grain_icon Markers Home | Markers Search | View Map Sets | SSR Markers Resource | Help | Tutorial | FAQs

Panel of 50 standard SSR markers

SSR panels labeled for the ABI3730

Marker Chr. Position cM TIGRv3 Forward Primer (Labeled) Reverse Primer Anneal temp  PCR Cycles Panel Label Color Pooling conc. Min Allele Max Allele
RM495* 1 2.8 213775 aatccaaggtgcagagatgg caacgatgacgaacacaacc 55 30 8 6FAM blue 1x 148 160
RM1 1 29.7 4633595 gcgaaaacacaatgcaaaaa gcgttggttggacctgac 55 30 2 PET red 1x 67 119
RM283* 1 31.4 4883717 gtctacatgtacccttgttggg cggcatgagagtctgtgatg 61 30 4 NED yellow 1x 130 176
RM259 1 54.2 7443424 tggagtttgagaggaggg cttgttgcatggtgccatgt 55 30 1 6FAM blue 2x 133 186
RM312 1 71.6 14890771 gtatgcatatttgataagag aagtcaccgagtttaccttc 55 30 1 6FAM blue 1x 86 106
RM5 1 94.9 23952076 tgcaacttctagctgctcga gcatccgatcttgatggg 57 30 5 VIC green 1x 94 138
RM237* 1 115.2 26795365 caaatcccgactgctgtcc tgggaagagagcactacagc 55 30 6 VIC green 1x 105 153
RM431* 1 178.3 38874702 tcctgcgaactgaagagttg agagcaaaaccctggttcac 55 30 2 VIC green 1x 233 261
RM154* 2 4.8 1083895 accctctccgcctcgcctcctc ctcctcctcctgcgaccgctcc 61 30 9 PET red 1x 148 230
RM452* 2 58.4 9564377 ctgatcgagagcgttaaggg gggatcaaaccacgtttctg 61 30 1 6FAM blue 1x 192 213
RM489 3 29.2 4316348 acttgagacgatcggacacc tcacccatggatgttgtcag 55 30 4 PET red 2x 223 289
OSR13* 3 53.1 7109988 catttgtgcgtcacggagta agccacagcgcccatctctc 53 40 3 VIC green 1x 85 122
RM338* 3 108.4 13210600 cacaggagcaggagaagagc ggcaaaccgatcactcagtc 55 40 1 VIC green 1x 178 184
RM55 3 168.2 29002484 ccgtcgccgtagtagagaag tcccggttattttaaggcg 55 30 1 NED yellow 1x 216 247
RM514* 3 216.4 35229618 agattgatctcccattcccc cacgagcatattactagtgg 55 30 4 VIC green 1x 229 278
RM307 4 0 12979675 gtactaccgacctaccgttcac ctgctatgcatgaactgctc 55 30 3 NED yellow 1x 116 191
RM124* 4 150.1 34485157 atcgtctgcgttgcggctgctg catggatcaccgagctcccccc 67 30 2 6FAM blue 1x 257 289
RM507* 5 0 71397 cttaagctccagccgaaatg ctcaccctcatcatcgcc 55 30 2 NED yellow 1x 234 257
RM413* 5 26.7 2181391 ggcgattcttggatgaagag tccccaccaatcttgtcttc 53 30 1 PET red 1x 71 114
RM161* 5 96.9 20714463 tgcagatgagaagcggcgcctc tgtgtcatcagacggcgctccg 61 30 9 6FAM blue 1x 154 187
RM178 5 118.8 24923084 tcgcgtgaaagataagcggcgc gatcaccgttccctccgcctgc 69 30 1 NED yellow 1x 112 131
RM334 5 141.8 28285978 gttcagtgttcagtgccacc gactttgatctttggtggacg 55 30 9 VIC green 2x 119 207
RM133* 6 0 226944 ttggattgttttgctggctcgc ggaacacggggtcggaagcgac 63 30 9 NED yellow 1x 226 237
RM510 6 20.8 2831513 aaccggattagtttctcgcc tgaggacgacgagcagattc 57 30 4 VIC green 1x 99 127
RM454 6 99.3 23336824 ctcaagcttagctgctgctg gtgatcagtgcaccatagcg 55 30 3 NED yellow 1x 249 292
RM162* 6 108.3 23991705 gccagcaaaaccagggatccgg caaggtcttgtgcggcttgcgg 61 30 3 PET red 1x 191 244
RM125* 7 24.8 5478776 atcagcagccatggcagcgacc aggggatcatgtgccgaaggcc 63 30 6 6FAM blue 1x 105 147
RM11 7 47 19256213 tctcctcttcccccgatc atagcgggcgaggcttag 55 30 6 PET red 2x 118 151
RM455* 7 65.7 22349919 aacaacccaccacctgtctc agaaggaaaagggctcgatc 57 30 7 PET red 1x 127 144
RM118* 7 96.9 26635903 ccaatcggagccaccggagagc cacatcctccagcgacgccgag 67 30 7 6FAM blue 1x 149 165
RM408* 8 0 119935 caacgagctaacttccgtcc actgctacttgggtagctgacc 55 30 3 6FAM blue 1x 112 128
RM152* 8 9.4 677616 gaaaccaccacacctcaccg ccgtagaccttcttgaagtag 53 40 8 PET red 1x 133 157
RM25 8 52.2 4372113 ggaaagaatgatcttttcatgg ctaccatcaaaaccaatgttc 53 40 1 PET red 2x 121 159
RM44* 8 60.9 11753077 acgggcaatccgaacaacc tcgggaaaacctaccctacc 53 30 4 6FAM blue 2x 82 132
RM284* 8 83.7 21012223 atctctgatactccatccatcc cctgtacgttgatccgaagc 55 30 6 NED yellow 1x 139 159
RM433* 8 116 25691233 tgcgctgaactaaacacagc agacaaacctggccattcac 53 40 7 PET red 1x 216 248
RM447* 8 124.6 26416867 cccttgtgctgtctcctctc acgggcttcttctccttctc 55 30 5 PET red 2x 95 146
RM316* 9 1.8 1022645 ctagttgggcatacgatggc acgcttatatgttacgtcaac 55 30 7 VIC green 1x 194 216
RM105 9 32.1 12496919 gtcgtcgacccatcggagccac tggtcgaggtggggatcgggtc 63 30 5 6FAM blue 1x 100 141
RM215* 9 99.4 20837148 caaaatggagcagcaagagc tgagcacctccttctctgtag 55 30 2 VIC green 1x 126 161
RM474 10 0 1798783 aagatgtacgggtggcattc tatgagctggtgagcaatgg 55 30 7 6FAM blue 2x 216 288
RM271* 10 59.4 16202474 tcagatctacaattccatcc tcggtgagacctagagagcc 55 30 2 6FAM blue 1x 80 120
RM171 10 73 18614310 aacgcgaggacacgtacttac acgagatacgtacgcctttg 55 40 3 6FAM blue 1x 307 347
RM484* 10 97.3 20630348 tctccctcctcaccattgtc tgctgccctctctctctctc 55 30 5 6FAM blue 2x 286 298
RM552 11 40.6 4836203 cgcagttgtggatttcagtg tgctcaacgtttgactgtcc 55 30 6 6FAM blue 1x 167 258
RM536* 11 55.1 8963471 tctctcctcttgtttggctc acacaccaacacgaccacac 55 30 6 PET red 2x 223 247
RM287 11 68.6 16733868 ttccctgttaagagagaaatc gtgtatttggtgaaagcaac 55 30 1 VIC green 1x 82 118
RM144 11 123.2 28158704 tgccctggcgcaaatttgatcc gctagaggagatcagatggtagtgcatg 57 30 4 NED yellow 1x 216 295
RM19 12 20.9 2432429 caaaaacagagcagatgac ctcaagatggacgccaaga 55 30 5 PET red 1x 192 250
RM277* 12 57.2 18286130 cggtcaaatcatcacctgac caaggcttgcaagggaag 55 30 2 VIC green 1x 104 121
*panel of 30