Variant_seq=A;Dbxref=dbSNP_129:rs18895844;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
CH400083.1	dbSNP	SNV	3145	3145	.	+	.	ID=5203;Variant_seq=C;Dbxref=dbSNP_129:rs52896737;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046999.1	dbSNP	SNV	1844	1844	.	+	.	ID=5204;Variant_seq=A,T;Dbxref=dbSNP_129:rs54113795;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
AAAA02046999.1	dbSNP	SNV	1849	1849	.	+	.	ID=5205;Variant_seq=A;Dbxref=dbSNP_129:rs53343367;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
AAAA02046999.1	dbSNP	SNV	1855	1855	.	+	.	ID=5206;Variant_seq=G;Dbxref=dbSNP_129:rs53449327;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046999.1	dbSNP	SNV	1856	1856	.	+	.	ID=5207;Variant_seq=G;Dbxref=dbSNP_129:rs53977872;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046999.1	dbSNP	SNV	1864	1864	.	+	.	ID=5208;Variant_seq=G;Dbxref=dbSNP_129:rs54265030;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
AAAA02046999.1	dbSNP	SNV	1866	1866	.	+	.	ID=5209;Variant_seq=A,C;Dbxref=dbSNP_129:rs53621035;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
AAAA02046999.1	dbSNP	SNV	1873	1873	.	+	.	ID=5210;Variant_seq=A;Dbxref=dbSNP_129:rs53639459;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
3	dbSNP	SNV	1298	1298	.	+	.	ID=5211;Variant_seq=G;Dbxref=dbSNP_129:rs18785442;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	1313	1313	.	+	.	ID=5212;Variant_seq=A;Dbxref=dbSNP_129:rs18785451;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
3	dbSNP	SNV	1335	1335	.	+	.	ID=5213;Variant_seq=A;Dbxref=dbSNP_129:rs18785467;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
3	dbSNP	SNV	1336	1336	.	+	.	ID=5214;Variant_seq=G;Dbxref=dbSNP_129:rs18785475;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
3	dbSNP	SNV	1337	1337	.	+	.	ID=5215;Variant_seq=T;Dbxref=dbSNP_129:rs18785483;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
3	dbSNP	SNV	1342	1342	.	+	.	ID=5216;Variant_seq=A;Dbxref=dbSNP_129:rs18785491;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
3	dbSNP	SNV	1347	1347	.	+	.	ID=5217;Variant_seq=A;Dbxref=dbSNP_129:rs18785499;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
3	dbSNP	SNV	1349	1349	.	+	.	ID=5218;Variant_seq=A;Dbxref=dbSNP_129:rs18785507;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
3	dbSNP	SNV	1445	1445	.	+	.	ID=5219;Variant_seq=C;Dbxref=dbSNP_129:rs18785539;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
3	dbSNP	SNV	1446	1446	.	+	.	ID=5220;Variant_seq=G;Dbxref=dbSNP_129:rs18785547;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
3	dbSNP	SNV	1448	1448	.	+	.	ID=5221;Variant_seq=G;Dbxref=dbSNP_129:rs18785555;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	1463	1463	.	+	.	ID=5222;Variant_seq=T;Dbxref=dbSNP_129:rs18785571;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
3	dbSNP	SNV	1466	1466	.	+	.	ID=5223;Variant_seq=A;Dbxref=dbSNP_129:rs18785579;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
3	dbSNP	SNV	1481	1481	.	+	.	ID=5224;Variant_seq=T;Dbxref=dbSNP_129:rs18785586;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	1484	1484	.	+	.	ID=5225;Variant_seq=C;Dbxref=dbSNP_129:rs18785610;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	1485	1485	.	+	.	ID=5226;Variant_seq=T;Dbxref=dbSNP_129:rs18785619;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
3	dbSNP	SNV	1490	1490	.	+	.	ID=5227;Variant_seq=A;Dbxref=dbSNP_129:rs18785628;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
3	dbSNP	SNV	1495	1495	.	+	.	ID=5228;Variant_seq=G;Dbxref=dbSNP_129:rs18785635;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
3	dbSNP	SNV	1496	1496	.	+	.	ID=5229;Variant_seq=G;Dbxref=dbSNP_129:rs18785644;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	1497	1497	.	+	.	ID=5230;Variant_seq=G;Dbxref=dbSNP_129:rs18785651;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	1498	1498	.	+	.	ID=5231;Variant_seq=C;Dbxref=dbSNP_129:rs18785659;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	1508	1508	.	+	.	ID=5232;Variant_seq=T;Dbxref=dbSNP_129:rs18785667;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
3	dbSNP	SNV	1509	1509	.	+	.	ID=5233;Variant_seq=T;Dbxref=dbSNP_129:rs18785674;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
3	dbSNP	SNV	1522	1522	.	+	.	ID=5234;Variant_seq=T;Dbxref=dbSNP_129:rs18785691;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
3	dbSNP	SNV	1525	1525	.	+	.	ID=5235;Variant_seq=C;Dbxref=dbSNP_129:rs18785699;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
3	dbSNP	SNV	1526	1526	.	+	.	ID=5236;Variant_seq=A;Dbxref=dbSNP_129:rs18785707;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
3	dbSNP	SNV	1528	1528	.	+	.	ID=5237;Variant_seq=G;Dbxref=dbSNP_129:rs18785715;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
3	dbSNP	SNV	1533	1533	.	+	.	ID=5238;Variant_seq=A;Dbxref=dbSNP_129:rs18785731;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
3	dbSNP	SNV	1537	1537	.	+	.	ID=5239;Variant_seq=C;Dbxref=dbSNP_129:rs18785747;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	1539	1539	.	+	.	ID=5240;Variant_seq=C;Dbxref=dbSNP_129:rs18785754;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	1543	1543	.	+	.	ID=5241;Variant_seq=T;Dbxref=dbSNP_129:rs18785762;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
3	dbSNP	SNV	1544	1544	.	+	.	ID=5242;Variant_seq=G;Dbxref=dbSNP_129:rs18785770;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	1545	1545	.	+	.	ID=5243;Variant_seq=T;Dbxref=dbSNP_129:rs18785778;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	1549	1549	.	+	.	ID=5244;Variant_seq=T;Dbxref=dbSNP_129:rs18785794;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
3	dbSNP	SNV	1550	1550	.	+	.	ID=5245;Variant_seq=G;Dbxref=dbSNP_129:rs18785802;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	2114	2114	.	+	.	ID=5246;Variant_seq=A;Dbxref=dbSNP_129:rs18786169;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
3	dbSNP	SNV	2115	2115	.	+	.	ID=5247;Variant_seq=C;Dbxref=dbSNP_129:rs18786177;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
3	dbSNP	SNV	2153	2153	.	+	.	ID=5248;Variant_seq=A;Dbxref=dbSNP_129:rs18786185;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
3	dbSNP	SNV	2156	2156	.	+	.	ID=5249;Variant_seq=G;Dbxref=dbSNP_129:rs18786201;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	2158	2158	.	+	.	ID=5250;Variant_seq=A;Dbxref=dbSNP_129:rs18786210;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
3	dbSNP	SNV	25224	25224	.	+	.	ID=5251;Variant_seq=A;Dbxref=dbSNP_129:rs53559203;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
3	dbSNP	SNV	25556	25556	.	+	.	ID=5252;Variant_seq=A;Dbxref=dbSNP_129:rs53778788;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
3	dbSNP	SNV	25557	25557	.	+	.	ID=5253;Variant_seq=G;Dbxref=dbSNP_129:rs53672200;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	25829	25829	.	+	.	ID=5254;Variant_seq=A;Dbxref=dbSNP_129:rs21768603;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
3	dbSNP	SNV	25834	25834	.	+	.	ID=5255;Variant_seq=C;Dbxref=dbSNP_129:rs21530198;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	28689	28689	.	+	.	ID=5256;Variant_seq=A;Dbxref=dbSNP_129:rs20338026;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
3	dbSNP	SNV	29677	29677	.	+	.	ID=5257;Variant_seq=T;Dbxref=dbSNP_129:rs17980165;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
3	dbSNP	SNV	31502	31502	.	+	.	ID=5258;Variant_seq=A;Dbxref=dbSNP_129:rs18086263;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
3	dbSNP	SNV	42152	42152	.	+	.	ID=5259;Variant_seq=T;Dbxref=dbSNP_129:rs18786323;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	42160	42160	.	+	.	ID=5260;Variant_seq=C;Dbxref=dbSNP_129:rs18786331;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	55449	55449	.	+	.	ID=5261;Variant_seq=A;Dbxref=dbSNP_129:rs53456399;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=G
3	dbSNP	SNV	55452	55452	.	+	.	ID=5262;Variant_seq=G;Dbxref=dbSNP_129:rs53123389;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	55452	55452	.	+	.	ID=5263;Variant_seq=G;Dbxref=dbSNP_129:rs19425884;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=A
3	dbSNP	SNV	55453	55453	.	+	.	ID=5264;Variant_seq=C;Dbxref=dbSNP_129:rs52949823;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=T
3	dbSNP	SNV	55457	55457	.	+	.	ID=5265;Variant_seq=G;Dbxref=dbSNP_129:rs53600974;ensembl_failure_reason=Variant maps to more than one genomic location;Reference_seq=C
3	dbSNP	SNV	55517	55517	.	+	.	ID=5266;Variant_seq=T;Dbxref=dbS